RESUMEN
A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.