Tracking the potyviral P1 protein in Nicotiana benthamiana plants during plum pox virus infection.

The P1 protein is derived from the N terminus of potyvirus-coded polyprotein. In addition to the proteolytic activity essential for its maturation, it probably participates in suppression of host defense and/or in virus replication. Clear validation of the P1 in vivo function(s), however, is not yet available. We applied an infectious cDNA clone of plum pox virus (PPV), where the P1 was N-fused with a hexahistidine tag, to trace this protein in Nicotiana benthamiana plants during the PPV infection. Immunoblot analysis with the anti-his antibody showed a diffuse band corresponding to the molecular weight about 70-80 kDa (about twice larger than expected) in the root samples from early stage of infection. This signal culminated on the sixth day post inoculation, later it rapidly disappeared. Sample denaturation by boiling in SDS before centrifugal clarification was essential, indicating strong affinity of P1-his to some plant compound sedimenting with the tissue and cell debris.

Detection and molecular characterization of Slovak tomato isolates belonging to two recombinant strains of potato virus Y.

Total RNAs from a symptomless tomato plant were subjected to next-generation sequencing (NGS) analysis, revealing the presence of a single viral agent - potato virus Y (PVY). The analysis of determined full-length genome sequence assigned the PVY SL16 isolate to the recombinant PVY-N-Wi strain group. A series of primers targeting the four main recombinant junction (RJ) sites were used for characterization of additional 5 tomato PVY isolates recovered in Western Slovakia. Based on the partial sequences, the isolates could be classified as belonging to PVY-N-Wi and PVY-NTNa strain groups. Interestingly, both these distinct recombinant PVY types were identified in mixed infection in one tomato sample (SL31). Our results further reinforce the data on the complexity of PVY infection and confirm the recombination as a significant evolutionary process shaping the PVY diversity.

Analysis of the complete sequences of two biologically distinct Zucchini yellow mosaic virus isolates further evidences the involvement of a single amino acid in the virus pathogenicity.

The complete genome sequences of two Slovak Zucchini yellow mosaic virus isolates (ZYMV-H and ZYMV-SE04T) were determined. These isolates differ significantly in their pathogenicity, producing either severe or very mild symptoms on susceptible cucurbit hosts. The viral genome of both isolates consisted of 9593 nucleotides in size, and contained an open reading frame encoding a single polyprotein of 3080 amino acids. Despite their different biological properties, an extremely high nucleotide identity could be noted (99.8%), resulting in differences of only 5 aa, located in the HC-Pro, P3, and NIb, respectively. In silico analysis including 5 additional fully-sequenced and phylogenetically closely-related isolates known to induce different symptoms in cucurbits was performed. This suggested that the key single mutation responsible for virus pathogenicity is likely located in the N-terminal part of P3, adjacent to the PIPO.

Analysis of a short genomic region of Grapevine leafroll-associated virus 1 (GLRaV-1) reveals the presence of two different molecular groups of isolates in Slovakia.

Although grapevine leafroll-associated virus 1 (GLRaV-1) is one of the most important agents of the grapevine leafroll disease, the data about its molecular variability are scarce. In order to assess the GLRaV-1 diversity in Slovakia, the sequence of a genome region encoding the central part of the capsid protein (CP) gene was determined from 18 GLRaV-1 isolates. Despite the fact that the analysis targeted a relatively short portion of the genome, comparison of obtained sequences has revealed the nucleotide identities between Slovak isolates ranging from 83.0-100%. Phylogenetic analysis indicated the presence of two distinct molecular groups of GLRaV-1 in Slovakia.

Plum pox virus accumulates mutations in different genome parts during a long-term maintenance in Prunus host plants and passage in Nicotiana benthamiana.

Plum pox virus (PPV) isolates of the strain PPV-M prevalently infect peaches under natural conditions in Middle Europe. Comparison of complete genome sequences obtained from subisolates of a PPV-M isolate maintained experimentally over a 6-year period in different Prunus host species and passaged in Nicotiana benthamiana was performed with the aim to highlight the mutations potentially connected with the virus-host adaptation. The results showed that the lowest number of non-silent mutations was accumulated in PPV-M maintained in peach (original host species), approximately two times higher diversity was recorded in plum, apricot and N. benthamiana, indicating the genetic determination of the PPV host preference. The sequence variability of Prunus subisolates was distributed more or less evenly along the PPV genome and no amino acid motif could be outlined as responsible for the host adaptation. In N. benthamiana the mutations were accumulated notably in the P1 and P3 genes indicating their non-essentiality in the infection of this experimental host plant.

Unfolding the secrets of plum pox virus: from epidemiology to genomics.

Over an approximately 80-year period since the description of the Sharka disease, the plum pox virus (PPV) has been thoroughly studied on various levels of the infection cycle. World-wide distribution of the virus, severity of the disease for the fruit industry with a potential to be further increased and discovery/emergence of new strains make PPV the most epidemiologically important viral pathogen of stone fruit trees. The history of PPV research reflects the development of analytical methods applicable in plant virology. In particular the establishment of molecular biology with reverse genetics and improvement of DNA sequencing technology have further contributed to the increase in knowledge on PPV variability, evolution, replication and interaction with host plants. This review gives a comprehensive summary of PPV data accumulated progressively, from the biological characterization of the disease to recent attempts aimed at using the PPV-based vectors for expression of exogenous proteins in plants.

Cloning of the complete infectious cDNA of the plum pox virus strain PPV-Rec.

UNLABELLED: Plum pox virus (PPV) is the causal agent of Sharka, considered to be the most detrimental viral disease of Prunus spp. worldwide. So far, several PPV strains have been recognized, three of them (PPV-D, PPV-M, and PPV-Rec) having shown serious economic impact in the European area. Infectious cDNA clones of plant RNA viruses are excellent tools for functional studies of viral genomes. Preparation and use of PPV-D and PPV-M infectious clones have been previously reported. Here we describe the construction of an infectious cDNA clone of the strain PPV-Rec (isolate BOR-3) by the strategy involving the subsequent exchanges of homologous BOR-3 genome parts in the backbone of the previously prepared PPV-D infectious construct. The infectivity of each intermediate chimeric cDNA as well as that of the final construct (pIC-PPV-Rec) was confirmed by biolistic transfection of Nicotiana benthamiana plants. Complete sequence of the cloned viral BOR-3 cDNA revealed 0.14% of difference at the nucleotide level compared to original BOR-3 sequence, resulting in four amino acid changes. This slight inequality was related to the population heterogeneity of the initial BOR-3 isolate; no difference in the amino acid sequence resulted from the cloning steps performed. KEYWORDS: inter-strain chimera; biolistics; genome sequence.

A single amino acid mutation alters the capsid protein electrophoretic double-band phenotype of the Plum pox virus strain PPV-Rec.

Plum pox virus (PPV) isolates differ by their capsid protein (CP) mobility in SDS-PAGE. These electrophoretic phenotypes are likely to result from post-translational modifications of the CP. We demonstrated that the CP mobility was solely determined by the CP N-terminal region. Sequence comparison pinpointed a possible role of mutations at position 66 in determining the CP phenotype of PPV-Rec isolates. Site-directed mutagenesis of a chimeric clone demonstrated that Gly(66) in the CP resulted in the double-band phenotype, while Arg(66) led to a single-band CP pattern, possibly by preventing the phosphorylation of a nearby Ser residue by steric hindrance.

Analysis of multiple virus-infected grapevine plant reveals persistence but uneven virus distribution.

LN33 grapevine plants were artificially inoculated with budwoods originating from a field-cultivated Traminer grapevine which was naturally infected with Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine virus A (GVA), Grapevine virus B (GVB), Rupestris stem pitting-associated virus (RSPaV), and an unclassified tymovirus. Four years after inoculation, a comparison of the cane weights between healthy and infected grapevines did not show any significant difference. Corky bark symptoms or destructive effects of GVB infection never appeared on the infected grapevines. Dormant canes, sampled before the beginning of the vegetation period, were used for detection of grapevine viruses by ELISA or RT-PCR. ELISA turned out unexpectedly to be more effective than RT-PCR for detecting GLRaV-1 probably due to an insufficient specificity of the primers used, not reflecting the actual genetic variability of the virus. Distribution of viruses in the infected grapevines showed a different degree of irregularity in dependence on individual viruses. Therefore, in order to properly verify the sanitary status of grapevines under testing, several random samples from different parts of a tested plant have to be analyzed.

The determinant of potyvirus ability to overcome the RTM resistance of Arabidopsis thaliana maps to the N-terminal region of the coat protein.

In Arabidopsis thaliana Columbia (Col-0) plants, the restriction of Tobacco etch virus (TEV) long-distance movement involves at least three dominant RTM (restricted TEV movement) genes named RTM1, RTM2, and RTM3. Previous work has established that, while the RTM-mediated resistance is also effective against other potyviruses, such as Plum pox virus (PPV) and Lettuce mosaic virus (LMV), some isolates of these viruses are able to overcome the RTM mechanism. In order to identify the viral determinant of this RTM-resistance breaking, the biological properties of recombinants between PPV-R, which systemically infects Col-0, and PPV-PSes, restricted by the RTM resistance, were evaluated. Recombinants that contain the PPV-R coat protein (CP) sequence in an RTM-restricted background are able to systemically infect Col-0. The use of recombinants carrying chimeric CP genes indicated that one or more PPV resistance-breaking determinants map to the 5' half of the CP gene. In the case of LMV, sequencing of independent RTM-breaking variants recovered after serial passages of the LMV AF199 isolate on Col-0 plants revealed, in each case, amino acid changes in the CP N-terminal region, close to the DAG motif. Taken together, these findings demonstrate that the potyvirus CP N-terminal region determines the outcome of the interaction with the RTM-mediated resistance.

Molecular characterization of geographically different cucurbit aphid-borne yellows virus isolates.

Cucurbit aphid-borne yellows virus (CABYV) causes yellowing symptoms in cucurbit crops worldwide. In this work, the sequences for the coat protein (CP) gene for CABYV isolates from Iran and Slovakia are reported for the first time. Three Iranian isolates shared 96.2-99.3% and the Slovak isolate 98.9% of nucleotide identity in comparison with the reference French CABYV-N isolate. Phylogenetic analysis showed that the sequence of CP gene of examined CABYV isolates differed only slightly. Relatively close relationship and sequence similarity of geographically distant CABYV isolates could reflect the epidemic outbreak and rapid expansion of the virus throughout the world due to the host and vector abundance.

First Report of Plum pox virus Recombinant Strain on Prunus spp. in Canada.

In July of 2008, during the Canadian Plum pox virus (PPV) eradication survey, three Prunus spp. trees (B-5, B-6, and C-1) in a home owner's yard in Grimsby, ON, Canada were found to be infected with PPV by triple antibody sandwich (TAS)-ELISA using the 5B generic monoclonal detecting antibody (1) and reverse transcription (RT)-PCR using the well-validated universal primer set P1/P2. All three trees were grafted on an unknown plum rootstock cultivar. Tree B-5 contained grafts of unknown peach (P. persica) and plum (P. domestica) cultivars, tree B-6 contained the same peach graft as tree B-5 and an unknown apricot (P. armeniaca) cultivar, and tree C-1 was grafted with the same plum cultivar as tree B-5. Strain typing was done by TAS-ELISA using strain-specific monoclonal antibodies for D, M, C, and EA strains. Positive results were obtained with the M-specific test. Strain typing by RT-PCR also was done using primers specific for D, M, W, and recombinant (Rec) strains. Positive results were obtained with the M and Rec primers (4). The 605-bp fragment generated by the PPV Rec primers, which spans the recombination site, was cloned and sequenced. The nucleotide sequences obtained from B-5, B-6, and C-1 are 99% identical to each other and approximately 98 and 99% identical to the PPV Rec isolates BOR-3 and J4c, respectively. Correspondingly, percentage identities are approximately 90% for PPV M, 84% for PPV isolate D-Fan (a typical Canadian D isolate), and 69% for PPV W. The deduced amino acid sequence of B-5, B-6, and C-1 are 98 to 99% identical to each other, 99% identical to the PPV Rec isolates BOR-3 and J4c, 92% identical to isolates of PPV M, and only 84% identical to the typical Canadian D isolate PPV Fan. The P3-6K1 genomic region was amplified using primers that generate a 836-bp fragment (2). This region was 97 to 98% identical to the PPV Rec isolates BOR-3 and J4c, 96 to 97% identical to isolates of PPV D, but only 86% identical to isolates of PPV M. The data above confirm that the PPV isolates B-5, B-6, and C-1 belong to the strain PPV Rec (3). To our knowledge, this is the first report of PPV Rec in North America, and together with PPV D and W, it represents the third PPV strain found on this continent. An intensive survey of all Prunus spp. within a 1.5-km radius area surrounding the home owner's property failed to reveal any additional PPV-positive plants. The three positive plants were removed. References: (1) M. Cambra et al. EPPO Bull. 24:569, 1994. (2) M. Glasa et al. Arch. Virol. 147:563, 2002. (3) M. Glasa et al. J. Gen. Virol. 85:2671, 2004. (4) A. Subr et al. Acta Virol. 48:173, 2004.

Plum pox virus variability detected by the advanced analytical methods.

Plum pox virus (PPV) infects stone-fruit trees with important economical impact mainly in Europe and Mediterranean region. The data about PPV intra-species variability accumulated markedly in the last two decades. Six PPV strains have been recognized using different approaches including serology, protein analysis, specific amplification, and genome sequencing. Reliable and sensitive diagnostics is the most important requirement for application of early control and safety measures. Therefore, many techniques and their modifications have been adapted to detect PPV and its different forms. Here, we review the improvement of the PPV detection and variability analysis in the context of progress in laboratory methods since the virus discovery till today.

First Report of Wheat streak mosaic virus in Slovakia.

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5' GAGAGCAATACTGCGTGTACG 3' and WS-8909R 5' GCATAATGGCTCGAAGTGATG 3') designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Two biologically distinct isolates of Zucchini yellow mosaic virus lack seed transmissibility in cucumber.

The seed transmission of the Zucchini yellow mosaic virus (ZYMV) was studied in cucumber using two isolates unrelated in their biological characteristics. Although the virus could be readily detected in mature seeds harvested from infected cucumbers, the seedlings obtained from infected germinated seeds tested negative for ZYMV using both ELISA and RT-PCR assays. No evidence was obtained for transmission of two ZYMV isolates through seeds.

Partial molecular characterization of a mild isolate of Grapevine fanleaf virus from South Moravia, Czech Republic.

An atypical mild isolate HV5 of Grapevine fanleaf virus (GFLV) was found in a South Moravian viticulture region in Czech Republic. Partial sequence of its RNA2 was determined and compared with available sequences of typical GFLV isolates. Two genomic regions, namely a 814 nt-long one spanning the movement protein (MP) gene and a 5'-part of the coat protein (CP) gene. and a 1426 nt-long one covering a part of the CP gene and the adjacent 3'-non-coding region (3'-NCR) were analyzed. Although no HV5-specific molecular features could be found in the two regions, marked differences were observed in the 3'-NCR. There was a 54 nt-long portion in which the sequence identity of some compared isolates was only 54.7%. Moreover, an unique one-nucleotide deletion occurred in the HV5 3'-NCR. These changes were also reflected in the predicted RNA secondary structure of this region. Particular biological behavior of GFLV HV5 isolate, namely a symptomless infection, could be related to the observed molecular differences.

Plum Pox Virus Mixed Infection Detected on Apricot in Pakistan.

Sharka, caused by Plum pox virus (PPV), is the most detrimental viral disease of stone fruit trees. First reported from Bulgaria in 1917, the virus is now widespread in Europe, the Mediterranean Basin, and Asia Minor and is sporadically present in North and South America. On the basis of molecular and serological properties, six PPV subgroups are recognized, from which PPV-D, PPV-M, and PPV-Rec are the most common (1,2). Several apricot trees (Prunus armeniaca) showing mild, pale green rings and diffuse chlorotic spots on leaves were found in a small orchard in the Baltistan District in northern Pakistan at approximately 2,400 m above sea level. Dried leaf samples from one symptomatic tree randomly selected from the orchard were positive for PPV using double-antibody sandwich enzyme-linked immunosorbent assay with antisera prepared in the laboratory, immunoblot analysis, and reverse transcription-polymerase chain reaction (RT-PCR) targeting the capsid protein (CP) gene using standard procedures (1). To check the subgroup affiliation and evaluate the molecular variability, the 562-bp variable region spanning the C-terminus of NIb and the N-terminus of the CP was amplified, the RT-PCR product was cloned into the pGEM-T Easy vector (Promega, Madison, WI), and positive clones were analyzed by restriction and sequence analyses. Interestingly, sequence analysis of four clones revealed mixed infection, i.e., the presence of two different PPV isolates in the apricot sample. One isolate belonged to PPV-D (GenBank Accession No. DQ422147) and the other belonged to the PPV-Rec subgroup (GenBank Accession No. DQ422148). Multiple alignment of the sequenced genome portion of the Pakistan PPV-D isolate indicated 96 to 99% nt identity with various PPV-D isolates without unique, clear-cut differences. Similarly, the PPV-Rec isolate had 98 to 99% identity with European PPV-Rec isolates and retained the cross-over at nucleotide position 8450 in the 3' terminus of NIb. This sequence had the amino acid signature at the N-terminus of the CP typical of the PPV-Rec subgroup (2). Moreover, no particular clustering of the Pakistan isolates within PPV-D and PPV-Rec could be observed after phylogenetic analysis. The DAG motif, essential for aphid transmission, was present in both sequences. To our knowledge, this is the first indication of PPV occurrence in Pakistan and first identification of the PPV-Rec isolate outside Europe. Together with previous reports on the PPV presence in China and Kazakhstan (3,4), this report indicates the need for more detailed epidemiological studies focusing the PPV spread and its molecular diversity in Asia. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. Glasa et al. J. Gen. Virol. 85:2671, 2004. (3) M. Navrátil et al. Plant Dis. 89:338, 2005. (4) S. Spiegel et al. Plant Dis. 88:973, 2004.

Analysis of recombinant Plum pox virus (PPV) isolates from Serbia confirms genetic homogeneity and supports a regional origin for the PPV-Rec subgroup.

The recent observation of the frequent occurrence of natural recombinant Plum pox virus (PPV) isolates has led to the identification of a distinct PPV subgroup, named PPV-Rec. The diversity, origin and geographical spread of the recombinant PPV isolates belonging to this subgroup remain, however, relatively poorly known. In an effort to further our understanding of these isolates, eight PPV isolates from Serbia, the country from which the first such recombinant (PPV-o6) originated, were characterized. Depending on the genomic region targeted by different typing assays, seven of the eight isolates tested presented discrepancies in their typing behavior. Sequence analysis of the (Cter)NIb-(Nter)CP region confirmed the recombinant nature of these seven isolates which all presented an identical recombination breakpoint identical to previously characterized PPV-Rec isolates. Biological indexing and immunoblot analysis provided indications that asymptomatic infection of the GF305 peach indicator and migration of the coat protein as a double-band in immunoblots may represent conserved and discriminating properties of PPV-Rec isolates. The genetic diversity of PPV-Rec isolates from former Yugoslavia (Serbia, Bosnia and Herzegovina) was estimated to be twice as large as that of the PPV-Rec isolates obtained from all other countries to date (Albania, Bulgaria, Czech republic, Germany, Hungary and Slovakia). These last results are consistent with the hypothesis that former Yugoslavia is the center of dispersion of PPV-Rec. Taken together, the results presented here provide further evidence for the wide distribution and temporal genetic stability of these natural PPV recombinant isolates and provide for the first time a possible scenario for their dispersion throughout central and eastern Europe.