Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 305
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Cell ; 186(4): 693-714, 2023 02 16.
Artigo em Inglês | MEDLINE | ID: mdl-36803602

RESUMO

Decades of research have identified genetic factors and biochemical pathways involved in neurodegenerative diseases (NDDs). We present evidence for the following eight hallmarks of NDD: pathological protein aggregation, synaptic and neuronal network dysfunction, aberrant proteostasis, cytoskeletal abnormalities, altered energy homeostasis, DNA and RNA defects, inflammation, and neuronal cell death. We describe the hallmarks, their biomarkers, and their interactions as a framework to study NDDs using a holistic approach. The framework can serve as a basis for defining pathogenic mechanisms, categorizing different NDDs based on their primary hallmarks, stratifying patients within a specific NDD, and designing multi-targeted, personalized therapies to effectively halt NDDs.


Assuntos
Doenças Neurodegenerativas , Humanos , Doenças Neurodegenerativas/patologia , Proteostase , Agregação Patológica de Proteínas/metabolismo , Morte Celular , Citoesqueleto/metabolismo
2.
Cell ; 174(6): 1559-1570.e22, 2018 09 06.
Artigo em Inglês | MEDLINE | ID: mdl-30100185

RESUMO

The urea cycle (UC) is the main pathway by which mammals dispose of waste nitrogen. We find that specific alterations in the expression of most UC enzymes occur in many tumors, leading to a general metabolic hallmark termed "UC dysregulation" (UCD). UCD elicits nitrogen diversion toward carbamoyl-phosphate synthetase2, aspartate transcarbamylase, and dihydrooratase (CAD) activation and enhances pyrimidine synthesis, resulting in detectable changes in nitrogen metabolites in both patient tumors and their bio-fluids. The accompanying excess of pyrimidine versus purine nucleotides results in a genomic signature consisting of transversion mutations at the DNA, RNA, and protein levels. This mutational bias is associated with increased numbers of hydrophobic tumor antigens and a better response to immune checkpoint inhibitors independent of mutational load. Taken together, our findings demonstrate that UCD is a common feature of tumors that profoundly affects carcinogenesis, mutagenesis, and immunotherapy response.


Assuntos
Genômica , Metabolômica , Neoplasias/patologia , Ureia/metabolismo , Sistemas de Transporte de Aminoácidos Básicos/metabolismo , Animais , Aspartato Carbamoiltransferase/genética , Aspartato Carbamoiltransferase/metabolismo , Carbamoil Fosfato Sintase (Glutamina-Hidrolizante)/genética , Carbamoil Fosfato Sintase (Glutamina-Hidrolizante)/metabolismo , Linhagem Celular Tumoral , Di-Hidro-Orotase/genética , Di-Hidro-Orotase/metabolismo , Feminino , Humanos , Camundongos , Camundongos Endogâmicos C57BL , Camundongos SCID , Proteínas de Transporte da Membrana Mitocondrial , Neoplasias/metabolismo , Ornitina Carbamoiltransferase/antagonistas & inibidores , Ornitina Carbamoiltransferase/genética , Ornitina Carbamoiltransferase/metabolismo , Fosforilação/efeitos dos fármacos , Pirimidinas/biossíntese , Pirimidinas/química , Interferência de RNA , RNA Interferente Pequeno/metabolismo , Sirolimo/farmacologia , Serina-Treonina Quinases TOR/antagonistas & inibidores , Serina-Treonina Quinases TOR/metabolismo
3.
Bioconjug Chem ; 35(4): 517-527, 2024 Apr 17.
Artigo em Inglês | MEDLINE | ID: mdl-38482815

RESUMO

Purpose: This study was motivated by the need for better positron emission tomography (PET)-compatible tools to image bacterial infection. Our previous efforts have targeted bacteria-specific metabolism via assimilation of carbon-11 labeled d-amino acids into the bacterial cell wall. Since the chemical determinants of this incorporation are not fully understood, we sought a high-throughput method to label d-amino acid derived structures with fluorine-18. Our strategy employed a chemical biology approach, whereby an azide (-N3) bearing d-amino acid is incorporated into peptidoglycan muropeptides, with subsequent "click" cycloaddition with an 18F-labeled strained cyclooctyne partner. Procedures: A water-soluble, 18F-labeled and dibenzocyclooctyne (DBCO)-derived radiotracer ([18F]FB-sulfo-DBCO) was synthesized. This tracer was incubated with pathogenic bacteria treated with azide-bearing d-amino acids, and incorporated 18F was determined via gamma counting. In vitro uptake in bacteria previously treated with azide-modified d-amino acids was compared to that in cultures treated with amino acid controls. The biodistribution of [18F]FB-sulfo-DBCO was studied in a cohort of healthy mice with implications for future in vivo imaging. Results: The new strain-promoted azide-alkyne cycloaddition (SPAAC) radiotracer [18F]FB-sulfo-DBCO was synthesized with high radiochemical yield and purity via N-succinimidyl 4-[18F]fluorobenzoate ([18F]SFB). Accumulation of [18F]FB-sulfo-DBCO was significantly higher in several bacteria treated with azide-modified d-amino acids than in controls; for example, we observed 7 times greater [18F]FB-sulfo-DBCO ligation in Staphylococcus aureus cultures incubated with 3-azido-d-alanine versus those incubated with d-alanine. Conclusions: The SPAAC radiotracer [18F]FB-sulfo-DBCO was validated in vitro via metabolic labeling of azide-bearing peptidoglycan muropeptides. d-Amino acid-derived PET radiotracers may be more efficiently screened via [18F]FB-sulfo-DBCO modification.


Assuntos
Azidas , Peptidoglicano , Humanos , Animais , Camundongos , Azidas/química , Distribuição Tecidual , Tomografia por Emissão de Pósitrons , Bactérias , Aminoácidos , Alanina , Radioisótopos de Flúor/química
4.
Int J Mol Sci ; 25(13)2024 Jun 29.
Artigo em Inglês | MEDLINE | ID: mdl-39000326

RESUMO

Decades of research have identified genetic and environmental factors involved in age-related neurodegenerative diseases and, to a lesser extent, neuropsychiatric disorders. Genomic instability, i.e., the loss of genome integrity, is a common feature among both neurodegenerative (mayo-trophic lateral sclerosis, Parkinson's disease, Alzheimer's disease) and psychiatric (schizophrenia, autism, bipolar depression) disorders. Genomic instability is associated with the accumulation of persistent DNA damage and the activation of DNA damage response (DDR) pathways, as well as pathologic neuronal cell loss or senescence. Typically, DDR signaling ensures that genomic and proteomic homeostasis are maintained in both dividing cells, including neural progenitors, and post-mitotic neurons. However, dysregulation of these protective responses, in part due to aging or environmental insults, contributes to the progressive development of neurodegenerative and/or psychiatric disorders. In this Special Issue, we introduce and highlight the overlap between neurodegenerative diseases and neuropsychiatric disorders, as well as the emerging clinical, genomic, and molecular evidence for the contributions of DNA damage and aberrant DNA repair. Our goal is to illuminate the importance of this subject to uncover possible treatment and prevention strategies for relevant devastating brain diseases.


Assuntos
Dano ao DNA , Instabilidade Genômica , Transtornos Mentais , Doenças Neurodegenerativas , Animais , Humanos , Reparo do DNA , Transtornos Mentais/metabolismo , Transtornos Mentais/etiologia , Transtornos Mentais/genética , Doenças Neurodegenerativas/metabolismo , Doenças Neurodegenerativas/genética
5.
J Infect Dis ; 228(Suppl 4): S249-S258, 2023 10 03.
Artigo em Inglês | MEDLINE | ID: mdl-37788506

RESUMO

Although nearly a century has elapsed since the discovery of penicillin, bacterial infections remain a major global threat. Global antibiotic use resulted in an astounding 42 billion doses of antibiotics administered in 2015 with 128 billion annual doses expected by 2030. This overuse of antibiotics has led to the selection of multidrug-resistant "super-bugs," resulting in increasing numbers of patients being susceptible to life-threatening infections with few available therapeutic options. New clinical tools are therefore urgently needed to identify bacterial infections and monitor response to antibiotics, thereby limiting overuse of antibiotics and improving overall health. Next-generation molecular imaging affords unique opportunities to target and identify bacterial infections, enabling spatial characterization as well as noninvasive, temporal monitoring of the natural course of the disease and response to therapy. These emerging noninvasive imaging approaches could overcome several limitations of current tools in infectious disease, such as the need for biological samples for testing with their associated sampling bias. Imaging of living bacteria can also reveal basic biological insights about their behavior in vivo.


Assuntos
Infecções Bacterianas , Humanos , Infecções Bacterianas/diagnóstico por imagem , Infecções Bacterianas/tratamento farmacológico , Antibacterianos/uso terapêutico , Bactérias , Penicilinas/uso terapêutico , Imagem Molecular
6.
J Infect Dis ; 228(Suppl 4): S281-S290, 2023 10 03.
Artigo em Inglês | MEDLINE | ID: mdl-37788505

RESUMO

BACKGROUND: Vertebral discitis-osteomyelitis (VDO) is a devastating infection of the spine that is challenging to distinguish from noninfectious mimics using computed tomography and magnetic resonance imaging. We and others have developed novel metabolism-targeted positron emission tomography (PET) radiotracers for detecting living Staphylococcus aureus and other bacteria in vivo, but their head-to-head performance in a well-validated VDO animal model has not been reported. METHODS: We compared the performance of several PET radiotracers in a rat model of VDO. [11C]PABA and [18F]FDS were assessed for their ability to distinguish S aureus, the most common non-tuberculous pathogen VDO, from Escherichia coli. RESULTS: In the rat S aureus VDO model, [11C]PABA could detect as few as 103 bacteria and exhibited the highest signal-to-background ratio, with a 20-fold increased signal in VDO compared to uninfected tissues. In a proof-of-concept experiment, detection of bacterial infection and discrimination between S aureus and E coli was possible using a combination of [11C]PABA and [18F]FDS. CONCLUSIONS: Our work reveals that several bacteria-targeted PET radiotracers had sufficient signal to background in a rat model of S aureus VDO to be potentially clinically useful. [11C]PABA was the most promising tracer investigated and warrants further investigation in human VDO.


Assuntos
Discite , Osteomielite , Infecções Estafilocócicas , Humanos , Ratos , Animais , Discite/diagnóstico por imagem , Ácido 4-Aminobenzoico , Escherichia coli , Tomografia por Emissão de Pósitrons/métodos , Infecções Estafilocócicas/diagnóstico por imagem , Osteomielite/microbiologia , Bactérias , Staphylococcus aureus , Compostos Radiofarmacêuticos
7.
J Am Chem Soc ; 145(32): 17632-17642, 2023 08 16.
Artigo em Inglês | MEDLINE | ID: mdl-37535945

RESUMO

Chemoenzymatic techniques have been applied extensively to pharmaceutical development, most effectively when routine synthetic methods fail. The regioselective and stereoselective construction of structurally complex glycans is an elegant application of this approach that is seldom applied to positron emission tomography (PET) tracers. We sought a method to dimerize 2-deoxy-[18F]-fluoro-d-glucose ([18F]FDG), the most common tracer used in clinical imaging, to form [18F]-labeled disaccharides for detecting microorganisms in vivo based on their bacteria-specific glycan incorporation. When [18F]FDG was reacted with ß-d-glucose-1-phosphate in the presence of maltose phosphorylase, the α-1,4- and α-1,3-linked products 2-deoxy-[18F]-fluoro-maltose ([18F]FDM) and 2-deoxy-2-[18F]-fluoro-sakebiose ([18F]FSK) were obtained. This method was further extended with the use of trehalose (α,α-1,1), laminaribiose (ß-1,3), and cellobiose (ß-1,4) phosphorylases to synthesize 2-deoxy-2-[18F]fluoro-trehalose ([18F]FDT), 2-deoxy-2-[18F]fluoro-laminaribiose ([18F]FDL), and 2-deoxy-2-[18F]fluoro-cellobiose ([18F]FDC). We subsequently tested [18F]FDM and [18F]FSK in vitro, showing accumulation by several clinically relevant pathogens including Staphylococcus aureus and Acinetobacter baumannii, and demonstrated their specific uptake in vivo. Both [18F]FDM and [18F]FSK were stable in human serum with high accumulation in preclinical infection models. The synthetic ease and high sensitivity of [18F]FDM and [18F]FSK to S. aureus including methicillin-resistant (MRSA) strains strongly justify clinical translation of these tracers to infected patients. Furthermore, this work suggests that chemoenzymatic radiosyntheses of complex [18F]FDG-derived oligomers will afford a wide array of PET radiotracers for infectious and oncologic applications.


Assuntos
Fluordesoxiglucose F18 , Trealose , Humanos , Celobiose , Staphylococcus aureus , Tomografia por Emissão de Pósitrons/métodos , Bactérias
8.
Nat Immunol ; 12(1): 70-6, 2011 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-21151102

RESUMO

Activation-induced deaminase (AID) initiates diversity of immunoglobulin genes through deamination of cytosine to uracil. Two opposing models have been proposed for the deamination of DNA or RNA by AID. Although most data support DNA deamination, there is no physical evidence of uracil residues in immunoglobulin genes. Here we demonstrate their presence by determining the sensitivity of DNA to digestion with uracil DNA glycosylase (UNG) and abasic endonuclease. Using several methods of detection, we identified uracil residues in the variable and switch regions. Uracil residues were generated within 24 h of B cell stimulation, were present on both DNA strands and were found to replace mainly cytosine bases. Our data provide direct evidence for the model that AID functions by deaminating cytosine residues in DNA.


Assuntos
Linfócitos B/metabolismo , Citidina Desaminase/metabolismo , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo , Uracila-DNA Glicosidase/metabolismo , Animais , Variação Antigênica/genética , Linfócitos B/imunologia , Linfócitos B/patologia , Células Cultivadas , Citidina Desaminase/genética , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/genética , Switching de Imunoglobulina , Região Variável de Imunoglobulina , Interleucina-4/imunologia , Interleucina-4/metabolismo , Lipopolissacarídeos/imunologia , Lipopolissacarídeos/metabolismo , Ativação Linfocitária/genética , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Modelos Químicos , Baço/patologia , Uracila/análise , Uracila-DNA Glicosidase/genética
9.
J Org Chem ; 88(21): 15237-15248, 2023 Nov 03.
Artigo em Inglês | MEDLINE | ID: mdl-37823733

RESUMO

We report the one-pot synthesis of N-CF3 heteroaryl amides (NTFMHA) from heteroaryl carboxylic acids and sterically hindered isothiocyanates, including various amino acid analogues, in the presence of AgF. The key to this reaction is the utilization of free heteroaryl acyl chlorides, rather than their corresponding hydrochloride salts. This method represents a complementary method of our previous work and enables modification to a variety of previously inaccessible structures, including α-tertiary amines and N-CF3-modified pharmaceuticals.

10.
Nucleic Acids Res ; 49(11): 6331-6346, 2021 06 21.
Artigo em Inglês | MEDLINE | ID: mdl-34096589

RESUMO

Cockayne syndrome (CS) is an autosomal recessive genetic disorder characterized by photosensitivity, developmental defects, neurological abnormalities, and premature aging. Mutations in CSA (ERCC8), CSB (ERCC6), XPB, XPD, XPG, XPF (ERCC4) and ERCC1 can give rise to clinical phenotypes resembling classic CS. Using a yeast two-hybrid (Y2H) screening approach, we identified LEO1 (Phe381-Ser568 region) as an interacting protein partner of full-length and C-terminal (Pro1010-Cys1493) CSB in two independent screens. LEO1 is a member of the RNA polymerase associated factor 1 complex (PAF1C) with roles in transcription elongation and chromatin modification. Supportive of the Y2H results, purified, recombinant LEO1 and CSB directly interact in vitro, and the two proteins exist in a common complex within human cells. In addition, fluorescently tagged LEO1 and CSB are both recruited to localized DNA damage sites in human cells. Cell fractionation experiments revealed a transcription-dependent, coordinated association of LEO1 and CSB to chromatin following either UVC irradiation or cisplatin treatment of HEK293T cells, whereas the response to menadione was distinct, suggesting that this collaboration occurs mainly in the context of bulky transcription-blocking lesions. Consistent with a coordinated interaction in DNA repair, LEO1 knockdown or knockout resulted in reduced CSB recruitment to chromatin, increased sensitivity to UVC light and cisplatin damage, and reduced RNA synthesis recovery and slower excision of cyclobutane pyrimidine dimers following UVC irradiation; the absence of CSB resulted in diminished LEO1 recruitment. Our data indicate a reciprocal communication between CSB and LEO1 in the context of transcription-associated DNA repair and RNA transcription recovery.


Assuntos
DNA Helicases/metabolismo , Enzimas Reparadoras do DNA/metabolismo , Reparo do DNA , Proteínas de Ligação a Poli-ADP-Ribose/metabolismo , Fatores de Transcrição/metabolismo , Cromatina/metabolismo , Adutos de DNA , Dano ao DNA , Células HEK293 , Células HeLa , Humanos , Mutagênicos/toxicidade , RNA/biossíntese , Fatores de Transcrição/química , Transcrição Gênica
11.
Int J Mol Sci ; 24(23)2023 Nov 23.
Artigo em Inglês | MEDLINE | ID: mdl-38068959

RESUMO

The ability to quickly discover reliable hits from screening and rapidly convert them into lead compounds, which can be verified in functional assays, is central to drug discovery. The expedited validation of novel targets and the identification of modulators to advance to preclinical studies can significantly increase drug development success. Our SaXPyTM ("SAR by X-ray Poses Quickly") platform, which is applicable to any X-ray crystallography-enabled drug target, couples the established methods of protein X-ray crystallography and fragment-based drug discovery (FBDD) with advanced computational and medicinal chemistry to deliver small molecule modulators or targeted protein degradation ligands in a short timeframe. Our approach, especially for elusive or "undruggable" targets, allows for (i) hit generation; (ii) the mapping of protein-ligand interactions; (iii) the assessment of target ligandability; (iv) the discovery of novel and potential allosteric binding sites; and (v) hit-to-lead execution. These advances inform chemical tractability and downstream biology and generate novel intellectual property. We describe here the application of SaXPy in the discovery and development of DNA damage response inhibitors against DNA polymerase eta (Pol η or POLH) and apurinic/apyrimidinic endonuclease 1 (APE1 or APEX1). Notably, our SaXPy platform allowed us to solve the first crystal structures of these proteins bound to small molecules and to discover novel binding sites for each target.


Assuntos
DNA Polimerase Dirigida por DNA , Descoberta de Drogas , DNA Polimerase Dirigida por DNA/metabolismo , Sítios de Ligação , Endonucleases/metabolismo , Cristalografia por Raios X , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo
12.
Biochemistry ; 61(15): 1614-1624, 2022 08 02.
Artigo em Inglês | MEDLINE | ID: mdl-35797480

RESUMO

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).


Assuntos
MicroRNAs , Nucleosídeos , Trifosfato de Adenosina , Citidina Trifosfato , MicroRNAs/genética , RNA Nucleotidiltransferases , Uridina Monofosfato/metabolismo , Uridina Trifosfato
13.
Am J Hum Genet ; 105(2): 237-257, 2019 08 01.
Artigo em Inglês | MEDLINE | ID: mdl-31374202

RESUMO

Genetic information is constantly being attacked by intrinsic and extrinsic damaging agents, such as reactive oxygen species, atmospheric radiation, environmental chemicals, and chemotherapeutics. If DNA modifications persist, they can adversely affect the polymerization of DNA or RNA, leading to replication fork collapse or transcription arrest, or can serve as mutagenic templates during nucleic acid synthesis reactions. To combat the deleterious consequences of DNA damage, organisms have developed complex repair networks that remove chemical modifications or aberrant base arrangements and restore the genome to its original state. Not surprisingly, inherited or sporadic defects in DNA repair mechanisms can give rise to cellular outcomes that underlie disease and aging, such as transformation, apoptosis, and senescence. In the review here, we discuss several genetic disorders linked to DNA repair defects, attempting to draw correlations between the nature of the accumulating DNA damage and the pathological endpoints, namely cancer, neurological disease, and premature aging.


Assuntos
Senilidade Prematura/etiologia , Dano ao DNA , Reparo do DNA , Neoplasias/etiologia , Doenças do Sistema Nervoso/etiologia , Senilidade Prematura/patologia , Animais , Humanos , Neoplasias/patologia , Doenças do Sistema Nervoso/patologia
14.
Eur J Nucl Med Mol Imaging ; 49(11): 3761-3771, 2022 09.
Artigo em Inglês | MEDLINE | ID: mdl-35732972

RESUMO

PURPOSE: Non-invasive imaging is a key clinical tool for detection and treatment monitoring of infections. Existing clinical imaging techniques are frequently unable to distinguish infection from tumors or sterile inflammation. This challenge is well-illustrated by prosthetic joint infections that often complicate joint replacements. D-methyl-11C-methionine (D-11C-Met) is a new bacteria-specific PET radiotracer, based on an amino acid D-enantiomer, that is rapidly incorporated into the bacterial cell wall. In this manuscript, we describe the biodistribution, radiation dosimetry, and initial human experience using D-11C-Met in patients with suspected prosthetic joint infections. METHODS: 614.5 ± 100.2 MBq of D-11C-Met was synthesized using an automated in-loop radiosynthesis method and administered to six healthy volunteers and five patients with suspected prosthetic joint infection, who were studied by PET/MRI. Time-activity curves were used to calculate residence times for each source organ. Absorbed doses to each organ and body effective doses were calculated using OLINDA/EXM 1.1 with both ICRP 60 and ICRP 103 tissue weighting factors. SUVmax and SUVpeak were calculated for volumes of interest (VOIs) in joints with suspected infection, the unaffected contralateral joint, blood pool, and soft tissue background. A two-tissue compartment model was used for kinetic modeling. RESULTS: D-11C-Met was well tolerated in all subjects. The tracer showed clearance from both urinary (rapid) and hepatobiliary (slow) pathways as well as low effective doses. Moreover, minimal background was observed in both organs with resident micro-flora and target organs, such as the spine and musculoskeletal system. Additionally, D-11C-Met showed increased focal uptake in areas of suspected infection, demonstrated by a significantly higher SUVmax and SUVpeak calculated from VOIs of joints with suspected infections compared to the contralateral joints, blood pool, and background (P < 0.01). Furthermore, higher distribution volume and binding potential were observed in suspected infections compared to the unaffected joints. CONCLUSION: D-11C-Met has a favorable radiation profile, minimal background uptake, and fast urinary extraction. Furthermore, D-11C-Met showed increased uptake in areas of suspected infection, making this a promising approach. Validation in larger clinical trials with a rigorous gold standard is still required.


Assuntos
Metionina , Tomografia por Emissão de Pósitrons , Humanos , Imageamento por Ressonância Magnética , Tomografia por Emissão de Pósitrons/métodos , Radiometria , Distribuição Tecidual
15.
Cell Mol Life Sci ; 78(10): 4615-4637, 2021 May.
Artigo em Inglês | MEDLINE | ID: mdl-33751149

RESUMO

Oligodendrocyte precursor cells (OPCs) account for 5% of the resident parenchymal central nervous system glial cells. OPCs are not only a back-up for the loss of oligodendrocytes that occurs due to brain injury or inflammation-induced demyelination (remyelination) but are also pivotal in plastic processes such as learning and memory (adaptive myelination). OPC differentiation into mature myelinating oligodendrocytes is controlled by a complex transcriptional network and depends on high metabolic and mitochondrial demand. Mounting evidence shows that OPC dysfunction, culminating in the lack of OPC differentiation, mediates the progression of neurodegenerative disorders such as multiple sclerosis, Alzheimer's disease and Parkinson's disease. Importantly, neurodegeneration is characterised by oxidative and carbonyl stress, which may primarily affect OPC plasticity due to the high metabolic demand and a limited antioxidant capacity associated with this cell type. The underlying mechanisms of how oxidative/carbonyl stress disrupt OPC differentiation remain enigmatic and a focus of current research efforts. This review proposes a role for oxidative/carbonyl stress in interfering with the transcriptional and metabolic changes required for OPC differentiation. In particular, oligodendrocyte (epi)genetics, cellular defence and repair responses, mitochondrial signalling and respiration, and lipid metabolism represent key mechanisms how oxidative/carbonyl stress may hamper OPC differentiation in neurodegenerative disorders. Understanding how oxidative/carbonyl stress impacts OPC function may pave the way for future OPC-targeted treatment strategies in neurodegenerative disorders.


Assuntos
Diferenciação Celular , Doenças do Sistema Nervoso/patologia , Células Precursoras de Oligodendrócitos/patologia , Estresse Oxidativo , Animais , Humanos
16.
Int J Mol Sci ; 23(8)2022 Apr 08.
Artigo em Inglês | MEDLINE | ID: mdl-35456958

RESUMO

Neurological complications directly impact the lives of hundreds of millions of people worldwide. While the precise molecular mechanisms that underlie neuronal cell loss remain under debate, evidence indicates that the accumulation of genomic DNA damage and consequent cellular responses can promote apoptosis and neurodegenerative disease. This idea is supported by the fact that individuals who harbor pathogenic mutations in DNA damage response genes experience profound neuropathological manifestations. The review article here provides a general overview of the nervous system, the threats to DNA stability, and the mechanisms that protect genomic integrity while highlighting the connections of DNA repair defects to neurological disease. The information presented should serve as a prelude to the Special Issue "Genome Stability and Neurological Disease", where experts discuss the role of DNA repair in preserving central nervous system function in greater depth.


Assuntos
Doenças Neurodegenerativas , Dano ao DNA/genética , Reparo do DNA/genética , Genoma , Instabilidade Genômica , Humanos , Doenças Neurodegenerativas/genética
17.
Mutagenesis ; 36(3): 223-236, 2021 07 07.
Artigo em Inglês | MEDLINE | ID: mdl-33740813

RESUMO

Previous studies have indicated important roles for NIMA-related kinase 1 (NEK1) in modulating DNA damage checkpoints and DNA repair capacity. To broadly assess the contributions of NEK1 to genotoxic stress and mitochondrial functions, we characterised several relevant phenotypes of NEK1 CRISPR knockout (KO) and wild-type (WT) HAP1 cells. Our studies revealed that NEK1 KO cells resulted in increased apoptosis and hypersensitivity to the alkylator methyl methanesulfonate, the radiomimetic bleomycin and UVC light, yet increased resistance to the crosslinker cisplatin. Mitochondrial functionalities were also altered in NEK1 KO cells, with phenotypes of reduced mitophagy, increased total mitochondria, elevated levels of reactive oxygen species, impaired complex I activity and higher amounts of mitochondrial DNA damage. RNA-seq transcriptome analysis coupled with quantitative real-time PCR studies comparing NEK1 KO cells with NEK1 overexpressing cells revealed that the expression of genes involved in DNA repair pathways, such as base excision repair, nucleotide excision repair and double-strand break repair, are altered in a way that might influence genotoxin resistance. Together, our studies underline and further support that NEK1 serves as a hub signalling kinase in response to DNA damage, modulating DNA repair capacity, mitochondrial activity and cell fate determination.


Assuntos
Reparo do DNA , Mitocôndrias/fisiologia , Quinase 1 Relacionada a NIMA/fisiologia , Transcriptoma , Linhagem Celular , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas , Técnicas de Inativação de Genes , Humanos , Quinase 1 Relacionada a NIMA/deficiência , RNA-Seq
18.
Mol Pharm ; 18(1): 451-460, 2021 01 04.
Artigo em Inglês | MEDLINE | ID: mdl-33315406

RESUMO

Glycosaminoglycans (GAGs) such as heparan sulfate and chondroitin sulfate decorate all mammalian cell surfaces. These mucopolysaccharides act as coreceptors for extracellular ligands, regulating cell signaling, growth, proliferation, and adhesion. In glioblastoma, the most common type of primary malignant brain tumor, dysregulated GAG biosynthesis results in altered chain length, sulfation patterns, and the ratio of contributing monosaccharides. These events contribute to the loss of normal cellular function, initiating and sustaining malignant growth. Disruption of the aberrant cell surface GAGs with small molecule inhibitors of GAG biosynthetic enzymes is a potential therapeutic approach to blocking the rogue signaling and proliferation in glioma, including glioblastoma. Previously, 4-azido-xylose-α-UDP sugar inhibited both xylosyltransferase (XYLT-1) and ß-1,4-galactosyltransferase-7 (ß-GALT-7)-the first and second enzymes of GAG biosynthesis-when microinjected into a cell. In another study, 4-deoxy-4-fluoro-ß-xylosides inhibited ß-GALT-7 at 1 mM concentration in vitro. In this work, we seek to solve the enduring problem of drug delivery to human glioma cells at low concentrations. We developed a library of hydrophobic, presumed prodrugs 4-deoxy-4-fluoro-2,3-dibenzoyl-(α- or ß-) xylosides and their corresponding hydrophilic inhibitors of XYLT-1 and ß-GALT-7 enzymes. The prodrugs were designed to be activatable by carboxylesterase enzymes overexpressed in glioblastoma. Using a colorimetric MTT assay in human glioblastoma cell lines, we identified a prodrug-drug pair (4-nitrophenyl-α-xylosides) as lead drug candidates. The candidates arrest U251 cell growth at an IC50 = 380 nM (prodrug), 122 µM (drug), and U87 cells at IC50 = 10.57 µM (prodrug). Molecular docking studies were consistent with preferred binding of the α- versus ß-nitro xyloside conformer to XYLT-1 and ß-GALT-7 enzymes.


Assuntos
Glioblastoma/metabolismo , Glicosídeos/metabolismo , Animais , Linhagem Celular Tumoral , Sulfatos de Condroitina/metabolismo , Galactosiltransferases/metabolismo , Glicosaminoglicanos/metabolismo , Heparitina Sulfato/metabolismo , Humanos , Simulação de Acoplamento Molecular/métodos , Pentosiltransferases/metabolismo , Pró-Fármacos/metabolismo , UDP Xilose-Proteína Xilosiltransferase
19.
Proc Natl Acad Sci U S A ; 115(52): E12285-E12294, 2018 12 26.
Artigo em Inglês | MEDLINE | ID: mdl-30538199

RESUMO

Frequent oxidative modification of the neural genome is a by-product of the high oxygen consumption of the nervous system. Rapid correction of oxidative DNA lesions is essential, as genome stability is a paramount determinant of neural homeostasis. Apurinic/apyrimidinic endonuclease 1 (APE1; also known as "APEX1" or "REF1") is a key enzyme for the repair of oxidative DNA damage, although the specific role(s) for this enzyme in the development and maintenance of the nervous system is largely unknown. Here, using conditional inactivation of murine Ape1, we identify critical roles for this protein in the brain selectively after birth, coinciding with tissue oxygenation shifting from a placental supply to respiration. While mice lacking APE1 throughout neurogenesis were viable with little discernible phenotype at birth, rapid and pronounced brain-wide degenerative changes associated with DNA damage were observed immediately after birth leading to early death. Unexpectedly, Ape1Nes-cre mice appeared hypothermic with persistent shivering associated with the loss of thermoregulatory serotonergic neurons. We found that APE1 is critical for the selective regulation of Fos1-induced hippocampal immediate early gene expression. Finally, loss of APE1 in combination with p53 inactivation resulted in a profound susceptibility to brain tumors, including medulloblastoma and glioblastoma, implicating oxidative DNA lesions as an etiologic agent in these diseases. Our study reveals APE1 as a major suppressor of deleterious oxidative DNA damage and uncovers specific and broad pathogenic consequences of respiratory oxygenation in the postnatal nervous system.


Assuntos
Regulação da Temperatura Corporal , Neoplasias Encefálicas/genética , Neoplasias Encefálicas/metabolismo , Neoplasias Encefálicas/fisiopatologia , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo , Homeostase , Animais , Dano ao DNA , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/genética , Feminino , Genoma , Hipocampo/metabolismo , Humanos , Masculino , Camundongos , Camundongos Knockout , Neurogênese , Estresse Oxidativo , Neurônios Serotoninérgicos/metabolismo , Proteína Supressora de Tumor p53/genética , Proteína Supressora de Tumor p53/metabolismo
20.
J Heterocycl Chem ; 58(4): 947-951, 2021 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-34824482

RESUMO

Substituted aminopyrimidines are an important class of compounds, in part because they frequently show biological activity. Facile synthesis of polysubstituted aminopyrimidines is highly desirable for the synthesis of screening libraries. We describe a route to 4,6-diamino-5-alkoxypyrimidines via a SNAr-alkylation-SNAr sequence from readily available 4,6-dichloro-5-methoxypyrimidine, which allows the synthesis of such compounds with regiochemical control. The extension of this approach to alkylating agents bearing amino substituents led to unexpected and, in some cases, unprecedented products resulting from intramolecular SNAr cyclization and subsequent fragmentation.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA