Lessons learned for reducing the negative impact of adverse events on patients, health professionals and healthcare organizations.

PURPOSE: To summarize the knowledge about the aftermath of adverse events (AEs) and develop a recommendation set to reduce their negative impact in patients, health professionals and organizations in contexts where there is no previous experiences and apology laws are not present. DATA SOURCES: Review studies published between 2000 and 2015, institutional websites and experts' opinions on patient safety. STUDY SELECTION: Studies published and websites on open disclosure, and the second and third victims' phenomenon. Four Focus Groups participating 27 healthcare professionals. DATA EXTRACTION: Study characteristic and outcome data were abstracted by two authors and reviewed by the research team. RESULTS OF DATA SYNTHESIS: Fourteen publications and 16 websites were reviewed. The recommendations were structured around eight areas: (i) safety and organizational policies, (ii) patient care, (iii) proactive approach to preventing reoccurrence, (iv) supporting the clinician and healthcare team, (v) activation of resources to provide an appropriate response, (vi) informing patients and/or family members, (vii) incidents' analysis and (viii) protecting the reputation of health professionals and the organization. CONCLUSION: Recommendations preventing aftermath of AEs have been identified. These have been designed for the hospital and the primary care settings; to cope with patient's emotions and for tacking the impact of AE in the second victim's colleagues. Its systematic use should help for the establishment of organizational action plans after an AE.

Medicamentos: cuando las apariencias engañan. Propuesta de norma para que los pacientes puedan identificar claramente los medicamentos, especialmente los que tienen la misma composición pero distintos nombres y aspectos que llevan a confusión / Drugs: When appearances mislead. Proposed standard for patients to clearly identify medications, especially those with the same composition but with different names and aspects that lead to confusion

No disponible

Interventions in health organisations to reduce the impact of adverse events in second and third victims.

BACKGROUND: Adverse events (AE) are also the cause of suffering in health professionals involved. This study was designed to identify and analyse organization-level strategies adopted in both primary care and hospitals in Spain to address the impact of serious AE on second and third victims. METHODS: A cross-sectional study was conducted in healthcare organizations assessing: safety culture; health organization crisis management plans for serious AE; actions planned to ensure transparency in communication with patients (and relatives) who experience an AE; support for second victims; and protective measures to safeguard the institution's reputation (the third victim). RESULTS: A total of 406 managers and patient safety coordinators replied to the survey. Deficient provision of support for second victims was acknowledged by 71 and 61% of the participants from hospitals and primary care respectively; these respondents reported there was no support protocol for second victims in place in their organizations. Regarding third victim initiatives, 35% of hospital and 43% of primary care professionals indicated no crisis management plan for serious AE existed in their organization, and in the case of primary care, there was no crisis committee in 34% of cases. The degree of implementation of second and third victim support interventions was perceived to be greater in hospitals (mean 14.1, SD 3.5) than in primary care (mean 11.8, SD 3.1) (p < 0.001). CONCLUSIONS: Many Spanish health organizations do not have a second and third victim support or a crisis management plan in place to respond to serious AEs.

The aftermath of adverse events in Spanish primary care and hospital health professionals.

BACKGROUND: Adverse events (AEs) cause harm in patients and disturbance for the professionals involved in the event (second victims). This study assessed the impact of AEs in primary care (PC) and hospitals in Spain on second victims. METHODS: A cross-sectional study was conducted. We carried out a survey based on a random sample of doctors and nurses from PC and hospital settings in Spain. A total of 1087 health professionals responded, 610 from PC and 477 from hospitals. RESULTS: A total of 430 health professionals (39.6%) had informed a patient of an error. Reporting to patients was carried out by those with the strongest safety culture (Odds Ratio -OR- 1.1, 95% Confidence Interval -CI- 1.0-1.2), nurses (OR 1.9, 95% CI 1.5-2.3), those under 50 years of age (OR 0.7, 95% CI 0.6-0.9) and primary care staff (OR 0.6, 95% CI 0.5-0.9). A total of 381 (62.5%, 95% CI 59-66%) and 346 (72.5%, IC95% 69-77%) primary care and hospital health professionals, respectively, reported having gone through the second-victim experience, either directly or through a colleague, in the previous 5 years. The emotional responses were: feelings of guilt (521, 58.8%), anxiety (426, 49.6%), re-living the event (360, 42.2%), tiredness (341, 39.4%), insomnia (317, 38.0%) and persistent feelings of insecurity (284, 32.8%). In doctors, the most common responses were: feelings of guilt (OR 0.7 IC95% 0.6-0.8), re-living the event (OR 0.7, IC95% o.6-0.8), and anxiety (OR 0.8, IC95% 0.6-0.9), while nurses showed greater solidarity in terms of supporting the second victim, in both PC (p = 0.019) and hospital (p = 0.019) settings. CONCLUSIONS: Adverse events cause guilt, anxiety, and loss of confidence in health professionals. Most are involved in such events as second victims at least once in their careers. They rarely receive any training or education on coping strategies for this phenomenon.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

[Enhanced quality in a hospital microbiology laboratory: from automation to clinical advice]. / Programa de mejora de un servicio de microbiología: de la automatización hacia la consultoría clínica.

BACKGROUND: Quality policies focussed on the patient and applied to a hospital microbiology laboratory have led us to investigate clinicians' needs when requesting test results. The aim of this study was to analyze these requirements and to implement a plan to improve attention to the clinicians, considered as direct customers, particularly in the process of providing results. METHODS: Phase 1: To determine clinicians' needs, we studied the calls made to the Bacteriology Unit. Over a period of two weeks the information requested, the reasons for the call and the hospital Service calling were recorded. A descriptive analysis of this information was performed and the most frequent reasons for calling were identified. Phase 2: A quality improvement plan was designed to improve laboratory reporting of bacteriologic results. One month after its implementation, the results of this quality effort were assessed by analysis of calls to the Unit and use of a questionnaire to determine clinicians' satisfaction. RESULTS: Phase 1: among the total calls made, 43.8% asked for information on specimens being processed, 17.7% for information on specimens processed in other units, 16.1% demanded test results that had not been received within the expected time, and 22.4% were for other reasons. The hospital departments requesting information included 31% Infectious Diseases, 16% Internal Medicine, 13% Intensive Care Unit (ICU), and 40% others. Phase 2: within the quality plan, a microbiologist attended clinical sessions in the above mentioned departments in order to provide information on the specimens being processed, to discuss alternative diagnostic tests, and to comment on treatment prescribed to the patients. EVALUATION: Microbiologists attended two sessions per week during one month in the IM and ID Departments and ICU, and his/her participation was evaluated through analysis of calls and a satisfaction questionnaire. CONCLUSION: Automation of many laboratory tasks has allowed a reorientation of the activity of laboratory professionals toward satisfying the needs of the medical staff and improvements in the reporting process. The direct participation of laboratory professionals in discussions on patient care resulted in an enhancement of the overall quality of the health care provided to the patient.

Programa de mejora de un servicio de microbiología: de la automatización hacia la consultoría clínica / Enhanced quality in a hospital microbiology laboratory: from automation to clinical advice

FUNDAMENTOS. La política de calidad centrada en el paciente aplicada a un servicio de microbiología lleva a centrar los programas de mejora en la detección de las necesidades de los profesionales sanitarios. El objetivo de este estudio ha sido analizar las necesidades de los servicios demandantes de pruebas a la sección de bacteriología y diseñar e implantar un plan de mejora para potenciar la atención a los profesionales. MÉTODOS. Fase 1: Detección de las necesidades expresadas por los profesionales mediante el análisis de la información reclamada por teléfono a la sección. Durante 2 semanas se han recogido los motivos y servicios de las llamadas a la sección. Se ha realizado un análisis descriptivo de las peticiones y seleccionado el motivo de llamada más frecuente. Fase 2: Se ha diseñado un programa de mejora y su plan de implementación. Se ha realizado una evaluación tras el primer mes por medio de la recogida y el análisis de las llamadas telefónicas y por una encuesta de satisfacción a los facultativos de los servicios implicados. RESULTADOS: Fase 1: La distribución de los motivos de llamada fue 43,8 por ciento preguntaban por resultado de muestra en proceso; 17,7 por ciento, por resultado de muestra en proceso de otra sección; 16,1 por ciento, reclamando resultado de prueba no recibida, y 22,4 por ciento por otros motivos. La distribución de las llamadas por servicios fue: 31 por ciento, Enfermedades Infecciosas (EI); 16 por ciento, Medicina Interna; 13 por ciento, Unidad de Cuidados Intensivos (UCI), y otros el resto. Se seleccionó como plan de mejora la participación de un microbiólogo en las sesiones clínicas de los servicios mencionados con el fin de anticipar información sobre las muestras en proceso, analizar la secuencia de otras pruebas diagnósticas posibles y comentar los tratamientos prescritos para los casos. Evaluación de la mejora: las sesiones se han desarrollado durante un mes a razón de 2 sesiones semanales con los servicios de Enfermedades Infecciosas, Medicina Interna y UCI. Se ha recogido información sobre las llamadas recibidas en la sección durante una semana, y se ha realizado una encuesta de satisfacción a los facultativos de los servicios implicados. CONCLUSIÓN. La automatización de las tareas de laboratorio ha permitido reorientar la actividad de los profesionales del laboratorio hacia las necesidades de los solicitantes y compartir de forma directa la atención al paciente que redunda en una mejora de la calidad de la asistencia prestada (AU)

Un mínimo básico para definir los productos de la asistencia sanitaria: el CMBD, un modelo en expansión / A minimun basic to define health care products: MBDS, an expansive model

No disponible