Typical and extreme weather datasets for studying the resilience of buildings to climate change and heatwaves.

We present unprecedented datasets of current and future projected weather files for building simulations in 15 major cities distributed across 10 climate zones worldwide. The datasets include ambient air temperature, relative humidity, atmospheric pressure, direct and diffuse solar irradiance, and wind speed at hourly resolution, which are essential climate elements needed to undertake building simulations. The datasets contain typical and extreme weather years in the EnergyPlus weather file (EPW) format and multiyear projections in comma-separated value (CSV) format for three periods: historical (2001-2020), future mid-term (2041-2060), and future long-term (2081-2100). The datasets were generated from projections of one regional climate model, which were bias-corrected using multiyear observational data for each city. The methodology used makes the datasets among the first to incorporate complex changes in the future climate for the frequency, duration, and magnitude of extreme temperatures. These datasets, created within the IEA EBC Annex 80 "Resilient Cooling for Buildings", are ready to be used for different types of building adaptation and resilience studies to climate change and heatwaves.

Development of a Polyethylene Glycol/Polymethyl Methacrylate-Based Binder System for a Borosilicate Glass Filler Suitable for Injection Molding.

Powder injection molding is an established, cost effective and often near-net-shape mass production process for metal or ceramic parts with complex geometries. This paper deals with the extension of the powder injection molding process chain towards the usage of a commercially available borosilicate glass and the realization of glass compounds with huge densities. The whole process chain consists of the individual steps of compounding, molding, debinding, and sintering. The first part, namely, the search for a suitable feedstock composition with a very high solid load and reliable molding properties, is mandatory for the successful manufacture of a dense glass part. The most prominent feature is the binder composition and the related comprehensive rheological characterization. In this work, a binder system consisting of polyethylene glycol and polymethylmethacrylate with stearic acid as a surfactant was selected and its suitability for glass injection molding was evaluated. The influence of all feedstock components on processing and of the process steps on the final sintered part was investigated for sintered glass parts with densities around 99% of the theoretical value.

Fibromyalgia-associated hyperalgesia is related to psychopathological alterations but not to gut microbiome changes.

Fibromyalgia-syndrome (FMS) is a complex disease characterized by chronic widespread pain and additional symptoms including depression, cognitive dysfunction ("fibro-fog") and maldigestion. Our research team examined whether FMS-related pain parameters assessed by quantitative sensory testing (QST) and psychological disturbances are accompanied by alterations of the fecal microbiome. We recruited 25 patients with FMS and 26 age- and sex-matched healthy controls. Medical background, food habits, psychopathology and quality of life were assessed through questionnaires. Stool samples were analyzed by 16S rRNA gene amplification and sequencing. QST was performed according to the protocol of the German Network for Neuropathic Pain. QST showed that both lemniscal and spinothalamic afferent pathways are altered in FMS patients relative to healthy controls and that peripheral as well as central pain sensitization processes are manifest. Psychometric assessment revealed enhanced scores of depression, anxiety and stress. In contrast, neither the composition nor the alpha- and beta-diversity of the fecal microbiome was changed in FMS patients. FMS patients segregate from healthy controls in various parameters of QST and psychopathology, but not in terms of composition and diversity of the fecal microbiome. Despite consideration of several confounding factors, we conclude that the contribution of the gut microbiome to the pathophysiology of FMS is limited.

Anhedonia induced by high-fat diet in mice depends on gut microbiota and leptin.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this work, we examined the role of the intestinal microbiota and the adipocytokine leptin as potential mediators of the effects of HFD to induce anhedonia-like behavior and reduce self-care in mice.Methods: Male mice were fed a control diet or HFD (60 kJ% from fat) for a period of 4 weeks, after which behavioral tests and molecular analyses (gut microbiome composition, intestinal metabolome, fecal fatty acids, plasma hormone levels) were performed. The role of the intestinal microbiota was addressed by selective depletion of gut bacteria with a combination of non-absorbable antibiotics, while the implication of leptin was examined by the use of leptin-deficient ob/ob mice.Results: Antibiotic treatment reduced the HFD-induced weight gain and adiposity and prevented HFD-induced anhedonia-like behavior and self-care reduction. These effects were associated with a decrease in fecal fatty acids and intestinal microbiota-related metabolites including short-chain fatty acids, glucose and amino acids. Gut microbiota depletion suppressed the HFD-induced rise of plasma leptin, and the circulating leptin levels correlated with the anhedonia-like behavior and reduced self-care caused by HFD. The anhedonic effect of HFD was absent in leptin-deficient ob/ob mice although these animals gained more weight and adiposity in response to HFD than wild-type mice.Discussion: The results indicate that anhedonia-like behavior induced by HFD in mice depends on the intestinal microbiome and involves leptin as a signaling hormone.

Dietary spermidine improves cognitive function.

Decreased cognitive performance is a hallmark of brain aging, but the underlying mechanisms and potential therapeutic avenues remain poorly understood. Recent studies have revealed health-protective and lifespan-extending effects of dietary spermidine, a natural autophagy-promoting polyamine. Here, we show that dietary spermidine passes the blood-brain barrier in mice and increases hippocampal eIF5A hypusination and mitochondrial function. Spermidine feeding in aged mice affects behavior in homecage environment tasks, improves spatial learning, and increases hippocampal respiratory competence. In a Drosophila aging model, spermidine boosts mitochondrial respiratory capacity, an effect that requires the autophagy regulator Atg7 and the mitophagy mediators Parkin and Pink1. Neuron-specific Pink1 knockdown abolishes spermidine-induced improvement of olfactory associative learning. This suggests that the maintenance of mitochondrial and autophagic function is essential for enhanced cognition by spermidine feeding. Finally, we show large-scale prospective data linking higher dietary spermidine intake with a reduced risk for cognitive impairment in humans.

Lack of peptide YY signaling in mice disturbs gut microbiome composition in response to high-fat diet.

Peptide YY (PYY), produced by endocrine L cells in the gut, is known for its critical role in regulating gastrointestinal functions as well as satiety. However, how these processes are integrated with maintaining a healthy gut microbiome composition is unknown. Here, we show that lack of PYY in mice leads to distinct changes in gut microbiome composition that are diet-dependent. While under chow diet only slight differences in gut microbiome composition could be observed, high-fat diet (HFD) aggravated these differences. Specifically an increased abundance of the Bacteroidetes phylum with a corresponding decrease of the Firmicutes/Bacteroidetes ratio could be detected in Pyy-knockout (KO) mice in response to HFD. Detailed analysis of the Bacteroidetes phylum further revealed that the Alistipes genus belonging to the Rikenellaceae family, the Parabacteroides belonging to the Tannerellaceae family, as well as Muribaculum were increased in Pyy-KO mice. In order to investigate whether these changes are associated with changed markers of gut barrier and immunity, we analyzed the colonic expression of various pro-inflammatory cytokines, as well as tight junction proteins and mucin 2, and identified increased mRNA expression of the tight junction proteins Cldn2 and Ocel1 in Pyy-KO mice, while pro-inflammatory cytokine expression was not significantly altered. Together these results highlight a critical gene-environment interaction between diet and the gut microbiome and its impact on homeostasis of the intestinal epithelium under conditions of reduced PYY signaling which is commonly seen under obese conditions.

Galanin receptor 3 attenuates inflammation and influences the gut microbiota in an experimental murine colitis model.

The regulatory (neuro)peptide galanin and its three receptors (GAL1-3R) are involved in immunity and inflammation. Galanin alleviated inflammatory bowel disease (IBD) in rats. However, studies on the galanin receptors involved are lacking. We aimed to determine galanin receptor expression in IBD patients and to evaluate if GAL2R and GAL3R contribute to murine colitis. Immunohistochemical analysis revealed that granulocytes in colon specimens of IBD patients (Crohn's disease and ulcerative colitis) expressed GAL2R and GAL3R but not GAL1R. After colitis induction with 2% dextran sulfate sodium (DSS) for 7 days, mice lacking GAL3R (GAL3R-KO) lost more body weight, exhibited more severe colonic inflammation and aggravated histologic damage, with increased infiltration of neutrophils compared to wild-type animals. Loss of GAL3R resulted in higher local and systemic inflammatory cytokine/chemokine levels. Remarkably, colitis-associated changes to the intestinal microbiota, as assessed by quantitative culture-independent techniques, were most pronounced in GAL3R-KO mice, characterized by elevated numbers of enterobacteria and bifidobacteria. In contrast, GAL2R deletion did not influence the course of colitis. In conclusion, granulocyte GAL2R and GAL3R expression is related to IBD activity in humans, and DSS-induced colitis in mice is strongly affected by GAL3R loss. Consequently, GAL3R poses a novel therapeutic target for IBD.

Constipation Caused by Anti-calcitonin Gene-Related Peptide Migraine Therapeutics Explained by Antagonism of Calcitonin Gene-Related Peptide's Motor-Stimulating and Prosecretory Function in the Intestine.

The development of small-molecule calcitonin gene-related peptide (CGRP) receptor antagonists (gepants) and of monoclonal antibodies targeting the CGRP system has been a major advance in the management of migraine. In the randomized controlled trials before regulatory approval, the safety of these anti-CGRP migraine therapeutics was considered favorable and to stay within the expected profile. Post-approval real-world surveys reveal, however, constipation to be a major adverse event which may affect more than 50% of patients treated with erenumab (an antibody targeting the CGRP receptor), fremanezumab or galcanezumab (antibodies targeting CGRP). In this review article we address the question whether constipation caused by inhibition of CGRP signaling can be mechanistically deduced from the known pharmacological actions and pathophysiological implications of CGRP in the digestive tract. CGRP in the gut is expressed by two distinct neuronal populations: extrinsic primary afferent nerve fibers and distinct neurons of the intrinsic enteric nervous system. In particular, CGRP is a major messenger of enteric sensory neurons which in response to mucosal stimulation activate both ascending excitatory and descending inhibitory neuronal pathways that enable propulsive (peristaltic) motor activity to take place. In addition, CGRP is able to stimulate ion and water secretion into the intestinal lumen. The motor-stimulating and prosecretory actions of CGRP combine in accelerating intestinal transit, an activity profile that has been confirmed by the ability of CGRP to induce diarrhea in mice, dogs and humans. We therefore conclude that the constipation elicited by antibodies targeting CGRP or its receptor results from interference with the physiological function of CGRP in the small and large intestine in which it contributes to the maintenance of peristaltic motor activity, ion and water secretion and intestinal transit.

Transient receptor potential ankyrin 1 contributes to somatic pain hypersensitivity in experimental colitis.

Pain evoked by visceral inflammation is often 'referred' to the somatic level. Transient receptor potential ankyrin 1 (TRPA1) has been reported to contribute to visceral pain-like behavior in dextran sulfate sodium (DSS)-evoked colitis. However, the role of TRPA1 in somatic component of hypersensitivity due to visceral inflammation is unknown. The present study investigated the role of TRPA1 in colitis-evoked mechanical hypersensitivity at the somatic level. Colitis was induced in mice by adding DSS to drinking water for one week. Control and DSS-treated mice were tested for various parameters of colitis as well as mechanical pain sensitivity in abdominal and facial regions. DSS treatment caused mechanical hypersensitivity in the abdominal and facial skin. Pharmacological blockade or genetic deletion of TRPA1 prevented the colitis-associated mechanical hypersensitivity in the abdominal and facial skin areas although the severity of colitis remained unaltered. DSS treatment increased expression of TRPA1 mRNA in cultured dorsal root ganglion (DRG) neurons, but not trigeminal ganglion neurons, and selectively enhanced currents evoked by the TRPA1 agonist, allyl isothiocyanate, in cultured DRG neurons. Our findings indicate that the TRPA1 channel contributes to colitis-associated mechanical hypersensitivity in somatic tissues, an effect associated with upregulation of TRPA1 expression and responsiveness in DRG nociceptors.

Further delineation of putative ACTB loss-of-function variants: A 4-patient series.

ACTB encodes ß-cytoplasmic actin, an essential component of the cytoskeleton. Based on chromosome 7p22.1 deletions that include the ACTB locus and on rare truncating ACTB variants, a phenotype resulting from ACTB haploinsufficiency was recently proposed. We report putative ACTB loss-of-function variants in four patients. To the best of our knowledge, we report the first 7p22.1 microdeletion confined to ACTB and the second ACTB frameshifting mutation that predicts mRNA decay. A de-novo ACTB p.(Gly302Ala) mutation affects ß-cytoplasmic actin distribution. All four patients share a facial gestalt that is distinct from that of individuals with dominant-negative ACTB variants in Baraitser-Winter cerebrofrontofacial syndrome. Two of our patients had strikingly thin and sparse scalp hair. One patient had sagittal craniosynostosis and hypospadias. All three affected male children have attention deficits and mild global developmental delay. Mild intellectual disability was present in only one patient. Heterozygous ACTB deletion can allow for normal psychomotor function.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Experimental colitis reduces microglial cell activation in the mouse brain without affecting microglial cell numbers.

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.

Amyloid-beta impairs insulin signaling by accelerating autophagy-lysosomal degradation of LRP-1 and IR-ß in blood-brain barrier endothelial cells in vitro and in 3XTg-AD mice.

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aß clearance from the brain. Changes in IR-ß and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-ß levels in 9-month-old male and female 3XTg-AD (PS1M146V, APPSwe, and tauP301L) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-ß levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-ß and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aß burden without affecting cerebrovascular LRP-1 and IR-ß levels. In vitro studies using primary porcine (p)BCEC revealed that Aß peptides 1-40 or 1-42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-ß thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aß treatment accelerated the autophagy-lysosomal degradation of IR-ß and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-ß levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aß burden in AD may accelerate LRP-1 and IR-ß degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.

Intranasal Neuropeptide Y Blunts Lipopolysaccharide-Evoked Sickness Behavior but Not the Immune Response in Mice.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 µg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.

Intermittent Fasting Exacerbates the Acute Immune and Behavioral Sickness Response to the Viral Mimic Poly(I:C) in Mice.

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.

An Unbiased Approach of Sampling TEM Sections in Neuroscience.

Investigations of the ultrastructural features of neurons and their synapses are only possible with electron microscopy. Especially for comparative studies of the changes in densities and distributions of such features, an unbiased sampling protocol is vital for reliable results. Here, we present a workflow for the image acquisition of brain samples. The workflow allows systematic uniform random sampling within a defined brain region, and the images can be analyzed using a disector. This technique is much faster than extensive examination of serial sections but still presents a feasible approach to estimate the densities and distributions of ultrastructure features. Before embedding, stained vibratome sections were used as a reference to identify the brain region under investigation, which helped speed up the overall specimen preparation process. This approach was used for comparative studies investigating the effect of an enriched-housing environment on several ultrastructural parameters in the mouse brain. Based on the successful use of the workflow, we adapted it for the purpose of elemental analysis of brain samples. We optimized the protocol in terms of the time of user-interaction. Automating all the time-consuming steps by compiling a script for the open source software SerialEM helps the user to focus on the main work of acquiring the elemental maps. As in the original workflow, we paid attention to the unbiased sampling approach to guarantee reliable results.

High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome.

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by 1H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.

Influence of 4-week multi-strain probiotic administration on resting-state functional connectivity in healthy volunteers.

PURPOSE: Experimental investigations in rodents have contributed significantly to our current understanding of the potential importance of the gut microbiome and brain interactions for neurotransmitter expression, neurodevelopment, and behaviour. However, clinical evidence to support such interactions is still scarce. The present study used a double-blind, randomized, pre- and post-intervention assessment design to investigate the effects of a 4-week multi-strain probiotic administration on whole-brain functional and structural connectivity in healthy volunteers. METHODS: Forty-five healthy volunteers were recruited for this study and were divided equally into three groups (PRP: probiotic, PLP: placebo, and CON: control). All the participants underwent resting-state functional MRI and diffusion MRI brain scans twice during the course of study, at the beginning (time point 1) and after 4 weeks (time point 2). MRI data were acquired using a 3T whole-body MR system (Magnetom Skyra, Siemens, Germany). RESULTS: Functional connectivity (FC) changes were observed in the default mode network (DMN), salience network (SN), and middle and superior frontal gyrus network (MFGN) in the PRP group as compared to the PLP and CON groups. PRP group showed a significant decrease in FC in MFGN (in frontal pole and frontal medial cortex) and in DMN (in frontal lobe) as compared to CON and PLP groups, respectively. Further, significant increase in FC in SN (in cingulate gyrus and precuneus cortex) was also observed in PRP group as compared to CON group. The significance threshold was set to p < 0.05 FWE corrected. No significant structural differences were observed between the three groups. CONCLUSIONS: This work provides new insights into the role of a multi-strain probiotic administration in modulating the behaviour, which is reflected as changes in the FC in healthy volunteers. This study motivates future investigations into the role of probiotics in context of major depression and stress disorders.

A step ahead: Exploring the gut microbiota in inpatients with bipolar disorder during a depressive episode.

OBJECTIVES: There is evidence that the gut microbiota plays a major role in the pathogenesis of diseases of the central nervous system through the gut-brain axis. The aim of the present study was to analyze gut microbiota composition in bipolar disorder (BD) and its relation to inflammation, serum lipids, oxidative stress, tryptophan (TRP)/kynurenine (KYN) levels, anthropometric measurements and parameters of metabolic syndrome. Further, microbial community differences of individuals with BD compared with healthy controls (HC) were explored. METHODS: In this cross-sectional study, we performed 16S rRNA gene sequencing of stool samples from 32 BD individuals and 10 HC. Laboratory parameters included inflammatory markers, serum lipids, KYN, oxidative stress and anthropometric measures. Microbial community analysis and correlation to clinical parameters was performed with QIIME, differential abundance analysis of taxa encompassed linear discriminant analysis effect size (LEfSe). RESULTS: We found a negative correlation between microbial alpha-diversity and illness duration in BD (R = -0.408, P = 0.021). Furthermore, we identified bacterial clades associated with inflammatory status, serum lipids, TRP, depressive symptoms, oxidative stress, anthropometrics and metabolic syndrome in individuals with BD. LEfSe identified the phylum Actinobacteria (LDA= 4.82, P = 0.007) and the class Coriobacteria (LDA= 4.75, P = 0.010) as significantly more abundant in BD when compared with HC, and Ruminococcaceae (LDA= 4.59, P = 0.018) and Faecalibacterium (LDA= 4.09, P = 0.039) as more abundant in HC when compared with BD. CONCLUSIONS: The present findings suggest that causes and/or consequences of BD may also lie outside the brain. Exploratory research of the gut microbiota in affective disorders like BD may identify previously unknown underlying causes, and offer new research and therapeutic approaches to mood disorders.