Biological, serological and molecular typing of potato virus Y (PVY) isolates from Tunisia.

In Tunisia, potato virus Y (PVY) currently presents a significant threat to potato production, reducing tuber yield and quality. Three hundred and eighty-five potato samples (six different cultivars) collected in autumn 2007 from nine regions in Tunisia were tested for PVY infection by DAS-ELISA. The virus was detected in all regions surveyed, with an average incidence of 80.26%. Subsequently, a panel of 82 Tunisian PVY isolates (PVY-TN) was subjected to systematic biological, serological and molecular typing using immunocapture reverse-transcription polymerase chain reaction and a series of PVYOC- and PVYN-specific monoclonal antibodies. Combined analyses revealed ~67% of PVYNTN variants of which 17 were sequenced in the 5'NTR-P1 region to assess the genetic diversity and phylogenetic relationship of PVY-TN against other worldwide PVY isolates. To investigate whether selective constraints could act on viral genomic RNA, synonymous and non-synonymous substitution rates and their ratio were analyzed. Averages of all pairwise comparisons obtained in the 5'NTR-P1 region allowed more synonymous changes, suggesting selective constraint acting in this region. Selective neutrality test was significantly negative, suggesting a rapid expansion of PVY isolates. Pairwise mismatch distribution gave a bimodal pattern and pointed to an eventually early evolution characterizing these sequences. Genetic haplotype network topology provided evidence of the existence of a distinct geographical structure. This is the first report of such genetic analyses conducted on PVY isolates from Tunisia.

Automatic registration of pre- and intraoperative data for long bones in minimally invasive surgery.

The Minimally Invasive Procedures (MIP) in orthopedics have grown rapidly worldwide, as clinical results indicate that patients who undergo MIP typically experience minimized blood loss, smaller incision and shorter hospital stays. For most MIP, a preoperative 3D model of the patient anatomy is usually generated in order to plan the surgery. The challenge in MIP consists in finding the correspondence between the preoperative model and the actual position of the patient in the operating room, also known as image-to-patient registration. This paper proposes a real-time solution based on ultrasound (US) images: the patient anatomy is scanned by an US probe. Then, the segmentation and the extraction of bone contours from US images result in a 3D point cloud. The Poisson surface reconstruction method provides a 3D surface from 2D US data which will be registered with the preoperative model (CT volume) using the principal axes of inertia and the Iterative Closest Point robust (ICPr) algorithm. We present quantitative and qualitative results on both phantom and clinical data and show a mean registration accuracy of 0.66 mm for clinical radius scan. The promising registration results show the possible use of the proposed registration algorithm in clinical procedures.

Molecular characterization of Bemisia tabaci populations in Tunisia: genetic structure and evidence for multiple acquisition of secondary symbionts.

A survey was conducted during 2009-2010 seasons to identify the distribution of Bemisia tabaci (Gennadius) biotypes in Tunisia. The genetic affiliation of collected populations was determined by polymerase chain reaction (PCR)-restriction fragment-length polymorphism (TaqI) of the mitochondrial cytochrom oxidase I (mtCOI) gene. Results, validated by sequencing and phylogenetic analysis, allowed the clustering of sampled sweetpotato whiteflies into B and Q biotypes. As B. tabaci harbors the obligatory bacterium Portiera aleyrodidarum, and a diverse array of secondary symbionts including Rickettsia, Hamiltonella, Wolbachia, Cardinium, Arsenophonus, and Fritschea, we report here the infectious status of Tunisian populations by secondary symbionts to find out a correlation between bacterial composition to biotype. The genetic variability and structure of B. tabaci populations in Tunisia was driven by analysis of molecular variance (AMOVA) and the hypothesis of isolation by distance was explored. Selective neutrality and genetic haplotype network tests suggested that Tunisian sweetpotato whiteflies have been undergoing a potential expansion followed by gene flow restriction.

Use of Tomato leaf curl virus (TYLCV) truncated Rep gene sequence to engineer TYLCV resistance in tomato plants.

Tomato yellow leaf curl disease causes severe losses in tomato production throughout Mediterranean countries including Tunisia. In order to generate engineered resistance to this disease, an intron-hairpin RNA construct harboring a Tomato yellow leaf curl Sardinia virus (TYLCSV) truncated replication-associated protein (Rep) gene was used to transform genotype of tomato plants. Prepared transgenic plants were agro-inoculated with Tunisian infectious strain of TYLCSV and screened for the resistance to infection. The infected transgenic plants were divided into 3 different groups according to their specific symptoms. Only one of them contained transgenic plants fully resistant to the tomato yellow leaf curl disease.

Evaluation of two gene-silencing constructs for resistance to tomato yellow leaf curl viruses in Nicotiana benthamiana plants.

Infiltration of Agrobacterium tumefaciens into intact plant leaves of N. benthamiana was used to test the efficiency of two virus-based silencing constructs conferring resistance to the closely related begomoviruses. The constructs contained the most conserved sequences of the coat protein (CP) gene and replication-associated protein (Rep) gene of Tomato yellow leaf curl Sardinia virus (Sicily strain) (TYLCSV-[Sic]). Both constructs formed a hairpin structure that enhanced the post-transcriptional gene-silencing mechanism. When agro-infiltrated plants were challenged separately with infectious viruses TYLCSV-[Sic] and Tomato yellow leaf curl virus (TYLCV), the plants showed resistance to TYLCSV-[Sic], but not to the related TYLCV.

[Continent urinary diversion (Mitrofanoff principle). Physical mechanisms and urodynamic explanation of continence]. / Dérivation urinaire de Mitrofanoff. Mécanismes physiques et explication urodynamique de la continence.

OBJECTIVE: To analyze the urodynamic parameters and the mechanisms of continence of Mitrofanoff urinary diversion. MATERIAL AND METHODS: Urodynamic assessment was performed via the stoma in 11 patients with continent urinary diversion according to the Mitrofanoff principle. The mean age of the patients at the time of the operation was 29 years. The appendix, used as conduit in all cases, was anastomosed to the skin of the right iliac fossa. Ileocystoplasty was performed in 10 patients. The urodynamic assessment was performed after a mean follow-up of seven years (range: five to 12 years). RESULTS: Reservoir pressures after filling did not exceed 20 cm H2O in nine cases. Uninhibited contractions were recorded in two patients with an enlarged bladder with pressures not exceeding 30 cm H2O. Appendix pressures during filling were always higher than bladder pressures. The mean pressure measured at the end of filling was 75 cm H2O (range: 45 to 90 cm H2O). After the Valsalva maneuver, these pressures were between 80 and 150 cm H2O with good transmission. The mean conduit closing pressure was 70 cm H2O (range: 40 to 90 cm H2O). The mean functional length of the conduit was 5 cm (range: 2.6 to 7.2 cm). CONCLUSION: The Mitrofanoff diversion is mainly characterized by the high intraluminal pressure in the continent conduit. A low bladder pressure is essential to maintain a perfectly continent diversion.

Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

Frequent Occurrence of Lettuce mosaic virus in Cape Daisy (Osteospermum sp.) in Tunisia.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Molecular features of new Peach Latent Mosaic Viroid variants suggest that recombination may have contributed to the evolution of this infectious RNA.

Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.

Successful Treatment of Homozygous Cystinuria with Captopril

Objective : Cystinuria is an autosomal recessive hereditary disorder associated with nephrolithiasis and its attendant complications. Traditional management using oral alkali; D-penicillamine; or mercaptopropionyglycine in an attempt to increase urinary cystine solubility is often unsuccessful due to intolerable side-effects. The aim of this study was to determine; if captopril could reduce urinary cystine excretion in homozygous cystinuric patients. Patients and methods : Three cystinuric patients with a history of multiple cystine stones despite previous traditional therapy were treated with 150 mg captopril daily for 3 years after determination of their baseline 24-hour urine cystine excretion. Cystine excretion studies were repeated subsequently at 6-month intervals. Results : The baseline 24-hour urine cystine excretion was within the expected limits for homozygous cystinuria in all patients (1072; 862 and 959 mg cystine per gm creatinine per 24 hours). After institution of captopril treatment; all patients had a significant decrease in urinary cystine levels (374; 313 and 451 mg cystine per gm creatinine per 24 hours). No patient experienced recurrent nephrolithiasis or adverse drug effects. Conclusion : We conclude that captopril can significantly decrease urinary cystine excretion in patients with homozygous cystinuria. Captopril should be considered an alternative to traditional drug management of cystinuria

Development of a real-time PCR for Tomato yellow leaf curl Sardinia virus.

Recently, tomato yellow leaf curl disease has become important for the tomato grown both in greenhouse and field conditions in Tunisia. Here, we describe a rapid, specific, reliable, and sensitive real-time PCR, based on TaqMan chemistry, for Tomato yellow leaf curl Sardinia virus (TYLCSV). This method proved suitable for the detection and quantification of this virus in tomato, pepper and bean plants. It detected the virus even in the samples that were negative by conventional assays.

Nucleotide sequence analysis of the ORF0 region of Potato leafroll virus isolates from Tunisia.

Potato leafroll virus (PLRV) isolates from potato plants from different regions of Tunisia were investigated for the ORF0 variable region of genomic RNA using PCR, nucleotide sequencing and sequence analysis. Based on the ORF0 variable region nucleotide sequence, individual Tunisian isolates were more homologous as a group compared to the isolates originating from other parts of the world. There was no correlation between bioclimatic origin of the isolates and their ORF0 sequence. Alignment of the deduced amino acid sequences showed that the P0 protein was not much conserved. Unexpectedly, Tunisian isolates were found to be most homologous to Peruvian ones both at nucleotide and amino acid level. A phylogenetic tree, based on the P0 amino acid sequence, showed that all the PLRV isolates were located in two major clusters regardless of their geographic origin. In the second cluster, three sub-clusters could be distinguished. These results provide valuable information for molecular characterization of the PLRV isolates occurring in Tunisia.

Genomic structure of new Tunisian peach latent mosaic viroid variants.

Peach latent mosaic viroid (PLMVd) is a single-stranded circular RNA that do not code for proteins and ranges in size from 335 to 351 nucleotides. It mainly infects peach. In this study, the sequence of 20 complete cDNA clones derived from seven PLMVd isolates detected in five Tunisian peach cultivars was analysed in 3 steps: primary structure, phylogeny and secondary structure. The analysis of the primary structure revealed that all the 20 cDNA clones sequences corresponded to different variants. They ranged in size from 336 to 341 nt. Sequence alignment of our variants with reference sequences revealed 81 polymorphic positions. Among them, 15 were never described in the literature so far. The variable positions are scattered all around the RNA molecules, but the majority of them were concentrated in the region corresponding to nucleotides 1 to 70 and 170 to 346 in the alignment. Sequence homologies between variants of the same isolate or variants of different isolates ranged from 96% to 100%. This confirms that a PLMVd isolate is composed by a complex mixture of closely related molecules. Moreover, some variants isolated from different cultivars were found to be similar, indicating that a sequence is not exclusive to a cultivar. Phylogenetic analysis of our sequences allowed their clustering into two groups: group I (16 variants) and group II (4 variants) that differed by 18 polymorphic positions. Further phylogenetic analysis and sequence alignment of our sequences and the reference sequences were done. It revealed that our sequences were similar to the reference sequence Hd8 in the regions delimited by nucleotides 1 to 69 (region 1) and 268 to 343 (region 5) and to the reference sequence Hd6 in the region between nucleotides 150 and 200 (region 3). The other regions corresponding to nucleotides 70 to 149 (region 2) and 201 to 267 (region 4) were similar for all the sequences. These observations revealed that our Tunisian PLMVd variants correspond to a new population never reported in the literature. Analysis of the secondary structure confirmed that all PLMVd Tunisian variants presented a branched secondary structure and revealed a new potential pseudoknot-like interaction between two loops.

[Renal medullary carcinoma: a case report]. / Le carcinome médullaire du rein: une observation.

Renal medullary carcinoma is an aggressive malignant tumour, recently reported in the literature. It is usually reported in the relatively young patients with drepanocytic trai. Histologically, the tumour is constituted by a tumoral proliferation with diffuse or glandular architecture and inflammatory stroma. The carcinomatous cells have plasmocytoid or rhabdoid aspect. We report a case of 40 years old man who presented macroscopic hematuria. Through this observation and the review of the literature we discuss the anatomoclinical and the prognostic aspects of this exceptional tumour.

Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

Detection and epidemiological characteristics of peach latent mosaic viroid in Tunisia.

A rapid and sensitive assay was developed for the detection and identification of Peach latent mosaic viroid (PLMVd) by reverse transcription-polymerase chain reaction (RT-PCR) in infected tissues from Tunisian orchards. The test was initially performed by using total RNA preparations from selected isolates and then applied on total RNA preparations from leaf or bark tissues of fruit trees collected in 2003 in 20 orchards in the North of Tunisia and the Sahel. PLMVd occurred in peach and pear trees. The identity of the detected viroid was confirmed by comparison of its sequence with other isolates previously characterized. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues are identical to those obtained from total RNA preparations. Epidemiological characteristics of PLMVd on peach trees have been investigated. A survey of peach trees was carried out in 32 orchards in May 2004. The obtained results showed that (1) PLMVd is highly and equally present in several regions of the north of Tunisia rather than the central, the Sahel and the southern regions, (2) infection percentage increases with the age of the tree and (3) the studied cultivars are classified into three groups of sensitivity.

A naturally occurring recombinant isolate of Lettuce mosaic virus.

LMV-Common and LMV-Most are two seed-borne types of Lettuce mosaic virus (LMV), genus Potyvirus. LMV-Most, but not LMV-Common, overcomes the resistance afforded to lettuce by two recessive genes, mo11 and mo12. An RT-PCR-based assay thought to be specific for LMV-Most also amplified LMV-Tn2, previously typified as LMV-Common. The sequence of selected regions along the genome indicated that LMV-Tn2 is a natural recombinant between LMV-Most and LMV-Common isolates, with a putative recombination site located within the P3 coding region. This is the first evidence of a naturally occurring LMV recombinant isolate.

First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Nucleotide sequence comparison of the 3' terminal region of the genome of pepper vein mottle virus isolates from Tunisia and Ivory Coast.

Three Tunisian PVMV isolates identified in pepper and tomato fields and one isolate from Ivory Coast were submitted to biological and molecular analysis. Phenotypically, Tunisian isolates induced mild symptoms while the Ivory Coast one is more aggressive on tobacco. As no PVMV sequence data are available, detailed sequence comparisons of coat protein gene (CP) were made. No nucleotide or amino acid changes in this region could be related to the pathogenicity of the isolates analysed. With the aim to increase our molecular understanding of the biological properties, we have sequenced the 3'-non translated region (3'NTR). Results suggest that this region of the RNA genome may be involved in the modulation of disease symptoms.

Synthesis of full-length potyvirus cDNA copies suitable for the analysis of genome polymorphism.

New methods facilitating the synthesis and amplification of full-length cDNA copies of single-stranded viral RNA genomes have been developed. A method is described for the efficient purification of potyviral RNA and total RNA from infected plants and it is shown that they can serve as templates for the efficient synthesis of a full-length, 10 kb long, genomic cDNA. Two different reverse transcriptases were used (AMV-RT and MMLV-RT); only the first reverse transcriptase produced a good quality, full-length cDNA using viral RNA as a template. Surprisingly, MMLV-RT allowed for the full-length cDNA synthesis on virions rather than viral RNA. The PVY cDNA, synthesized using either RNA or virions, can be amplified successfully by PCR with high yields of full-length products. Such products are good substrates for the study by RFLP of the total genome polymorphism of virus isolates.