Role of methyl jasmonate and salicylic acid in kiwifruit plants further subjected to Psa infection: biochemical and genetic responses.

The use of plant elicitors for controlling Pseudomonas syringae pv. actinidiae (Psa), the etiological agent of the kiwifruit bacterial canker (KBC), has been analysed in the past and, while salicylic acid (SA) seems to decrease disease susceptibility, methyl jasmonate (MJ) shows an opposite effect. However, the metabolic and genomic responses of Psa-infected plants following elicitation with these two compounds, as compared with non-elicited Psa-inoculated plants, are poorly understood, being the focus of this study. Micropropagated A. chinensis 'Hayward' plants were elicited with MJ or SA, and further inoculated with Psa. Fifteen days post-inoculation, Psa population in MJ-treated plants was increased by 7.4-fold, whereas SA elicitation led to decreased Psa colonization (0.5-fold), as compared with non-elicited inoculated plants. Additionally, elicitation with MJ or SA generally decreased polyphenols and lignin concentrations (by at least 20%) and increased total proteins (by at least 50%). MJ led to the upregulation of SOD, involved in plant antioxidant system, and reporter genes for the jasmonic acid (JA) (JIH and LOX1), abscisic acid (SnRK), SA (ICS1), and ethylene (ACAS1, ETR1 and SAM) pathways. Moreover, it increased ABA (40%) and decreased carotenoids (30%) concentrations. Contrastingly, comparing with non-elicited Psa-inoculated plants, SA application resulted in the downregulation of antioxidant system-related genes (SOD and APX) and of reporter genes for ethylene (ETR1) and JA (JIH and ETR1). This study contributes to the understanding of potential mechanisms involved in kiwifruit plant defences against Psa, highlighting the role of the JA, ABA and ethylene in plant susceptibility to the pathogen.

Early Pathogen Recognition and Antioxidant System Activation Contributes to Actinidia arguta Tolerance Against Pseudomonas syringae Pathovars actinidiae and actinidifoliorum.

Actinidia chinensis and A. arguta have distinct tolerances to Pseudomonas syringae pv. actinidiae (Psa), but the reasons underlying the inter-specific variation remain unclear. This study aimed to integrate the metabolic and molecular responses of these two kiwifruit species against the highly pathogenic Psa and the less pathogenic P. syringae pv. actinidifoliorum (Pfm) bacterial strains. Disease development was monitored weekly till 21 days post inoculation (dpi), analysing a broad number and variety of parameters including: colony forming units (CFU), foliar symptoms, total chlorophylls, lipid peroxidation, soluble polyphenols, lignin and defense-related gene expression. At the end of the experimental period A. chinensis inoculated with Psa presented the highest endophytic bacterial population, whereas A. arguta inoculated with Pfm showed the lowest values, also resulting in a lower extent of leaf symptoms. Metabolic responses to infection were also more pronounced in A. chinensis with decreased total chlorophylls (up to 55%) and increased lipid peroxidation (up to 53%), compared with non-inoculated plants. Moreover, at 14 dpi soluble polyphenols and lignin concentrations were significantly higher (112 and 26%, respectively) in Psa-inoculated plants than in controls, while in A. arguta no significant changes were observed in those metabolic responses, except for lignin concentration which was, in general, significantly higher in Psa-inoculated plants (by at least 22%), comparing with control and Pfm-inoculated plants. Genes encoding antioxidant enzymes (SOD, APX and CAT) were upregulated at an earlier stage in Psa-inoculated A. arguta than in A. chinensis. In contrast, genes related with phenylpropanoids (LOX1) and ethylene (SAM) pathways were downregulated in A. arguta, but upregulated in A. chinensis in the later phases of infection. Expression of Pto3, responsible for pathogen recognition, occurred 2 dpi in A. arguta, but only 14 dpi in A. chinensis. In conclusion, we found that A. arguta is more tolerant to Psa and Pfm infection than A. chinensis and its primary and secondary metabolism is less impacted. A. arguta higher tolerance seems to be related with early pathogen recognition, the activation of plant antioxidant system, and to the suppression of ET and JA pathways from an earlier moment after infection.

Effect of cellulose and lignin on disintegration, antimicrobial and antioxidant properties of PLA active films.

This study reports the effects on antimicrobial, antioxidant, migration and disintegrability activities of ternary nanocomposite films based on poly(lactic acid) incorporating two biobased nanofillers, (cellulose nanocrystals (CNC) and lignin nanoparticles (LNP)), in two different amounts (1 and 3% wt.). Results from antimicrobial tests revealed a capacity to inhibit the Gram negative bacterial growth of Xanthomonas axonopodis pv. vesicatoria and Xanthomonas arboricola pv. pruni along the time, offering innovative opportunities against dangerous bacterial plant pathogens. LNP proved to be highly efficient in antioxidation activity, based on the disappearance of the absorption band at 517nm of the free radical, 2,2-diphenyl-1-picrylhydrazyl (DPPH) upon reduction by an antiradical compound; moreover the combination of LNP and CNC generates a synergistic positive effect in the antioxidation response of PLA ternary films. Furthermore, all the studied formulations showed a disintegrability value up to 90% after 15days of incubation in composting conditions. Migration results showed that the films can be considered suitable for application in food packaging field.

A Multiplex PCR Assay for Detection of Pseudomonas syringae pv. actinidiae and Differentiation of Populations with Different Geographic Origin.

Pseudomonas syringae pv. actinidiae is responsible for severe outbreaks of bacterial canker of kiwifruit currently occurring around the world. Although molecular detection methods have been reported, none provide complete selectivity for this pathovar or discriminate among pathogen haplotypes. Therefore, a new multiplex polymerase chain reaction (PCR) assay was developed and validated. The assay was tested on 32 P. syringae pv. actinidiae isolates and 15 non-P. syringae pv. actinidiae strains and correctly assigned P. syringae pv. actinidiae strains to three different haplotypes: a Japanese/Korean group, a European group, and a Chinese group. Two P. syringae pv. actinidiae isolates from New Zealand were found to belong to the Chinese group whereas two other isolates from New Zealand, which were isolated from kiwifruit plants but which do not cause bacterial canker, tested negative. The described PCR assays has a limit of detection of approximately 5 to 50 pg of purified DNA or of 5 × 102 bacteria/PCR and were shown to work with both artificially and naturally infected plant tissues. Thus, the described method represents a suitable tool for detection of P. syringae pv. actinidiae and haplotype attribution, in particular, when testing a high number of samples during surveillance and prevention activities.

Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy.

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report.

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

Outbreak of Bacterial Blossom Blight Caused by Pseudomonas viridiflava on Actinidia chinensis Kiwifruit Plants in Italy.

During the springs from 2006 to 2008, a new disease was observed on 4- to 5-year-old Actinidia chinensis (cv. Jin Tao) trees in different commercial kiwifruit-production areas in northern Italy (Lombardy). Initially, disease occurrence was sporadic but later became widespread. Symptoms on flowers appeared as a dark brown rot of anthers, filaments, sepals, and whole buds. Blossoms abscised prematurely from buds. Symptoms appeared as confluent brown spots often present on rolled margins. Bacteria were isolated from symptomatic tissue on nutrient agar medium supplemented with 5% sucrose. The isolated bacteria were aerobic; produced a diffusible fluorescent pigment on King's B medium; levan, oxidase, and arginine dihydrydrolase negative, and catalase positive; rotted potato tuber tissue; caused a hypersensitive response on tobacco; and failed to reduce nitrate or utilize sucrose and were ice nuclease-positive at -5°C, suggesting the organism was P. viridiflava (1,3). Inoculation of 2-year-old A. chinensis cv. Jin Tao plants were carried out in the greenhouse under controlled environmental conditions (15 to 27°C, night/day; relative humidity up to 70%) by spraying five plants in bloom with a suspension (1 × 108 CFU/ml) of isolated bacteria with a hand-held sprayer that produced large spray droplets. Symptoms, similar to those in nature, were observed on flowers and buds 3 to 5 days after inoculation and on leaves after 7 to 10 days. Using the same tests described above with the original strains, the strains that were isolated from symptomatic tissue were identified as Pseudomonas viridiflava. Seven bacterial strains (PV508-PV1108) were identified by sequencing 1,481 bp of their 16S rDNA region (2) and using BlastN (4) for the most similar sequences in the INSD (GenBank, EMBL, and DDBJ). Our sequences shared 99.53% (1,474 of 1,481 bp) to 99.9% (1480 of 1,481 bp) identity with the analogous sequences of P. viridiflava available in the database. To our knowledge, this is the first report of an outbreak of blossom blight caused by P. viridiflava on A. chinensis cv. Jin Tao kiwifruit plants in Italy. Previously, it was reported on A. deliciosa cv. Hayward (3). Because of the risk of bacterial contamination among the different cultivars of kiwifruit, further investigation and development of control measures are in progress. References: (1) R. A. Lelliott and D. E. Stead. Methods for the Diagnosis of Bacterial Diseases of Plants. Blackwell Scientific, Oxford, UK, 1987. (2) E. R. B. Moore et al. Syst. Appl. Microbiol. 19:478, 1996. (3) L. Varvaro et al. Inf. Fitopatol. 6:49, 1990. (4) Z. Zhang et al. J. Comput. Biol. 7(1-2):203, 2000.

First Report of Citrus Canker Caused by Xanthomonas citri in Somalia.

Xanthomonas citri (synonym = Xanthomonas axonopodis pv. citri) (3) has been reported in several countries in Africa (1) but not Somalia. During 2006 and 2007, hyperplasia-type lesions, often surrounded by a water-soaked margin and yellow halo, typical of citrus canker caused by X. citri were found on 8- to 10-year-old lime (Citrus limetta) and grapefruit (Citrus × paradisi Macfed.) trees in northern and southern Somalia, respectively. Ten leaf samples diagnosed presumptively as citrus canker by Xac ImmunoStrip test kits (Agdia, Elkhart, IN) were mailed to the USDA Foreign Disease-Weed Science Research Unit at Ft. Detrick, MD. To confirm the identification of X. citri, isolations were made from several lesions from each sample onto yeast-dextrose-CaCO3 (YDC) agar (2). Yellow, xanthomonad-like mucoid, convex colonies were purified and stored on YDC slants. Phenotypic tests were done as described (2), and real-time PCR assays were done using primers XCit8F and XCit5R with probe XCitP2 (N. W. Schaad, unpublished). For pathogenicity tests, cultures were grown overnight in liquid nutrient broth-yeast (4) medium adjusted to contain 1 × 105 CFU/ml and inoculated into leaves of lime seedlings with the blunt end of a 2-ml syringe. After 21 to 30 days in a lighted dew chamber (Model I-60DLM; Percival Scientific, Inc. Perry, IA) at 30/23°C day/night, symptoms were recorded. Cultures of sample S-1 (northern Somalia) from lime were phenotypically atypical of X. citri, PCR negative, and nonpathogenic. However, cultures of samples 3 to 7 (southern Somalia) from grapefruit were typical of X. citri and PCR positive; cultures 3 and 4 were tested for pathogenicity and produced erumpent lesions on lime. Isolations onto YDC agar resulted in typical mucoid, convex, yellow, PCR-positive colonies. To our knowledge, this is the first report of X. citri on citrus plants in Somalia. Strains S3 and S4 have been deposited in ICPB at Ft. Detrick, MD as ICPB 11650 and 11651, respectively. References: (1) J. F. Bradbury. Guide to Plant Pathogenic Bacteria. CAB International, Egham, UK, 1986. (2) N. W. Schaad et al. Xanthomonas. Page 175 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al. eds. American Phytopathological Society, St. Paul. MN. 2001. (3) N. W. Schaad et al. Syst. Appl. Microbiol. 29:690, 2006. (4) A. K. Vidaver. Appl. Microbiol. 15:1523, 1967.