RESUMO
Hypercortisolism is known to affect platelet function. However, few studies have approached the effect of exogenous cortisol on human platelets, and the results obtained are conflicting and unconvincing. In this study, the effect of exogenous cortisol on several parameters indicative of oxidative status in human platelets has been analysed. We have found that cortisol stimulates ROS production, superoxide anion formation, and lipid peroxidation, with these parameters being in strict correlation. In addition, cortisol decreases GSH and membrane SH-group content, evidencing that the hormone potentiates oxidative stress, depleting platelet antioxidant defence. The involvement of src, syk, PI3K, and AKT enzymes in oxidative mechanisms induced by cortisol is shown. The main sources of ROS in cells can include uncontrolled increase of NADPH oxidase activity and uncoupled aerobic respiration during oxidative phosphorylation. Both mechanisms seem to be involved in ROS formation induced by cortisol, as the NADPH oxidase 1 inhibitor 2(trifluoromethyl)phenothiazine, and rotenone and antimycin A, complex I and III inhibitor, respectively, significantly reduce oxidative stress. On the contrary, the NADPH oxidase inhibitor gp91ds-tat, malate and NaCN, complex II and IV inhibitor, respectively, have a minor effect. It is likely that, in human platelets, oxidative stress induced by cortisol can be associated with venous and arterial thrombosis, greatly contributing to cardiovascular diseases.
Assuntos
Hidrocortisona , Estresse Oxidativo , Humanos , Hidrocortisona/farmacologia , Espécies Reativas de Oxigênio , Plaquetas , NADPH OxidasesRESUMO
The role of antiplatelet therapy in patients with acute coronary syndromes is a moving target with considerable novelty in the last few years. The pathophysiological basis of the treatment depends on platelet biology and physiology, and the interplay between these aspects and clinical practice must guide the physician in determining the best therapeutic options for patients with acute coronary syndromes. In the present narrative review, we discuss the latest novelties in the antiplatelet therapy of patients with acute coronary syndromes. We start with a description of platelet biology and the role of the main platelet signal pathways involved in platelet aggregation during an acute coronary syndrome. Then, we present the latest evidence on the evaluation of platelet function, focusing on the strengths and weaknesses of each platelet's function test. We continue our review by describing the role of aspirin and P2Y12 inhibitors in the treatment of acute coronary syndromes, critically appraising the available evidence from clinical trials, and providing current international guidelines and recommendations. Finally, we describe alternative therapeutic regimens to standard dual antiplatelet therapy, in particular for patients at high bleeding risk. The aim of our review is to give a comprehensive representation of current data on antiplatelet therapy in patients with acute coronary syndromes that could be useful both for clinicians and basic science researchers to be up-to-date on this complex topic.
Assuntos
Síndrome Coronariana Aguda , Humanos , Síndrome Coronariana Aguda/tratamento farmacológico , Inibidores da Agregação Plaquetária/uso terapêutico , Aspirina/uso terapêutico , Plaquetas , Agregação PlaquetáriaRESUMO
The signaling lymphocytic activation molecule (SLAM) receptor family (SLAMF) consists of nine glycoproteins that belong to the CD2 superfamily of immunoglobulin (Ig) domain-containing molecules. SLAMF receptors modulate the differentiation and activation of a wide range of immune cells. Individual SLAMF receptors are expressed on the surface of hematopoietic stem cells, hematopoietic progenitor cells, B cells, T cells, NK cells, NKT cells, monocytes, macrophages, dendritic cells, neutrophils, and platelets. The expression of SLAMF receptors was studied during normal B cell maturation. Several SLAMF receptors were also detected in cancer cell lines of B-lymphoid origin and in pathological B cells from patients with B cell chronic lymphoproliferative disorders (B-CLPD), the most frequent hematological malignancies in adults. This review summarizes current knowledge on the expression of SLAMF receptors and their adaptor proteins SAP and EAT-2 in B-CLPD. Several SLAMF receptors could be regarded as potential diagnostic and differential diagnostic markers, prognostic factors, and targets for the development of novel drugs for patients with B-CLPD.
Assuntos
Proteínas Adaptadoras de Transdução de Sinal , Transtornos Linfoproliferativos , Adulto , Humanos , Linfócitos B , Plaquetas , Família de Moléculas de Sinalização da Ativação Linfocitária/genética , Transtornos Linfoproliferativos/genéticaRESUMO
Although fibrin matrices derived from Platelet-Rich Plasma (PRP) are widely used in regenerative medicine, they have some limitations that can hinder their application. Modifying the composition of the PRP-derived fibrin matrix may improve its properties, making it suitable for certain medical uses. Three types of fibrin matrices were obtained: a PRP-derived fibrin matrix (FM), a PRP-derived fibrin matrix with a high fibrinogen content and platelets (FM-HFP) and a PRP-derived fibrin matrix with a high fibrinogen content (FM-HF). The fibrinogen levels, biomechanical properties and cell behavior were analyzed. The presence of platelets in the FM-HFP generated an inconsistent fibrin matrix that was discarded for the rest of the analysis. The fibrinogen levels in the FM-FH were higher than those in the FM (p < 0.0001), with a concentration factor of 6.86 ± 1.81. The values of clotting and swelling achieved using the FM-HF were higher (p < 0.0001), with less clot shrinkage (p < 0.0001). The FM had a significantly higher stiffness and turned out to be the most adherent composition (p = 0.027). In terms of cell viability, the FM-HF showed less cell proliferation but higher live/dead ratio values (p < 0.01). The increased fibrinogen and platelet removal in the FM-HF improved its adhesion and other biomechanical properties without affecting cell viability.
Assuntos
Plasma Rico em Plaquetas , Coagulação Sanguínea , Plaquetas , Fibrina , FibrinogênioRESUMO
BACKGROUND: Evaluation of biomarkers as risk factors for mortality may provide early intervention and treatment for fatal diseases. We aimed to determine the usability of inexpensive and easily measurable tests in the differentiation of critically ill patients by investigating their relationship with mortality. METHODS: This study was executed by examining the sixth, third, and first month examinations of patients registered to the home health care services unit in 2022 before mortality due to any reason. This study was conducted by including 1,060 patients. All parameters were distributed non-parametrically. The difference between the dependent groups was evaluated with Friedman's two-way analysis of variance, and p < 0.05 was considered statistically significant. RESULTS: When the patients' premortem one-month, three-month, and six-month results were examined, there was an increase in mean platelet volume (MPV) values over time. The neutrophil-to-lymphocyte ratio (NLR) and platelet-to-lymphocyte ratio (PLR) also increased. In these two parameters, the difference between the first and third months and between the first and sixth months was statistically significant. Given the C-Reactive Protein (CRP)/Albumin Ratio (CAR) and CRP/Prealbumin results, a significant increase was observed in both ratios. A more than four-fold increase was observed in the CAR between the premortem first and sixth month results, which increased gradually over time and was statistically significant. Conclusions: NLR, PLR, MPV, CAR and CRP/Prealbumin values were statistically associated with mortality.
Assuntos
Plaquetas , Pré-Albumina , Humanos , Pré-Albumina/metabolismo , Contagem de Plaquetas , Plaquetas/metabolismo , Linfócitos/metabolismo , Biomarcadores/metabolismo , Neutrófilos/metabolismo , Proteína C-Reativa/análise , Estudos RetrospectivosRESUMO
BACKGROUND: Platelet (PLT) count is one of the most important parameters of automated hematology, as spurious PLT reports could affect medical judgement and bring significant risks. In most cases, spurious PLT will not be reported for review criteria, which will be triggered by abnormal PLT histograms and PLT flag(s). Here, we present a case of severe aplastic anemia after hematopoietic stem cell transplantation with spurious high platelet count with normal histogram and no PLT flag(s). METHODS: The electrical impedance channel (PLT-I) and the fluorescence channel (PLT-F) of Sysmex XN-series hematology analyzer was used to obtain PLT results. Then, the sample was retested by another hematology analyzer MINDRAY BC-7500 [NR] CRP, and incubation was performed to rule out cryoglobulin interference. Furthermore, a microscope was used to estimate the PLT count by the ratio of platelets to red blood cells and observe the morphology of cells. RESULTS: Both PLT-I and PLT-F test results were spuriously high, and microscopically assessed platelet counts were relatively reliable. The observed spiny cells and ghost cells caused by hemolysis may have contributed to the inaccuracy of instrumental counting in this case. CONCLUSIONS: For special hematologic patients, PLT-I with flags may not be sufficient for screening purposes and PLT-F is not always accurate. Multiple testing methods including manual microscopy are needed.
Assuntos
Agmatina/análogos & derivados , Anemia Aplástica , Ácido Oxâmico/análogos & derivados , Humanos , Contagem de Plaquetas/métodos , Anemia Aplástica/diagnóstico , Reprodutibilidade dos Testes , PlaquetasRESUMO
BACKGROUND: Blood wastage leads to additional costs and reduced blood availability to patients. Above all is the moral issue of wasting donor gifts. This study aimed to determine the rate of blood wastage before and after implementing a new standard operating procedure (SOP) in Iran. METHODS: In this interventional study, a SOP for wastage management was prepared and implemented in all blood centers throughout the country. Data were extracted from the integrated software of the Iranian Blood Transfusion Organization (IBTO). The wastage rate of blood components in the post-intervention years (2016-2017) was then compared with that in the pre-intervention years (2013-2015) using the Z test. RESULTS: The overall wastage rate decreased by 36.86% (P<0.001, 95% CI [36.84-36.88]) after the intervention. Red blood cell (RBC) wastage decreased from 2.6% to 2.5%, platelet wastage from 19.5% to 10.6% and plasma wastage from 15.5% to 7.3% (P<0.001). The highest percentage of waste reduction pertained to plasma components, which decreased by 52.90% (P<0.001, 95% CI [52.86-52.94]). Expiration was the most common cause of RBC and platelet wastage. The most common causes of plasma wastage were RBC contamination and rupture or leakage of the bags. The intervention resulted in a drop of over 250000 discarded components each year, equal to approximately thirty-six million dollars in savings. CONCLUSION: This intervention effectively reduced waste and increased efficiency. Ongoing blood wastage reviews, auditing, and receiving feedback from the central headquarters were powerful tools in following the compliance of blood centers. Further studies are recommended, especially concerning blood wastage in hospital blood banks and various wards.
Assuntos
Plaquetas , Hospitais , Humanos , Irã (Geográfico) , Cooperação do PacienteRESUMO
Uncontrolled bleeding after trauma represents a substantial clinical problem. The current standard of care to treat bleeding after trauma is transfusion of blood products including platelets; however, donated platelets have a short shelf life, are in limited supply, and carry immunogenicity and contamination risks. Consequently, there is a critical need to develop hemostatic platelet alternatives. To this end, we developed synthetic platelet-like particles (PLPs), formulated by functionalizing highly deformable microgel particles composed of ultralow cross-linked poly (N-isopropylacrylamide) with fibrin-binding ligands. The fibrin-binding ligand was designed to target to wound sites, and the cross-linking of fibrin polymers was designed to enhance clot formation. The ultralow cross-linking of the microgels allows the particles to undergo large shape changes that mimic platelet shape change after activation; when coupled to fibrin-binding ligands, this shape change facilitates clot retraction, which in turn can enhance clot stability and contribute to healing. Given these features, we hypothesized that synthetic PLPs could enhance clotting in trauma models and promote healing after clotting. We first assessed PLP activity in vitro and found that PLPs selectively bound fibrin and enhanced clot formation. In murine and porcine models of traumatic injury, PLPs reduced bleeding and facilitated healing of injured tissue in both prophylactic and immediate treatment settings. We determined through biodistribution experiments that PLPs were renally cleared, possibly enabled by ultrasoft particle properties. The performance of synthetic PLPs in the preclinical studies shown here supports future translational investigation of these hemostatic therapeutics in a trauma setting.
Assuntos
Hemostáticos , Roedores , Animais , Camundongos , Suínos , Roedores/metabolismo , Distribuição Tecidual , Plaquetas/metabolismo , Hemorragia , Fibrina/química , Fibrina/metabolismoRESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
BACKGROUND: Podoplanin (PDPN) expressed on tumour cells interacts with platelet C-type lectin-like receptor 2 (CLEC-2). This study aimed to investigate the role of the PDPN-platelet CLEC-2 interaction in melanoma pulmonary metastasis. METHODS: Murine melanoma B16-F0 cells, which have two populations that express podoplanin, were sorted by FACS with anti-podoplanin staining to obtain purified PDPN + and PDPN- B16-F0 cells. C57BL/6J mice transplanted with CLEC-2-deficient bone marrow cells were used for in vivo experiments. RESULTS: The in vivo data showed that the number of metastatic lung nodules in WT mice injected with PDPN + cells was significantly higher than that in WT mice injected with PDPN- cells and in WT or CLEC-2 KO mice injected with PDPN- cells. In addition, our results revealed that the platelet Syk-dependent signalling pathway contributed to platelet aggregation and melanoma metastasis. CONCLUSIONS: Our study indicates that the PDPN-CLEC-2 interaction promotes experimental pulmonary metastasis in a mouse melanoma model. Tumour cell-induced platelet aggregation mediated by the interaction between PDPN and CLEC-2 is a key factor in melanoma pulmonary metastasis.
Assuntos
Neoplasias Pulmonares , Melanoma , Animais , Camundongos , Plaquetas/metabolismo , Lectinas Tipo C/metabolismo , Neoplasias Pulmonares/metabolismo , Melanoma/metabolismo , Glicoproteínas de Membrana/genética , Glicoproteínas de Membrana/metabolismo , Camundongos Endogâmicos C57BL , Agregação PlaquetáriaRESUMO
Thrombocytopenia caused by long-term radiotherapy and chemotherapy exists in cancer treatment. Previous research demonstrates that 5-Hydroxtrayptamine (5-HT) and its receptors induce the formation of megakaryocytes (MKs) and platelets. However, the relationships between 5-HT1A receptor (5-HTR1A) and MKs is unclear so far. We screened and investigated the mechanism of vilazodone as a 5-HTR1A partial agonist in promoting MK differentiation and evaluated its therapeutic effect in thrombocytopenia. We employed a drug screening model based on machine learning (ML) to screen the megakaryocytopoiesis activity of Vilazodone (VLZ). The effects of VLZ on megakaryocytopoiesis were verified in HEL and Meg-01 cells. Tg (itga2b: eGFP) zebrafish was performed to analyze the alterations in thrombopoiesis. Moreover, we established a thrombocytopenia mice model to investigate how VLZ administration accelerates platelet recovery and function. We carried out network pharmacology, Western blot, and immunofluorescence to demonstrate the potential targets and pathway of VLZ. VLZ has been predicted to have a potential biological action. Meanwhile, VLZ administration promotes MK differentiation and thrombopoiesis in cells and zebrafish models. Progressive experiments showed that VLZ has a potential therapeutic effect on radiation-induced thrombocytopenia in vivo. The network pharmacology and associated mechanism study indicated that SRC and MAPK signaling are both involved in the processes of megakaryopoiesis facilitated by VLZ. Furthermore, the expression of 5-HTR1A during megakaryocyte differentiation is closely related to the activation of SRC and MAPK. Our findings demonstrated that the expression of 5-HTR1A on MK, VLZ could bind to the 5-HTR1A receptor and further regulate the SRC/MAPK signaling pathway to facilitate megakaryocyte differentiation and platelet production, which provides new insights into the alternative therapeutic options for thrombocytopenia.
Assuntos
Trombocitopenia , Cloridrato de Vilazodona , Camundongos , Animais , Cloridrato de Vilazodona/efeitos adversos , Cloridrato de Vilazodona/metabolismo , Peixe-Zebra , Receptor 5-HT1A de Serotonina/metabolismo , Plaquetas/metabolismo , Trombocitopenia/tratamento farmacológico , Trombocitopenia/metabolismo , Megacariócitos/metabolismo , TrombopoeseRESUMO
Platelets have been reported to exert diverse actions besides hemostasis and thrombus formation in the body. However, whether platelets affect transporter activity remains to be determined. In this study, we examined the effects of platelets on the activity of amino acid transporter system A, which is known to be changed by various factors, and we clarified the mechanism by which platelets affect system A activity. Among system A subtypes, we found that sodium-coupled neutral amino acid transporter (SNAT) 4 played a central role in the transport activity of system A in HuH-7 human hepatoma cells. Interestingly, platelets showed a biphasic effect on system A activity: activated platelet supernatants (APS) including the granule contents released from platelets downregulated system A activity at lower concentrations and the downregulation was suppressed at higher concentrations. The downregulation was due to a decrease in the affinity of SNAT4 for its substrate and not a decrease in the SNAT4 abundance on the plasma membrane. In addition, APS did not decrease the expression level of SNAT4 mRNA. On the other hand, platelets did not affect system A activity when the platelet suspension was added to HuH-7 cells. These results indicate that platelets indirectly affect the transport activity of system A by releasing bioactive substances but do not directly affect it by binding to HuH-7 cells.
Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Humanos , Sistemas de Transporte de Aminoácidos/metabolismo , Plaquetas/metabolismo , Membrana Celular/metabolismo , RNA Mensageiro/genéticaRESUMO
We recently achieved the first-in-human transfusion of induced pluripotent stem cell-derived platelets (iPSC-PLTs) as an alternative to standard transfusions, which are dependent on donors and therefore variable in supply. However, heterogeneity characterized by thrombopoiesis-biased or immune-biased megakaryocytes (MKs) continues to pose a bottleneck against the standardization of iPSC-PLT manufacturing. To address this problem, here we employ microRNA (miRNA) switch biotechnology to distinguish subpopulations of imMKCLs, the MK cell lines producing iPSC-PLTs. Upon miRNA switch-based screening, we find imMKCLs with lower let-7 activity exhibit an immune-skewed transcriptional signature. Notably, the low activity of let-7a-5p results in the upregulation of RAS like proto-oncogene B (RALB) expression, which is crucial for the lineage determination of immune-biased imMKCL subpopulations and leads to the activation of interferon-dependent signaling. The dysregulation of immune properties/subpopulations, along with the secretion of inflammatory cytokines, contributes to a decline in the quality of the whole imMKCL population.
Assuntos
Células-Tronco Pluripotentes Induzidas , MicroRNAs , Humanos , Megacariócitos , Células-Tronco Pluripotentes Induzidas/metabolismo , Plaquetas/metabolismo , Trombopoese/genética , MicroRNAs/genética , MicroRNAs/metabolismoRESUMO
Leukocytes and platelets must adhere to the wall of blood vessels to carry out their protective functions in inflammation and haemostasis. Recruitment is critically dependent on rheological variables (wall shear rate and stress, red cell aggregation and haematocrit) which affect delivery to the vessel wall as well as velocities and forces experienced there. Leukocyte recruitment is efficient only up to wall shear rates of about 300 s-1 and usually restricted to low-shear post-capillary venules in inflammation. Being smaller, platelets experience lower velocities and shear forces adjacent to the wall and can adhere at much higher shear rates for haemostasis in arteries. In addition, we found quite different effects of variations in haematocrit or red cell aggregation on attachment of neutrophils or platelets, which also assist their separate recruitment in venules or arteries. However, it has become increasingly evident that inflammatory and thrombotic responses may occur together, with platelets promoting the adhesion and activation of neutrophils and monocytes. Indeed, it is 30 years since we demonstrated that platelets could cause neutrophils to aggregate in suspension and, when attached to a surface, could support selectin-mediated rolling of all leukocytes. Thrombin-activated platelets could further induce neutrophil activation and immobilisation. In some conditions, platelets could bind to intact endothelial monolayers and capture neutrophils or monocytes. Subsequently, we found that extracellular vesicles released by activated platelets (PEV) fulfilled similar functions when deposited on surfaces or bound to endothelial cells. In murine models, platelets or PEV could act as bridges for monocytes in inflamed vessels. Thus, leukocytes and platelets are rheologically adapted for their separate functions, while novel thrombo-inflammatory pathways using platelets or PEV may underlie pathogenic leukocyte recruitment.
Assuntos
Agregação Eritrocítica , Adesividade Plaquetária , Humanos , Animais , Camundongos , Adesividade Plaquetária/fisiologia , Células Endoteliais , Plaquetas/fisiologia , Leucócitos/fisiologia , Neutrófilos , Reologia , Inflamação/metabolismo , Adesão Celular , Selectina-P/metabolismoRESUMO
Heparin-induced thrombocytopenia (HIT) is an adverse reaction to heparin leading to a reduction in circulating platelets with an increased risk of thrombosis. It is precipitated by polymerized immune complexes consisting of pathogenic antibodies that recognize a small chemokine platelet factor 4 (PF4) bound to heparin. Characterization of these immune complexes is extremely challenging due to the enormous structural heterogeneity of such macromolecular assemblies and their constituents. Native mass spectrometry demonstrates that up to three PF4 tetramers can be assembled on a heparin chain, consistent with the molecular modeling studies showing facile polyanion wrapping along the polycationic belt on the PF4 surface. Although these assemblies can accommodate a maximum of only two antibodies, the resulting immune complexes are capable of platelet activation despite their modest size. Taken together, these studies provide further insight into molecular mechanisms of HIT and other immune disorders where anti-PF4 antibodies play a central role.
Assuntos
Heparina , Trombocitopenia , Humanos , Heparina/efeitos adversos , Complexo Antígeno-Anticorpo , Fator Plaquetário 4/metabolismo , Trombocitopenia/induzido quimicamente , Plaquetas/metabolismo , Fatores ImunológicosRESUMO
Platelet count increases are typically a reactionary response to one of a variety of pathophysiological events. We present here a case of microcytic hypochromic red blood cells and thrombocytosis in an adolescent female that we have monitored for three years. The patient was positive for alpha thalassemia trait; negative for mutation in Janus kinase 2, calreticulin, or myeloproliferative leukemia virus oncogene; and negative for reactive causes of thrombocytosis. Noticeably, a variant in atypical chemokine receptor 1 (ACKR1) (c.-67T>C, rs2814778) was found to be homozygous. Accordingly, the case was diagnosed as idiopathic thrombocytosis, and treatment was given to restore platelet levels to normal. Our findings highlight the possibility of an unknown association between alpha thalassemia trait and idiopathic thrombocytosis in the presence of ACKR1 mutation, which could be implicated in disease pathogenesis.
Assuntos
Trombocitose , Talassemia alfa , Adolescente , Humanos , Feminino , Talassemia alfa/diagnóstico , Trombocitose/complicações , Trombocitose/genética , Trombocitose/diagnóstico , Contagem de Plaquetas , Plaquetas , Diagnóstico DiferencialRESUMO
BACKGROUND: Immune thrombocytopenia (ITP) is commonly associated with platelet-associated immunoglobulins (PAIg). Demonstration of PAIg can help determine etiologies for thrombocytopenia. In humans, ITP and thrombocytopenia have been associated with various vaccinations and influenza infections, respectively. OBJECTIVES: We aimed to evaluate platelet counts and PAIg in research dogs with H3N2 and in research and client-owned dogs routinely vaccinated for distemper, adenovirus-2, parainfluenza, and parvovirus (DA2PP). The hypotheses were that H3N2 infection but not DA2PP vaccination would decrease platelet counts, and neither would result in the detection of PAIg. METHODS: Three pilot studies. Platelet counts and PAIg, measured by direct flow cytometry as %IgG, were evaluated in eight research Beagles following experimental infection with H3N2 (experiment 1), nine research Beagles vaccinated for DA2PP (experiment 2), and thirty client-owned dogs vaccinated for DA2PP (experiment 3). All animals were considered healthy at the start of the experiments. RESULTS: Transient, self-resolving decreases in platelet counts and increases in %IgG occurred following H3N2 infection, and one dog became thrombocytopenic and positive for PAIg. Following DA2PP vaccination, %IgG increased in research and client-owned dogs, but only one dog was considered positive for PAIg with a concurrent increase in platelet count. Mean PAIg increased from baseline in client-owned dogs following vaccination. CONCLUSIONS: Transient PAIg and thrombocytopenia can occur following H3N2 infection, while routine vaccination for DA2PP in this group of dogs was not associated with the development of thrombocytopenia or clinically relevant formation of PAIg.
Assuntos
Doenças do Cão , Influenza Humana , Púrpura Trombocitopênica Idiopática , Trombocitopenia , Humanos , Cães , Animais , Contagem de Plaquetas/veterinária , Plaquetas , Vírus da Influenza A Subtipo H3N2 , Influenza Humana/complicações , Trombocitopenia/diagnóstico , Trombocitopenia/veterinária , Púrpura Trombocitopênica Idiopática/diagnóstico , Púrpura Trombocitopênica Idiopática/veterinária , Imunoglobulina GRESUMO
Objective: To analyze the transfusion effect of different platelet matching schemes in patients with platelet transfusion refractoriness (PTR). Methods: A total of 94 patients with PTR received by Taiyuan Blood Center from January to December 2021 were retrospectively analyzed, including 26 males and 68 females, aged 53(34,66) years. Platelet antibody screening was performed by enzyme-linked immunosorbent assay (ELISA). For patients with positive human leukocyte antigen (HLA) class â antibodies, Luminex platform liquid chip assay was used to identify the specificity of antibodies, and platelets with missing allelic expression antigen corresponding to their specific antibodies were found in the platelet donor gene database established in our laboratory. For patients with negative class HLA-â antibody screening, medium and high-resolution HLA-A and B alleles were genotyped by polymerase chain reaction restriction sequence specific oligonucleotide (PCR-SSO), and the compatible platelets were searched from the platelet donor gene database by HLA cross-reactive group genotype matching scheme or directly selected by serological cross-matching. The PCI compliance rate and total transfusion effective rate of different mismatch site groups and different matching scheme groups were statistically analyzed. Results: Platelet antibody was detected in 39 of 94 PTR patients with a positive rate of 41.5%, and all of them were HLA-â antibodies, and 1 case was accompanied by human platelet antigen (HPA) antibody. A total of 134 times of compatible platelets were supplied to 39 patients with HLA-â antibody positive by using antibody avoidance matching method. And the total effective rate of transfusion was 97.8% (131/134); The PCI compliance rates of HLA-A antigen mismatch, HLA-B antigen mismatch and HLA-A and B antigen mismatch groups were 81.6% (31/38), 86.5% (32/37) and 78.6% (22/28), respectively. The total effective rate of transfusion was 97.4% (37/38), 94.6% (35/37) and 100% (28/28), respectively, with no statistical significance (all P>0.05). A total of 118 times of compatible platelets were provided by HLA antigen cross-reaction group genotype matching and serological cross-matching, 90 transfusion effects were collected during follow-up, and the total effective rate was 76.7% (69/90). Conclusion: The combination of different platelet matching schemes can improve the PCI compliance rate and the total effective rate of transfusion in PTR patients.