Phenotyping xylem connections in grafted plants using X-ray micro-computed tomography.

Plants are able to naturally graft or inosculate their trunks, branches and roots together, this mechanism is used by humans to graft together different genotypes for a range of purposes. Grafts are considered successful if functional vascular connections between the two genotypes occur. Various techniques can evaluate xylem connections across the graft interface. However, these methods are generally unable to assess the heterogeneity and three-dimensional (3D) structure of xylem vessel connections. Here we present the use of X-ray micro-computed tomography to characterize the 3D morphology of grafts of grapevine. We show that xylem vessels form between the two plants of natural root and human-made stem grafts. The main novelty of this methodology is that we were able to visualize the 3D network of functional xylem vessels connecting the scion and rootstock in human-made stem grafts thanks to the addition of a contrast agent to the roots and improved image analysis pipelines. In addition, we reveal the presence of extensive diagonal xylem connections between the main axial xylem vessels in 2-year old grapevine stems. In conclusion, we present a method that has the potential to provide new insights into the structure and function of xylem vessels in large tissue samples.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

End-to-end multimodal 3D imaging and machine learning workflow for non-destructive phenotyping of grapevine trunk internal structure.

Quantifying healthy and degraded inner tissues in plants is of great interest in agronomy, for example, to assess plant health and quality and monitor physiological traits or diseases. However, detecting functional and degraded plant tissues in-vivo without harming the plant is extremely challenging. New solutions are needed in ligneous and perennial species, for which the sustainability of plantations is crucial. To tackle this challenge, we developed a novel approach based on multimodal 3D imaging and artificial intelligence-based image processing that allowed a non-destructive diagnosis of inner tissues in living plants. The method was successfully applied to the grapevine (Vitis vinifera L.). Vineyard's sustainability is threatened by trunk diseases, while the sanitary status of vines cannot be ascertained without injuring the plants. By combining MRI and X-ray CT 3D imaging with an automatic voxel classification, we could discriminate intact, degraded, and white rot tissues with a mean global accuracy of over 91%. Each imaging modality contribution to tissue detection was evaluated, and we identified quantitative structural and physiological markers characterizing wood degradation steps. The combined study of inner tissue distribution versus external foliar symptom history demonstrated that white rot and intact tissue contents are key-measurements in evaluating vines' sanitary status. We finally proposed a model for an accurate trunk disease diagnosis in grapevine. This work opens new routes for precision agriculture and in-situ monitoring of tissue quality and plant health across plant species.

Identifying early metabolite markers of successful graft union formation in grapevine.

Grafting is an important horticultural technique used for many crop species. However, some scion/rootstock combinations are considered as incompatible due to poor graft union formation and subsequently high plant mortality. The early identification of graft incompatibility could allow the selection of non-viable plants before planting and would have a beneficial impact on research and development in the nursery sector. In general, visible phenotypes of grafted plants (size, root number, etc.) are poorly correlated with grafting success, but some studies have suggested that some polyphenols could be used as markers of graft incompatibility several months or years after grafting. However, much of the previous studies into metabolite markers of grafting success have not included all the controls necessary to unequivocally validate the markers proposed. In this study, we quantified 73 primary and secondary metabolites in nine hetero-grafts and six homo-grafted controls 33 days after grafting at the graft interface and in both the scion and rootstock woody tissues. Certain biomarker metabolites typical of a high stress status (such as proline, GABA and pallidol) were particularly accumulated at the graft interface of the incompatible scion/rootstock combination. We then used correlation analysis and generalized linear models to identify potential metabolite markers of grafting success measured one year after grafting. Here we present the first attempt to quantitatively predict graft compatibility and identify marker metabolites (especially asparagine, trans-resveratrol, trans-piceatannol and α-viniferin) 33 days after grafting, which was found to be particularly informative for homo-graft combinations.

Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool.

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.