Linear mitochondrial DNAs of yeasts: closed-loop structure of the termini and possible linear-circular conversion mechanisms.

The terminal structure of the linear mitochondrial DNA (mtDNA) from three yeast species has been examined. By enzymatic digestion, alkali denaturation, and sequencing of cloned termini, it was shown that in Pichia pijperi and P. jadinii, both termini of the linear mtDNA were made of a single-stranded loop covalently joining the two strands, as in the case of vaccinia virus DNA. The left and right loop sequences were in either of two orientations, suggesting the existence of a flip-flop inversion mechanism. Contiguous to the terminal loops, inverted terminal repeats were present. The mtDNA from Williopsis mrakii seems to have an analogous structure, although terminal loops could not be directly demonstrated. Electron microscopy revealed the presence, among linear molecules, of a small number of circular DNAs, mostly of monomer length. Linear and circular models of replication are considered, and possible conversion mechanisms between linear and circular forms are discussed. A flip-flop inversion mechanism between the inverted repeat sequences within a circular intermediate may be involved in the generation of the linear form of mtDNA.

Linear mitochondrial DNAs of yeasts: frequency of occurrence and general features.

In most yeast species, the mitochondrial DNA (mtDNA) has been reported to be a circular molecule. However, two cases of linear mtDNA with specific termini have previously been described. We examined the frequency of occurrence of linear forms of mtDNA among yeasts by pulsed-field gel electrophoresis. Among the 58 species from the genera Pichia and Williopsis that we examined, linear mtDNA was found with unexpectedly high frequency. Thirteen species contained a linear mtDNA, as confirmed by restriction mapping, and labeling, and electron microscopy. The mtDNAs from Pichia pijperi, Williopsis mrakii, and P. jadinii were studied in detail. In each case, the left and right terminal fragments shared homologous sequences. Between the terminal repeats, the order of mitochondrial genes was the same in all of the linear mtDNAs examined, despite a large variation of the genome size. This constancy of gene order is in contrast with the great variation of gene arrangement in circular mitochondrial genomes of yeasts. The coding sequences determined on several genes were highly homologous to those of the circular mtDNAs, suggesting that these two forms of mtDNA are not of distant origins.

Transcriptional organization of the S10, spc and alpha operons of Escherichia coli.

We have investigated the transcription patterns at the inter-operon regions between the S10 and spc, and spc and alpha ribosomal protein operons of Escherichia coli. Newly synthesized transcripts were characterized by RNase T1 protection experiments, and accumulated transcripts were mapped with S1 nuclease. With both techniques we found that about 75% of the RNA polymerases transcribing the S10 operon terminated at the position of a typical rho-independent terminator. In contrast, most or all RNA polymerases transcribing the spc operon continued into the alpha operon. Nevertheless, we observed that about 30% of the transcripts of the alpha operon were initiated at the alpha operon promoter.

Diphthamide synthesis in Saccharomyces cerevisiae: structure of the DPH2 gene.

A gene involved in diphthamide biosynthesis, DPH2, was cloned from Saccharomyces cerevisiae by complementation of a diphthamide mutant. DPH2 exists as a single-copy gene in the yeast genome and is located on the left arm of chromosome XI. Sequence analysis of the DPH2 locus predicts that the DPH2 gene product is a 534-amino acid (aa) protein, with a calculated M(r) of 59,772. This conclusion was supported by Northern blot analysis of the DPH2 transcript and gel analysis of the DPH2 protein overproduced in Escherichia coli. Gene disruption studies indicate that the DPH2 gene is not essential for viability of yeast. The role of DPH2 in diphthamide biosynthesis is discussed.

Mapping of murine interferon-alpha genes to chromosome 4.

A cDNA library was constructed from polysomal poly(A)+RNA from Newcastle disease virus (NDV)-induced mouse C243 cells, and screened with a human interferon-alpha (HuIFN-alpha) cDNA probe. A cDNA clone for one of the murine interferon-alpha (MuIFN-alpha) genes was isolated, and sequencing analysis revealed that it was a partial copy which is almost identical to the published sequence for the MuIFN-alpha 2 gene. This partial cDNA clone represents a virus-induced message as seen by Northern blot analysis of RNA from NDV-induced C243 cells, and Southern blot analysis of DNA from BALB/c mouse revealed the presence of a multiple IFN-alpha gene family. The MuIFN-alpha genes were mapped to chromosome 4 by Southern blot analysis of hamster/mouse somatic cell hybrid DNAs.

Transforming potential of the v-myb oncogene from avian myeloblastosis virus: alterations in the oncogene product may reveal a new target specificity.

Transfection of brown leghorn chicken embryo fibroblasts by DNA containing v-myb sequences cloned either in a complete AMV proviral DNA or in a retroviral derived vector has led to the isolation of two kinds of transformed cells. A characterization of the proviral sequences retained and expressed in these transformed cells revealed that they contained either new or altered v-myb-related RNA species. The experiments presented in this paper also show that both types of transformants expressed truncated myb-related polypeptides, suggesting that alterations of the v-myb product may result in a new target specificity, leading to the transformation of chicken embryo fibroblasts.

A computer program allows the separation of a wide range of chromosome sizes by pulsed field gel electrophoresis.

The introduction of Pulsed Field Gel Electrophoresis techniques, which allow the separation of DNA molecules of molecular weights as high as chromosomes of lower eukaryotes, has given a powerful tool to geneticists. The resolution expected from these techniques is dependent on numerous parameters, among them pulse time and field strength. A given set of these parameters allows only a limited range of molecular weights to be resolved. To allow the separation of a broader molecular weight range on a single gel, we designed a computer program, driving a simple switching device, to take care of switching electrodes and power supplies in OFAGE migrations. This program has been designed to be used with any technique calling for periodic switching or inversion of the electric field, and/or variation of the electric field applied during electrophoresis. As an example, we show the results obtained with yeast genera in which chromosome sizes range from 260 to 9,000 kilobase pairs.

Erythromycin and spiramycin resistance mutations of yeast mitochondria: nature of the rib2 locus in the large ribosomal RNA gene.

Two linked genetic loci, rib 2 and rib 3, of yeast mitochondrial genome are the sites of mutations that confer resistance to erythromycin and/or spiramycin. We have examined two mutations at the rib 2 locus. Mutation ER354 was found at the nucleotide position 3993 of the large ribosomal RNA gene; it corresponded to a C to G transversion leading to a double resistance to erythromycin and spiramycin. Mutation SR551 was found also at the same position, but the C was replaced by a T, conferring resistance to spiramycin only. Rib 2 and rib 3 are 836 base pairs apart on the gene sequence, but are very close to each other in the secondary structure of ribosomal RNA.

Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. II. Biochemistry.

1. Several nuclear mutants have been isolated which showed thermo- or cryo-sensitive growth on non-fermentable media. Although the original strain carried mitochondrial drug resistance mutations (CR, ER, OR and PR), the resistance to one or several drugs was suppressed in these mutants. Two of them showed a much reduced amount of the mitochondrial small ribosomal subunit (37S) and of the corresponding 16S ribosomal RNA. Two dimensional electrophoretic analysis did not reveal any change in the position of any of the mitochondrial ribosomal proteins. However one of the mitochondrial ribosomal proteins. However one of the mutants showed a striking decrease in the amounts of three ribosomal proteins S3, S4 and S15. 2. Four temperature-sensitive mitochondrial mutations have been localized in the region of the gene coding for the large mitochondrial ribosomal RNA (23S). These mutants all showed a marked anomaly in the mitochondrial large ribosomal subunit (50S) and/or the corresponding 23S ribosomal RNA.

Analysis of chromosomal DNA patterns of the genus Kluyveromyces.

Using an improved procedure of pulsed field gel electrophoresis, yeast chromosomes were separated over a wide range of molecular size (250-4000 kbp) on single gels. The chromosomal DNA patterns of all the species belonging to the genus Kluyveromyces were examined. Within the species K. marxianus, the varieties lactis, drosophilarum and vanudenii showed closely related patterns: very different from them, the varieties bulgaricus and marxianus were related to each other, forming a distinct group; the strains commonly called 'K. lactis' and 'K. fragilis' were unambiguously different from each other in chromosome patterns. These differences were correlated with the presence of characteristic repetitive sequence elements in the mitochondrial DNA of the former group and not in the latter. Analysis of Candida macedoniensis, which had been considered to be an anamorph of K. marxianus var. marxianus, showed that these two yeast species were indeed similar in chromosome patterns and in mitochondrial DNA restriction patterns.

Analysis of mitochondrial ribosomal proteins of Saccharomyces cerevisiae by two dimensional polyacrylamide gel electrophoresis.

Proteins from mitochondrial ribosomes of Saccharomyces cerevisiae were analysed by a two dimensional gel electrophoresis method. Each ribosomal subunit revealed a reproducible characteristic pattern of protein components. The 37S small subunit contained 33 protein species with an average molecular weight of 27,300 daltons (ranging from 60,000 to 95000 daltons). The 50S large subunit showed 38 protein species with an average molecular weight of 23,000 (ranging from 41,000 to 10,000 daltons). Ribosomes from various sources were compared on the basis of protein composition.

Identification of two erythromycin resistance mutations in the mitochondrial gene coding for the large ribosomal RNA in yeast.

Two independent erythromycin resistance mutations, ER514 and ER221, have been identified in the mitochondrial gene coding for the 21S ribosomal RNA. The two mutations were found to be identical, corresponding to a A to G transition at the nucleotide position 1951 of the ribosomal RNA gene. In the secondary structure model of the ribosomal RNA, the ER resistance site is found at the proximity of the chloramphenicol resistance sites located about 500 bases downstream.

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Unequal excision of complementary strands is involved in the generation of palindromic repetitions of rho- mitochondrial DNA in yeast.

In the rho- mutants of yeast, the mitochondrial genome is made up of a small segment excised from the wild-type mitochondrial DNA. The segment is repeated either in tandem or in palindrome to form a series of multimeric DNAs. We have asked how the palindromic organization arises. From several palindromic rho- mitochondrial DNAs, we have isolated the restriction fragments that contained the head-to-head or tail-to-tail junction of the repeating units, and have determined their nucleotide sequences. We found that the palindromes were not symmetrical right up to the junction points: at the junction, there was always an asymmetrical sequence of variable length. At both ends of this junction sequence, we found inverted oligonucleotide sequences that were variable in each mutant and that were present in the wild-type DNA. At the moment of excision, a single-strand cut seems to occur at each of these short inverted repeats, in such a way that the two complementary strands of the genome are cut unequally and the single-stranded overhangs become the junction sequences between the palindromic repeating units. This scheme may account for the complex structures of many rho- mitochondrial DNAs.

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.

[Nucleotide sequence of the gene for the mitochondrial 15S ribosomal RNA of yeast]. / Séquence nucléotidique du gène de l'ARN ribosomique 15S mitochondrial de la levure.

We have determined the nucleotide sequence of a DNA segment carrying the entire 15S ribosomal RNA gene of yeast mitochondrial genome. Many stretches of sequence are present which are homologous to the E. coli 16S ribosomal RNA gene. The gene sequence can be folded into a secondary structure according to the [1] model on bacterial ribosomal RNAs. The structure reveals a striking similarity between the two RNAs despite the large difference in their base compositions. In the middle of the gene, we found a guanine-cytosine rich sequence that is also present in several other regions of the mitochondrial genome.

Cloning and DNA sequence determination of the L11 ribosomal protein operon of Serratia marcescens and Proteus vulgaris: translational feedback regulation of the Escherichia coli L11 operon by heterologous L1 proteins.

In Escherichia coli the genes encoding ribosomal proteins L11 (rplK) and L1 (rplA) are contained in a single operon and their expression is translationally regulated by L1. We have cloned the homologous genes from two other enterobacteria, Serratia marcescens and Proteus vulgaris, and determined nucleotide sequences. The genes are organized in a similar way to that found in E. coli. Conservation of nucleotide and amino acid sequences relative to E. coli in the protein coding regions are 89.2% and 94.7% for S. marcescens, and 80.9% and 88.6% for P. vulgaris. Nucleotide sequences of L11 mRNA leader regions were strongly conserved for the primary as well as the secondary structures in the L1 target site. We have also constructed plasmids carrying E. coli L11 and either P. vulgaris or S. marcescens L1 genes fused to the lac promoter, with or without the E. coli leader containing the L1 target site. Induction of transcription of the operons possessing the E. coli mRNA leader did not lead to overproduction of L11, indicating translational regulation of the chimeric operon as well as the chromosomal operon by the plasmid encoded L1. Repression of the chromosomal L11 operon was directly demonstrated upon induction of the chimeric operons without the leader, which also lack the L11 initiation signal but have a mutation allowing L1 translation.(ABSTRACT TRUNCATED AT 250 WORDS)

Inverted terminal repetitions of the two linear DNA associated with the killer character of the yeast Kluyveromyces lactis.

The killer character of some Kluyveromyces lactis strains is associated with the presence of two linear double-stranded DNA, pGKl-1 (or k1) and pGKl-2 (or k2). Nucleotide sequencing has revealed that each DNA has inverted terminal repetitions of about 200 base-pairs whose 5' ends seem to be blocked. The repetitions of the two DNA do not share extensive sequence homology. The role of these repetitions in the replication of killer DNA is discussed.

A fine restriction map of the linear mitochondrial DNA of Tetrahymena pyriformis: genome size, map locations of rRNA and tRNA genes, terminal inversion repeat, and restriction site polymorphism.

A fine restriction map of the linear mitochondrial DNA of Tetrahymena pyriformis strain ST is presented. 1. Based on agarose gel electrophoresis data together with limited nucleotide sequences available on some restriction fragments, we estimate the actual size of this genome to be about 55,000 base pairs. 2. Seven tRNA gene locations have been assigned, which are scattered along the genome length. Six of these locations encode the genes for tRNA(phe), tRNA(his), tRNA(trp), and tRNA(glu), and the duplicate tRNA(tyr) genes which are located at the inverted terminal repeat segments. The tRNA gene(s) encoded in one location has not been identified. We have not yet found the tRNA(leu) and tRNA(met) genes, which were previously shown to be encoded in the genome (Chiu et al. 1974; Suyama 1982). 3. We have mapped the 14S rRNA gene by sequencing the 170 bp segment of EcoRI fragment 8 and by aligning its sequence with E. coli 16S rRNA. From our recent complete sequence data the gene size was found to be about 1,650 bp, which is unexpectedly large for the 14S rRNA which has an estimated size of 1,300 bp. The 14S rRNA is probably a cleavage product of the larger primary transcript of which 200-300 bases of the 5' end are missing. 4. The duplicate copies of the 21S rRNA gene at the terminal duplication inversion segments were analyzed. ClaI fragment 7 (1,500 bp) corresponds in sequence from base position 850 to 2,390 of the 20S rRNA gene of Paramecium mitochondrial DNA (Seilhamer et al. 1984b). The 21S gene is approximately 2,500 bp long. The presence of some restriction site polymorphism is apparent in this segment. 5. Each of the 21S gene copies precedes the tRNA(tyr) gene, but the space flanking one tRNA(tyr) gene differs in size and restriction sites from the space flanking another tRNA(tyr) gene. Thus, this space corresponds to the segment of an imperfect match in the terminal duplication inversion of Goldbach et al. (1978a). 6. Saccharomyces cerevisiae mitochondrial probes including Cob, ATPase VI and IX, and cytochrome oxidase I gene sequences, 21S and 15S rRNAs, and mouse mitochondrial DNA showed no significant hybridization with any restriction fragments of Tetrahymena mitochondrial DNA. The results are in accordance with an extensive sequence divergence previously found in the Tetrahymena mitochondrial genome (Goldbach et al. 1977).

DNA sequence analysis of the VPH1-SNF2 region on chromosome XV of Saccharomyces cerevisiae.

The nucleotide sequence of a 37 000 base pair region from the left arm of chromosome XV of Saccharomyces cerevisiae has been determined and analysed. This region contains 21 open reading frames (ORFs) coding for proteins of more than 100 amino acids. Six ORFs correspond to the genes PAC1, VPH1, MOD5, CAP20, ORF1 and SNF2 already described. Eight ORFs show some similarities to known genes from yeast and other organisms. They include genes coding for serine/threonine protein kinases, a multidrug resistance family homologue, a protein related to dihydrofolate reductase, a cluster of heat shock-like proteins and a gene coding for an enzyme related to protein disulfide isomerase. Finally seven ORFs do not show any similarities with a known gene. In addition we found a new ala-tRNA (UGC) gene located next to a sigma sequence.