NetMe 2.0: a web-based platform for extracting and modeling knowledge from biomedical literature as a labeled graph.

MOTIVATION: The rapid increase of bio-medical literature makes it harder and harder for scientists to keep pace with the discoveries on which they build their studies. Therefore, computational tools have become more widespread, among which network analysis plays a crucial role in several life-science contexts. Nevertheless, building correct and complete networks about some user-defined biomedical topics on top of the available literature is still challenging. RESULTS: We introduce NetMe 2.0, a web-based platform that automatically extracts relevant biomedical entities and their relations from a set of input texts-i.e. in the form of full-text or abstract of PubMed Central's papers, free texts, or PDFs uploaded by users-and models them as a BioMedical Knowledge Graph (BKG). NetMe 2.0 also implements an innovative Retrieval Augmented Generation module (Graph-RAG) that works on top of the relationships modeled by the BKG and allows the distilling of well-formed sentences that explain their content. The experimental results show that NetMe 2.0 can infer comprehensive and reliable biological networks with significant Precision-Recall metrics when compared to state-of-the-art approaches. AVAILABILITY AND IMPLEMENTATION: https://netme.click/.

TMBcalc: a computational pipeline for identifying pan-cancer Tumor Mutational Burden gene signatures.

Background: In the precision medicine era, identifying predictive factors to select patients most likely to benefit from treatment with immunological agents is a crucial and open challenge in oncology. Methods: This paper presents a pan-cancer analysis of Tumor Mutational Burden (TMB). We developed a novel computational pipeline, TMBcalc, to calculate the TMB. Our methodology can identify small and reliable gene signatures to estimate TMB from custom targeted-sequencing panels. For this purpose, our pipeline has been trained on top of 17 cancer types data obtained from TCGA. Results: Our results show that TMB, computed through the identified signature, strongly correlates with TMB obtained from whole-exome sequencing (WES). Conclusion: We have rigorously analyzed the effectiveness of our methodology on top of several independent datasets. In particular we conducted a comprehensive testing on: (i) 126 samples sourced from the TCGA database; few independent whole-exome sequencing (WES) datasets linked to colon, breast, and liver cancers, all acquired from the EGA and the ICGC Data Portal. This rigorous evaluation clearly highlights the robustness and practicality of our approach, positioning it as a promising avenue for driving substantial progress within the realm of clinical practice.

Measuring cancer driving force of chromosomal aberrations through multi-layer Boolean implication networks.

Multi-layer Complex networks are commonly used for modeling and analysing biological entities. This paper presents the advantage of using COMBO (Combining Multi Bio Omics) to suggest a new role of the chromosomal aberration as a cancer driver factor. Exploiting the heterogeneous multi-layer networks, COMBO integrates gene expression and DNA-methylation data in order to identify complex bilateral relationships between transcriptome and epigenome. We evaluated the multi-layer networks generated by COMBO on different TCGA cancer datasets (COAD, BLCA, BRCA, CESC, STAD) focusing on the effect of a specific chromosomal numerical aberration, broad gain in chromosome 20, on different cancer histotypes. In addition, the effect of chromosome 8q amplification was tested in the same TCGA cancer dataset. The results demonstrate the ability of COMBO to identify the chromosome 20 amplification cancer driver force in the different TCGA Pan Cancer project datasets.

tRFUniverse: A comprehensive resource for the interactive analyses of tRNA-derived ncRNAs in human cancer.

tRNA-derived ncRNAs are a heterogeneous class of non-coding RNAs recently proposed to be active regulators of gene expression and be involved in many diseases, including cancer. Consequently, several online resources on tRNA-derived ncRNAs have been released. Although interesting, such resources present only basic features and do not adequately exploit the wealth of knowledge available about tRNA-derived ncRNAs. Therefore, we introduce tRFUniverse, a novel online resource for the analysis of tRNA-derived ncRNAs in human cancer. tRFUniverse presents an extensive collection of classes of tRNA-derived ncRNAs analyzed across all the TCGA and TARGET tumor cohorts, NCI-60 cell lines, and biological fluids. Moreover, public AGO CLASH/CLIP-Seq data were analyzed to identify the molecular interactions between tRNA-derived ncRNAs and other transcripts. Importantly, tRFUniverse combines in a single resource a comprehensive set of features that we believe may be helpful to investigate the involvement of tRNA-derived ncRNAs in cancer biology.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

The Ratio of Key Metabolic Transcripts Is a Predictive Biomarker of Breast Cancer Metastasis to the Lung.

Understanding the rewired metabolism underlying organ-specific metastasis in breast cancer could help identify strategies to improve the treatment and prevention of metastatic disease. Here, we used a systems biology approach to compare metabolic fluxes used by parental breast cancer cells and their brain- and lung-homing derivatives. Divergent lineages had distinct, heritable metabolic fluxes. Lung-homing cells maintained high glycolytic flux despite low levels of glycolytic intermediates, constitutively activating a pathway sink into lactate. This strong Warburg effect was associated with a high ratio of lactate dehydrogenase (LDH) to pyruvate dehydrogenase (PDH) expression, which correlated with lung metastasis in patients with breast cancer. Although feature classification models trained on clinical characteristics alone were unable to predict tropism, the LDH/PDH ratio was a significant predictor of metastasis to the lung but not to other organs, independent of other transcriptomic signatures. High lactate efflux was also a trait in lung-homing metastatic pancreatic cancer cells, suggesting that lactate production may be a convergent phenotype in lung metastasis. Together, these analyses highlight the essential role that metabolism plays in organ-specific cancer metastasis and identify a putative biomarker for predicting lung metastasis in patients with breast cancer. SIGNIFICANCE: Lung-homing metastatic breast cancer cells express an elevated ratio of lactate dehydrogenase to pyruvate dehydrogenase, indicating that ratios of specific metabolic gene transcripts have potential as metabolic biomarkers for predicting organ-specific metastasis.

DEGGs: an R package with shiny app for the identification of differentially expressed gene-gene interactions in high-throughput sequencing data.

SUMMARY: The discovery of differential gene-gene correlations across phenotypical groups can help identify the activation/deactivation of critical biological processes underlying specific conditions. The presented R package, provided with a count and design matrix, extract networks of group-specific interactions that can be interactively explored through a shiny user-friendly interface. For each gene-gene link, differential statistical significance is provided through robust linear regression with an interaction term. AVAILABILITY AND IMPLEMENTATION: DEGGs is implemented in R and available on GitHub at https://github.com/elisabettasciacca/DEGGs. The package is also under submission on Bioconductor.

Application of the PHENotype SIMulator for rapid identification of potential candidates in effective COVID-19 drug repurposing.

The current, rapidly diversifying pandemic has accelerated the need for efficient and effective identification of potential drug candidates for COVID-19. Knowledge on host-immune response to SARS-CoV-2 infection, however, remains limited with few drugs approved to date. Viable strategies and tools are rapidly arising to address this, especially with repurposing of existing drugs offering significant promise. Here we introduce a systems biology tool, the PHENotype SIMulator, which -by leveraging available transcriptomic and proteomic databases-allows modeling of SARS-CoV-2 infection in host cells in silico to i) determine with high sensitivity and specificity (both>96%) the viral effects on cellular host-immune response, resulting in specific cellular SARS-CoV-2 signatures and ii) utilize these cell-specific signatures to identify promising repurposable therapeutics. Powered by this tool, coupled with domain expertise, we identify several potential COVID-19 drugs including methylprednisolone and metformin, and further discern key cellular SARS-CoV-2-affected pathways as potential druggable targets in COVID-19 pathogenesis.

Transcriptome Analysis of Human Endogenous Retroviruses at Locus-Specific Resolution in Non-Small Cell Lung Cancer.

Lung cancer is the second most commonly diagnosed cancer and the leading cause of cancer deaths worldwide. Among its subtypes, lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) are the most common, accounting for more than 85% of lung cancer diagnoses. Despite the incredible efforts and recent advances in lung cancer treatments, patients affected by this condition still have a poor prognosis. Therefore, novel diagnostic biomarkers are needed. Recently, a class of transposable elements called human endogenous retroviruses (HERVs) has been found to be implicated in cancer development and later employed as novel biomarkers for several tumor types. In this study, we first ever characterized the expression of HERVs at genomic locus-specific resolution in both LUAD and LUSC cohorts available in The Cancer Genome Atlas (TCGA). Precisely, (i) we profiled the expression of HERVs in TCGA-LUAD and TCGA-LUSC cohorts; (ii) we identified the dysregulated HERVs in both lung cancer subtypes; (iii) we evaluated the impact of the dysregulated HERVs on signaling pathways using neural network-based predictions; and (iv) we assessed their association with overall survival (OS) and relapse-free survival (RFS). In conclusion, we believe this study may help elucidate another layer of dysregulation that occurs in lung cancer involving HERVs, paving the way for identifying novel lung cancer biomarkers.

Network analysis of synovial RNA sequencing identifies gene-gene interactions predictive of response in rheumatoid arthritis.

BACKGROUND: To determine whether gene-gene interaction network analysis of RNA sequencing (RNA-Seq) of synovial biopsies in early rheumatoid arthritis (RA) can inform our understanding of RA pathogenesis and yield improved treatment response prediction models. METHODS: We utilized four well curated pathway repositories obtaining 10,537 experimentally evaluated gene-gene interactions. We extracted specific gene-gene interaction networks in synovial RNA-Seq to characterize histologically defined pathotypes in early RA and leverage these synovial specific gene-gene networks to predict response to methotrexate-based disease-modifying anti-rheumatic drug (DMARD) therapy in the Pathobiology of Early Arthritis Cohort (PEAC). Differential interactions identified within each network were statistically evaluated through robust linear regression models. Ability to predict response to DMARD treatment was evaluated by receiver operating characteristic (ROC) curve analysis. RESULTS: Analysis comparing different histological pathotypes showed a coherent molecular signature matching the histological changes and highlighting novel pathotype-specific gene interactions and mechanisms. Analysis of responders vs non-responders revealed higher expression of apoptosis regulating gene-gene interactions in patients with good response to conventional synthetic DMARD. Detailed analysis of interactions between pairs of network-linked genes identified the SOCS2/STAT2 ratio as predictive of treatment success, improving ROC area under curve (AUC) from 0.62 to 0.78. We identified a key role for angiogenesis, observing significant statistical interactions between NOS3 (eNOS) and both CAMK1 and eNOS activator AKT3 when comparing responders and non-responders. The ratio of CAMKD2/NOS3 enhanced a prediction model of response improving ROC AUC from 0.63 to 0.73. CONCLUSIONS: We demonstrate a novel, powerful method which harnesses gene interaction networks for leveraging biologically relevant gene-gene interactions leading to improved models for predicting treatment response.

Virus finding tools: current solutions and limitations.

MOTIVATION: The study of the Human Virome remains challenging nowadays. Viral metagenomics, through high-throughput sequencing data, is the best choice for virus discovery. The metagenomics approach is culture-independent and sequence-independent, helping search for either known or novel viruses. Though it is estimated that more than 40% of the viruses found in metagenomics analysis are not recognizable, we decided to analyze several tools to identify and discover viruses in RNA-seq samples. RESULTS: We have analyzed eight Virus Tools for the identification of viruses in RNA-seq data. These tools were compared using a synthetic dataset of 30 viruses and a real one. Our analysis shows that no tool succeeds in recognizing all the viruses in the datasets. So we can conclude that each of these tools has pros and cons, and their choice depends on the application domain. AVAILABILITY: Synthetic data used through the review and raw results of their analysis can be found at https://zenodo.org/record/6426147. FASTQ files of real data can be found in GEO (https://www.ncbi.nlm.nih.gov/gds) or ENA (https://www.ebi.ac.uk/ena/browser/home). Raw results of their analysis can be downloaded from https://zenodo.org/record/6425917.

BioTAGME: A Comprehensive Platform for Biological Knowledge Network Analysis.

The inference of novel knowledge and new hypotheses from the current literature analysis is crucial in making new scientific discoveries. In bio-medicine, given the enormous amount of literature and knowledge bases available, the automatic gain of knowledge concerning relationships among biological elements, in the form of semantically related terms (or entities), is rising novel research challenges and corresponding applications. In this regard, we propose BioTAGME, a system that combines an entity-annotation framework based on Wikipedia corpus (i.e., TAGME tool) with a network-based inference methodology (i.e., DT-Hybrid). This integration aims to create an extensive Knowledge Graph modeling relations among biological terms and phrases extracted from titles and abstracts of papers available in PubMed. The framework consists of a back-end and a front-end. The back-end is entirely implemented in Scala and runs on top of a Spark cluster that distributes the computing effort among several machines. The front-end is released through the Laravel framework, connected with the Neo4j graph database to store the knowledge graph.

Computational Methods for Drug Repurposing.

The wealth of knowledge and multi-omics data available in drug research has allowed the rise of several computational methods in the drug discovery field, resulting in a novel and exciting strategy called drug repurposing. Drug repurposing consists in finding new applications for existing drugs. Numerous computational methods perform a high-level integration of different knowledge sources to facilitate the discovery of unknown mechanisms. In this chapter, we present a survey of data resources and computational tools available for drug repositioning.

Pathway Analysis for Cancer Research and Precision Oncology Applications.

With the advent of OMICs technologies, several bioinformatics methods have been developed to infer biological knowledge from such data. Pathway analysis methodologies help integrate multi-OMICs data and find altered function in known metabolic and signaling pathways. As widely known, such alterations promote the cancer cells' progression and the maintenance of the malignant state. In this chapter, we provide (i) a comprehensive description of the primary data sources for omics data, cancer "omics" projects, and precision oncology knowledge bases; (ii) a survey of the main biological pathway databases; (iii) and a global view of the principal pathway analysis tools and methodologies, describing their main characteristics and shortcomings highlighting their potential applications in cancer research and precision oncology.

Computational Resources for the Interpretation of Variations in Cancer.

A broad ecosystem of resources, databases, and systems to analyze cancer variations is present in the literature. These are a strategic element in the interpretation of NGS experiments. However, the intrinsic wealth of data from RNA-seq, ChipSeq, and DNA-seq can be fully exploited only with the proper skill and knowledge. In this chapter, we survey relevant literature concerning databases, annotators, and variant prioritization tools.

NETME: on-the-fly knowledge network construction from biomedical literature.

BACKGROUND: The rapidly increasing biological literature is a key resource to automatically extract and gain knowledge concerning biological elements and their relations. Knowledge Networks are helpful tools in the context of biological knowledge discovery and modeling. RESULTS: We introduce a novel system called NETME, which, starting from a set of full-texts obtained from PubMed, through an easy-to-use web interface, interactively extracts biological elements from ontological databases and then synthesizes a network inferring relations among such elements. The results clearly show that our tool is capable of inferring comprehensive and reliable biological networks. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s41109-021-00435-x.

Novel Mechanisms of Tumor Promotion by the Insulin Receptor Isoform A in Triple-Negative Breast Cancer Cells.

The insulin receptor isoform A (IR-A) plays an increasingly recognized role in fetal growth and tumor biology in response to circulating insulin and/or locally produced IGF2. This role seems not to be shared by the IR isoform B (IR-B). We aimed to dissect the specific impact of IR isoforms in modulating insulin signaling in triple negative breast cancer (TNBC) cells. We generated murine 4T1 TNBC cells deleted from the endogenous insulin receptor (INSR) gene and expressing comparable levels of either human IR-A or IR-B. We then measured IR isoform-specific in vitro and in vivo biological effects and transcriptome in response to insulin. Overall, the IR-A was more potent than the IR-B in mediating cell migration, invasion, and in vivo tumor growth. Transcriptome analysis showed that approximately 89% of insulin-stimulated transcripts depended solely on the expression of the specific isoform. Notably, in cells overexpressing IR-A, insulin strongly induced genes involved in tumor progression and immune evasion including chemokines and genes related to innate immunity. Conversely, in IR-B overexpressing cells, insulin predominantly induced the expression of genes primarily involved in the regulation of metabolic pathways and, to a lesser extent, tumor growth and angiogenesis.

MiREDiBase, a manually curated database of validated and putative editing events in microRNAs.

MicroRNAs (miRNAs) are regulatory small non-coding RNAs that function as translational repressors. MiRNAs are involved in most cellular processes, and their expression and function are presided by several factors. Amongst, miRNA editing is an epitranscriptional modification that alters the original nucleotide sequence of selected miRNAs, possibly influencing their biogenesis and target-binding ability. A-to-I and C-to-U RNA editing are recognized as the canonical types, with the A-to-I type being the predominant one. Albeit some bioinformatics resources have been implemented to collect RNA editing data, it still lacks a comprehensive resource explicitly dedicated to miRNA editing. Here, we present MiREDiBase, a manually curated catalog of editing events in miRNAs. The current version includes 3,059 unique validated and putative editing sites from 626 pre-miRNAs in humans and three primates. Editing events in mature human miRNAs are supplied with miRNA-target predictions and enrichment analysis, while minimum free energy structures are inferred for edited pre-miRNAs. MiREDiBase represents a valuable tool for cell biology and biomedical research and will be continuously updated and expanded at https://ncrnaome.osumc.edu/miredibase .

VECTOR: An Integrated Correlation Network Database for the Identification of CeRNA Axes in Uveal Melanoma.

Uveal melanoma (UM) is the most common primary intraocular malignant tumor in adults and, although its genetic background has been extensively studied, little is known about the contribution of non-coding RNAs (ncRNAs) to its pathogenesis. Indeed, its competitive endogenous RNA (ceRNA) regulatory network comprising microRNAs (miRNAs), long non-coding RNAs (lncRNAs) and mRNAs has been insufficiently explored. Thanks to UM findings from The Cancer Genome Atlas (TCGA), it is now possible to statistically elaborate these data to identify the expression relationships among RNAs and correlative interaction data. In the present work, we propose the VECTOR (uVeal mElanoma Correlation NeTwORk) database, an interactive tool that identifies and visualizes the relationships among RNA molecules, based on the ceRNA model. The VECTOR database contains: i) the TCGA-derived expression correlation values of miRNA-mRNA, miRNA-lncRNA and lncRNA-mRNA pairs combined with predicted or validated RNA-RNA interactions; ii) data of sense-antisense sequence overlapping; iii) correlation values of Transcription Factor (TF)-miRNA, TF-lncRNA, and TF-mRNA pairs associated with ChiPseq data; iv) expression data of miRNAs, lncRNAs and mRNAs both in UM and physiological tissues. The VECTOR web interface can be queried, by inputting the gene name, to retrieve all the information about RNA signaling and visualize this as a graph. Finally, VECTOR provides a very detailed picture of ceRNA networks in UM and could be a very useful tool for researchers studying RNA signaling in UM. The web version of Vector is freely available at the URL reported at the end of the Introduction.

RNAdetector: a free user-friendly stand-alone and cloud-based system for RNA-Seq data analysis.

BACKGROUND: RNA-Seq is a well-established technology extensively used for transcriptome profiling, allowing the analysis of coding and non-coding RNA molecules. However, this technology produces a vast amount of data requiring sophisticated computational approaches for their analysis than other traditional technologies such as Real-Time PCR or microarrays, strongly discouraging non-expert users. For this reason, dozens of pipelines have been deployed for the analysis of RNA-Seq data. Although interesting, these present several limitations and their usage require a technical background, which may be uncommon in small research laboratories. Therefore, the application of these technologies in such contexts is still limited and causes a clear bottleneck in knowledge advancement. RESULTS: Motivated by these considerations, we have developed RNAdetector, a new free cross-platform and user-friendly RNA-Seq data analysis software that can be used locally or in cloud environments through an easy-to-use Graphical User Interface allowing the analysis of coding and non-coding RNAs from RNA-Seq datasets of any sequenced biological species. CONCLUSIONS: RNAdetector is a new software that fills an essential gap between the needs of biomedical and research labs to process RNA-Seq data and their common lack of technical background in performing such analysis, which usually relies on outsourcing such steps to third party bioinformatics facilities or using expensive commercial software.