Daily Online Adaptive Radiation Therapy of Postoperative Endometrial and Cervical Cancer With PTV Margin Reduction to 5 mm: Dosimetric Outcomes, Acute Toxicity, and First Clinical Experience.

Purpose: This study evaluated the first clinical implementation of daily iterative cone beam computed tomography (iCBCT)-guided online adaptive radiation therapy (oART) in the postoperative treatment of endometrial and cervical cancer. Methods and Materials: Seventeen consecutive patients treated with daily iCBCT-guided oART were enrolled in this prospective study, with a reduced uniform 3-dimensional PTV margin of 5 mm. Treatment plans were designed to deliver 45 or 50.4 Gy in 1.8 Gy daily fractions to PTV. Pre- and posttreatment ultrasound and iCBCT scans were performed to record intrafractional bladder and rectal volume changes. The accuracy of contouring, oART procedure time, dosimetric outcomes, and acute toxicity were evaluated. Results: The average time from first iCBCT acquisition to completion of treatment was 22 minutes and 26 seconds. During this period, bladder volume increased by 44 cm3 using iCBCT contouring, whereas rectal volume remained stable (62.9 cm3 pretreatment vs 61.9 cm3 posttreatment). A total of 91.6% of influencers and 88.1% of CTVs required no or minor edits. The adapted plan was selected in all (434) fractions and significantly improved the dosimetry coverage for CTV and PTV, especially the vaginal PTV coverage by nearly 7% (P < .05). The adapted bladder Dmean was 104.61 cGy, and the rectum Dmean was 123.67 cGy, significantly lower than the scheduled plan of 108.24 and 128.19 cGy, respectively. The bone marrow and femur head left and right dosimetry were also improved with adaptation. Grade 2 acute gastrointestinal and genitourinary toxicities were 24% and 0, respectively. There was a grade 3 acute toxicity of decreased white blood cell count in 1 patient. Conclusions: Daily oART was associated with favorable dosimetry improvement and low acute toxicity, supporting its safety and efficacy for postoperative treatment of endometrial and cervical cancer. These results need to be validated in a larger prospective randomized controlled cohort.

Proteomics identifies hypothermia induced adiponectin protects corneal endothelial cells via AMPK mediated autophagy in phacoemulsification.

AIM: To explore the molecular mechanism underlying the protective effect of hypothermic perfusion on the corneal endothelium during phacoemulsification. METHODS: Phacoemulsification was performed on New Zealand white rabbits. Perfusate at different temperatures was used during the operation, and the aqueous humor was collected for proteomic sequencing after the operation. Corneal endothelial cell injury was simulated by a corneal endothelial cell oxygen-glucose deprivation/reoxygenation (OGD/R) model in vitro. Flow cytometry and evaluation of fluorescent LC3B puncta were used to detect apoptosis and autophagy, and western blotting was used to detect protein expression. RESULTS: A total of 381 differentially expressed proteins were identified between the two groups. In vitro, 4 ℃ hypothermia significantly reduced apoptosis and promoted autophagy. Apoptosis increased after autophagy was inhibited by 3-Methyladenine (3-MA). Furthermore, adiponectin (ADIPOQ) knockdown inhibited phospho-AMPK and blocked the protective effect of hypothermia on corneal endothelial cells. CONCLUSIONS: We investigated the differential expression of proteins between the hypothermia group and normothermia group by proteomics. Moreover, hypothermia-induced ADIPOQ can reduce apoptosis by promoting AMPK-mediated autophagy.

Probucol mitigates high-fat diet-induced cognitive and social impairments by regulating brain redox and insulin resistance.

Probucol has been utilized as a cholesterol-lowering drug with antioxidative properties. However, the impact and fundamental mechanisms of probucol in obesity-related cognitive decline are unclear. In this study, male C57BL/6J mice were allocated to a normal chow diet (NCD) group or a high-fat diet (HFD) group, followed by administration of probucol to half of the mice on the HFD regimen. Subsequently, the mice were subjected to a series of behavioral assessments, alongside the measurement of metabolic and redox parameters. Notably, probucol treatment effectively alleviates cognitive and social impairments induced by HFD in mice, while exhibiting no discernible influence on mood-related behaviors. Notably, the beneficial effects of probucol arise independently of rectifying obesity or restoring systemic glucose and lipid homeostasis, as evidenced by the lack of changes in body weight, serum cholesterol levels, blood glucose, hyperinsulinemia, systemic insulin resistance, and oxidative stress. Instead, probucol could regulate the levels of nitric oxide and superoxide-generating proteins, and it could specifically alleviate HFD-induced hippocampal insulin resistance. These findings shed light on the potential role of probucol in modulating obesity-related cognitive decline and urge reevaluation of the underlying mechanisms by which probucol exerts its beneficial effects.

Myopia prevalence and ocular biometry in children and adolescents at different altitudes: a cross-sectional study in Chongqing and Tibet, China.

OBJECTIVE: To investigate the differences in myopia prevalence and ocular biometry in children and adolescents in Chongqing and Tibet, China. DESIGN: Cross-sectional study. SETTING: The study included children and adolescents aged 6-18 years in Chongqing, a low-altitude region, and in Qamdo, a high-altitude region of Tibet. PARTICIPANTS: A total of 448 participants in Qamdo, Tibet, and 748 participants in Chongqing were enrolled in this study. METHODS: All participants underwent uncorrected visual acuity assessment, non-cycloplegic refraction, axial length (AL) measurement, intraocular pressure (IOP) measurement and corneal tomography. And the participants were grouped according to age (6-8, 9-11, 12-14 and 15-18 years group), and altitude of location (primary school students: group A (average altitude: 325 m), group B (average altitude: 2300 m), group C (average altitude: 3250 and 3170 m) and group D (average altitude: 3870 m)). RESULTS: There was no statistical difference in mean age (12.09±3.15 vs 12.2±3.10, p=0.549) and sex distribution (males, 50.4% vs 47.6%, p=0.339) between the two groups. The Tibet group presented greater spherical equivalent (SE, -0.63 (-2.00, 0.13) vs -0.88 (-2.88, -0.13), p<0.001), shorter AL (23.45±1.02 vs 23.92±1.19, p<0.001), lower prevalence of myopia (39.7% vs 47.6%, p=0.008) and flatter mean curvature power of the cornea (Km, 43.06±1.4 vs 43.26±1.36, p=0.014) than the Chongqing group. Further analysis based on age subgroups revealed that the Tibet group had a lower prevalence of myopia and higher SE in the 12-14, and 15-18 years old groups, shorter AL in the 9-11, 12-14 and 15-18 years old groups, and lower AL to corneal radius of curvature ratio (AL/CR) in all age subgroups compared with the Chongqing group, while Km was similar between the two groups in each age subgroup. Simple linear regression analysis showed that SE decreased with age in both the Tibet and Chongqing groups, with the Tibet group exhibiting a slower rate of decrease (p<0.001). AL and AL/CR increased with age in both the Tibet and Chongqing groups, but the rate of increase was slower in the Tibet group (p<0.001 of both). Multiple linear regression analysis revealed that AL had the greatest effect on SE in both groups, followed by Km. In addition, the children and adolescents in Tibet presented thinner corneal thickness (CCT, p<0.001), smaller white to white distance (WTW, p<0.001), lower IOP (p<0.001) and deeper anterior chamber depth (ACD, p=0.015) than in Chongqing. Comparison of altitude subgroups showed that the prevalence of myopia (p=0.002), SE (p=0.031), AL (p=0.001) and AL/CR (p<0.001) of children at different altitudes was statistically different but the Km (p=0.189) were similar. The highest altitude, Tengchen County, exhibited the lowest prevalence of myopia and greatest SE among children, and the mean AL also decreased with increasing altitude. CONCLUSIONS: Myopia prevalence in Tibet was comparable with that in Chongqing for students aged 6-8 and 9-11 years but was lower and myopia progressed more slowly for students aged 12-14 and 15-18 years than in Chongqing, and AL was the main contributor for this difference, which may be related to higher ultraviolet radiation exposure and lower IOP in children and adolescents at high altitude in Tibet. Differences in AL and AL/CR between Tibet and Chongqing children and adolescents manifested earlier than in SE, underscoring the importance of AL measurement in myopia screening.

Casual associations between blood metabolites and colon cancer.

BACKGROUND: Limited knowledge exists regarding the casual associations linking blood metabolites and the risk of developing colorectal cancer. AIM: To investigate causal associations between blood metabolites and colon cancer. METHODS: The study utilized a two-sample Mendelian randomization (MR) analysis to investigate the causal impact of 486 blood metabolites on colorectal cancer. The primary method of analysis used was the inverse variance weighted model. To further validate the results several sensitivity analyses were performed, including Cochran's Q test, MR-Egger intercept test, and MR robust adjusted profile score. These additional analyses were conducted to ensure the reliability and robustness of the findings. RESULTS: After rigorous selection for genetic variation, 486 blood metabolites were included in the MR analysis. We found Mannose [odds ratio (OR) = 2.09 (1.10-3.97), P = 0.024], N-acetylglycine [OR = 3.14 (1.78-5.53), P = 7.54 × 10-8], X-11593-O-methylascorbate [OR = 1.68 (1.04-2.72), P = 0.034], 1-arachidonoylglycerophosphocholine [OR = 4.23 (2.51-7.12), P = 6.35 × 10-8] and 1-arachidonoylglycerophosphoethanolamine 4 [OR = 3.99 (1.17-13.54), P = 0.027] were positively causally associated with colorectal cancer, and we also found a negative causal relationship between Tyrosine [OR = 0.08 (0.01-0.63), P = 0.014], Urate [OR = 0.25 (0.10-0.62), P = 0.003], N-acetylglycine [0.73 (0.54-0.98), P = 0.033], X-12092 [OR = 0.89 (0.81-0.99), P = 0.028], Succinylcarnitine [OR = 0.48 (0.27-0.84), P = 0.09] with colorectal cancer. A series of sensitivity analyses were performed to confirm the rigidity of the results. CONCLUSION: This study showed a causal relationship between 10 blood metabolites and colorectal cancer, of which 5 blood metabolites were found to be causal for the development of colorectal cancer and were confirmed as risk factors. The other five blood metabolites are protective factors.

Tissue-Specific Distribution and Maternal Transfer of Persistent Organic Halogenated Pollutants in Frogs.

Persistent organic pollutants pose a great threat to amphibian populations, but information on the bioaccumulation of contaminants in amphibians remains scarce. To examine the tissue distribution and maternal transfer of organic halogenated pollutants (OHPs) in frogs, seven types of tissues from black-spotted frog (muscle, liver, kidney, stomach, intestine, heart, and egg) were collected from an e-waste-polluted area in South China. Among the seven frog tissues, median total OHP concentrations of 2.3 to 9.7 µg/g lipid weight were found (in 31 polychlorinated biphenyl [PCB] individuals and 15 polybrominated diphenyl ether [PBDE], dechlorane plus [syn-DP and anti-DP], bexabromobenzene [HBB], polybrominated biphenyl] PBB153 and -209], and decabromodiphenyl ethane [DBDPE] individuals). Sex-specific differences in contaminant concentration and compound compositions were observed among the frog tissues, and eggs had a significantly higher contaminant burden on the whole body of female frogs. In addition, a significant sex difference in the concentration ratios of other tissues to the liver was observed in most tissues except for muscle. These results suggest that egg production may involve the mobilization of other maternal tissues besides muscle, which resulted in the sex-specific distribution. Different parental tissues had similar maternal transfer mechanisms; factors other than lipophilicity (e.g., molecular size and proteinophilic characteristics) could influence the maternal transfer of OHPs in frogs. Environ Toxicol Chem 2024;00:1-12. © 2024 SETAC.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Dapagliflozin attenuates LPS-induced myocardial injury by reducing ferroptosis.

Septic cardiomyopathy is a severe cardiovascular disease with a poor prognosis. Previous studies have reported the involvement of ferroptosis in the pathogenesis of septic cardiomyopathy. SGLT2 inhibitors such as dapagliflozin have been demonstrated to improve ischemia-reperfusion injury by alleviating ferroptosis in cardiomyocyte. However, the role of dapagliflozin in sepsis remains unclear. Therefore, our study aims to investigate the therapeutic effects of dapagliflozin on LPS-induced septic cardiomyopathy. Our results indicate that dapagliflozin improved cardiac function in septic cardiomyopathy experimental mice. Mechanistically, dapagliflozin works by inhibiting the translation of key proteins involved in ferroptosis, such as GPX4, FTH1, and SLC7A11. It also reduces the transcription of lipid peroxidation-related mRNAs, including PTGS2 and ACSL4, as well as iron metabolism genes TFRC and HMOX1.

Visualization of the Infection and Colonization Process of Dendrobium officinale Using a Green Fluorescent Protein-Tagged Isolate of Fusarium oxysporum.

Dendrobium officinale soft rot is a widespread and destructive disease caused by Fusarium oxysporum that can seriously affect its yield and quality. To better understand the fungal infection and colonization, we successfully created an F. oxysporum labeled with green fluorescent protein (GFP) using Agrobacterium tumefaciens-mediated transformation (ATMT) method. Transformants had varying fluorescence intensities, but their pathogenicity did not differ from that of the wild type (WT). Fluorescence microscopy revealed that F. oxysporum primarily entered the aboveground portion of D. officinale through the leaf margin, stomata, or by direct penetration of leaf surface. It then colonized the mesophyll and spreads along its vascular bundles. After 14 d of culture, D. officinale exhibited typical symptoms of decay and wilting, accompanied by a pronounced fluorescence signal in the affected area. The initial colonization of F. oxysporum in the subterranean region primarily involved attachment to the root hair and epidermis, which progressed to the medullary vascular bundle. At 14 days post inoculation (dpi), the root vascular bundles of D. officinale exhibited significant colonization by F. oxysporum. Macroconidia were also observed in black rot D. officinale tissue. In particular, the entire root was surrounded by a significant number of chlamydospore-producing F. oxysporum mycelia at 28 dpi. This approach allowed the visualization of the complete infection process of F. oxysporum and provided a theoretical foundation for the development of field control strategies.

Investigation of subclinical ocular inflammation in the aqueous humor of patients with myopia following bilateral sequential collamer lens implantation.

BACKGROUND: The aqueous humor, a transparent fluid secreted by the ciliary body, supports the lens of the eyeball. In this study, we analyzed the cytokine and chemokine profiles within the aqueous humor of the contralateral eye post-implantation of an implantable collamer lens (ICL) to evaluate potential subclinical inflammation in the second eye subsequent to ICL implantation in the first eye. METHODS: Aqueous humor samples were procured from both eyes of 40 patients (totaling 80 eyes) prior to bilateral ICL insertion. Subsequently, a comprehensive statistical analysis was conducted using the Luminex assay to quantify 30 different cytokines in these samples. RESULTS: Compared to the first eye, the aqueous humor of the second eye demonstrated decreased concentrations of IFN-γ (P = 0.038), IL-13 (P = 0.027), IL-17/IL-17 A (P = 0.012), and IL-4 (P = 0.025). No significant differences were observed in other cytokine levels between the two groups. Patients were then categorized based on the postoperative rise in intraocular pressure (IOP) in the first eye. The group with elevated IOP displayed elevated levels of EGF in the aqueous humor of the first eye (P = 0.013) and higher levels of PDGF-AB/BB in the aqueous humor of the second eye (P = 0.032) compared to the group with normal IOP. Within the elevated IOP group, the levels of EGF (P = 0.013) and IL-17/IL-17 A (P = 0.016) in the aqueous humor were lower in the second eye than in the first eye. In the normal IOP group, cytokine levels did not differ notably between eyes. CONCLUSION: Following sequential ICL implantation, it appears that a protective response may be activated to mitigate subclinical inflammation in the second eye induced by the initial implantation in the first eye. Additionally, the increase in IOP subsequent to surgery in the first eye may correlate with the presence of inflammatory mediators in the aqueous humor.

EZH2 inhibition induces senescence via ERK1/2 signaling pathway in multiple myeloma.

Epigenetic modifications play an important role in cellular senescence, and enhancer of zeste homolog 2 (EZH2) is a key methyltransferase involved in epigenetic remodeling in multiple myeloma (MM) cells. We have previously demonstrated that GSK126, a specific EZH2 inhibitor, exhibits anti-MM therapeutic efficacy and safety in vivo and in vitro; however, its specific mechanism remains unclear. This study shows that GSK126 induces cellular senescence in MM, which is characterized by the accumulation of senescence-associated heterochromatin foci (SAHF) and p21, and increased senescence-associated ß galactosidase activity. Furthermore, EZH2 is inhibited in ribonucleotide reductase regulatory subunit M2 (RRM2) overexpression OCI-MY5 and RPMI-8226 cells. RRM2 overexpression inhibits the methyltransferase function of EZH2 and promotes its degradation through the ubiquitin-proteasome pathway, thereby inducing cellular senescence. In this senescence model, Lamin B1, a key component of the nuclear envelope and a marker of senescence, does not decrease but instead undergoes aberrant accumulation. Meanwhile, phosphorylation of extracellular signal-regulated protein kinase (ERK1/2) is significantly increased. The inhibition of ERK1/2 phosphorylation in turn partially restores Lamin B1 level and alleviates senescence. These findings suggest that EZH2 inhibition increases Lamin B1 level and induces senescence by promoting ERK1/2 phosphorylation. These data indicate that EZH2 plays an important role in MM cellular senescence and provide insights into the relationships among Lamin B1, p-ERK1/2, and cellular senescence.

A Lateral Flow-Recombinase Polymerase Amplification Method for Colletotrichum gloeosporioides Detection.

The greater yam (Dioscorea alata), a widely cultivated and nutritious food crop, suffers from widespread yield reduction due to anthracnose caused by Colletotrichum gloeosporioides. Latent infection often occurs before anthracnose phenotypes can be detected, making early prevention difficult and causing significant harm to agricultural production. Through comparative genomic analysis of 60 genomes of 38 species from the Colletotrichum genus, this study identified 17 orthologous gene groups (orthogroups) that were shared by all investigated C. gloeosporioides strains but absent from all other Colletotrichum species. Four of the 17 C. gloeosporioides-specific orthogroups were used as molecular markers for PCR primer designation and C. gloeosporioides detection. All of them can specifically detect C. gloeosporioides out of microbes within and beyond the Colletotrichum genus with different sensitivities. To establish a rapid, portable, and operable anthracnose diagnostic method suitable for field use, specific recombinase polymerase amplification (RPA) primer probe combinations were designed, and a lateral flow (LF)-RPA detection kit for C. gloeosporioides was developed, with the sensitivity reaching the picogram (pg) level. In conclusion, this study identified C. gloeosporioides-specific molecular markers and developed an efficient method for C. gloeosporioides detection, which can be applied to the prevention and control of yam anthracnose as well as anthracnose caused by C. gloeosporioides in other crops. The strategy adopted by this study also serves as a reference for the identification of molecular markers and diagnosis of other plant pathogens.

AZIN2 is associated with apoptosis of germ cells in undescended testis.

Undescended testis (UDT), known as cryptorchidism (CRY), is a common congenital disorder in which one or both testicles do not descend normally into the scrotum. A unilateral UDT model was established by inducing UDT in mice through surgery. The results showed that the testis in the UDT model group was abnormal; the lumen of the seminiferous tubule was atrophic; apoptosis, necrosis and shedding were observed in many of the germ cells; the level of sex hormones was abnormal; and mature sperm was reduced. Subsequently, transcriptome sequencing was conducted on the testicular tissue of UDT model mice. Through analysis and verification of differential genes, AZIN2 was identified as playing a key role in the decline in male fertility caused by cryptorchidism. AZIN2 expression and spermine content was down-regulated in the testis of the UDT group. We then used a combination of hypoxanthine and xanthine to create a GC-1 cell damage model. In this model, AZIN2 expression and spermine content was down-regulated. When si-Azin2 transfected GC-1 cells, cell viability and proliferation were decreased. However, in the GC-1 cell damage model transfected with Azin2 over-expressed plasmid, AZIN2 expression and spermine content was up-regulated, reversing the cell damage caused by hypoxanthine and xanthine, and restoring the proliferation ability of GC-1 cells. These results indicate that in UDT, down-regulated AZIN2 expression is a factor in testicular damage. This discussion of the connection between AZIN2 and germ cells has important clinical significance as it provides an important reference for the diagnosis and treatment of cryptorchidism.

Overexpression of transcription factor TBX5 inhibits the activation of YAP1-TEAD1 pathway to promote ferroptosis in lung cancer cells.

BACKGROUND: Non-small cell lung cancer (NSCLC) accounts for more than 80 % of lung cancer (LC) cases, making it the primary cause of cancer-related mortality worldwide. T-box transcription factor 5 (TBX5) is an important regulator of embryonic and organ development and plays a key role in cancer development. Here, our objective was to investigate the involvement of TBX5 in ferroptosis within LC cells and the underlying mechanisms. METHODS: First, TBX5 expression was examined in human LC cells. Next, overexpression of TBX5 and Yes1-associated transcriptional regulator (YAP1) and knockdown of TEA domain 1 (TEAD1) were performed in A549 and NCI-H1703 cells. The proliferation ability of A549 and NCI-H1703 cells, GSH, MDA, ROS, and Fe2+ levels were measured. Co-immunoprecipitation (Co-IP) was performed to verify whether TBX5 protein could bind YAP1. Then TBX5, YAP1, TEAD1, GPX4, p53, FTH1, SLC7A11 and PTGS2 protein levels were assessed. Finally, we verified the effect of TBX5 on ferroptosis in LC cells in vivo. RESULTS: TBX5 expression was down-regulated in LC cells, especially in A549 and NCI-H1703 cells. Overexpression of TBX5 significantly decreased proliferation ability of A549 and NCI-H1703 cells, downregulated GPX4 and GSH levels, and upregulated MDA, ROS, and Fe2+ levels. Co-IP verified that TBX5 protein could bind YAP1. Moreover, oe-YAP1 promoted proliferation ability of A549 and NCI-H1703 cells transfected with Lv-TBX5, upregulated GPX4 and GSH levels and downregulated MDA, ROS, and Fe2+ levels. Additionally, oe-YAP1 promoted FTH1 and SLC7A11 levels and inhibited p53 and PTGS2 levels in A549 and NCI-H1703 cells transfected with Lv-TBX5. However, transfection with si-TEAD1 further reversed these effects. In vivo experiments further validated that TBX5 promoted ferroptosis in LC cells. CONCLUSIONS: TBX5 inhibited the activation of YAP1-TEAD1 pathway to promote ferroptosis in LC cells.

Recent development and future application of biodegradable ureteral stents.

Ureteral stenting is a common clinical procedure for the treatment of upper urinary tract disorders, including conditions such as urinary tract infections, tumors, stones, and inflammation. Maintaining normal renal function by preventing and treating ureteral obstruction is the primary goal of this procedure. However, the use of ureteral stents is associated with adverse effects, including surface crusting, bacterial adhesion, and lower urinary tract symptoms (LUTS) after implantation. Recognizing the need to reduce the complications associated with permanent ureteral stent placement, there is a growing interest among both physicians and patients in the use of biodegradable ureteral stents (BUS). The evolution of stent materials and the exploration of different stent coatings have given these devices different roles tailored to different clinical needs, including anticolithic, antibacterial, antitumor, antinociceptive, and others. This review examines recent advances in BUS within the last 5 years, providing an in-depth analysis of their characteristics and performance. In addition, we present prospective insights into the future applications of BUS in clinical settings.

Integrated micro/nano drug delivery system based on magnetically responsive phase-change droplets for ultrasound theranostics.

Phase-change droplets (PCDs) are intelligent responsive micro and nanomaterials developed based on micro/nano bubbles. Subject to external energy inputs such as temperature and ultrasound, the core substance, perfluorocarbon (PFC), undergoes a phase transition from liquid to gas. This transformation precipitates alterations in the PCDs' structure, size, ultrasound imaging capabilities, drug delivery efficiency, and other pertinent characteristics. This gives them the ability to exhibit "intelligent responses". This study utilized lipids as the membrane shell material and perfluorohexane (PFH) as the core to prepare lipid phase-change droplets. Superparamagnetic nanoparticles (PEG-functionalized Fe3O4 nanoparticles) and the anti-tumor drug curcumin (Cur) were loaded into the membrane shell, forming magnetic drug-loaded phase-change droplets (Fe-Cur-NDs). These nanoscale phase-change droplets exhibited excellent magnetic resonance/ultrasound imaging capabilities and thermal/ultrasound-mediated drug release. The Fe-Cur-NDs showed excellent anti-tumor efficacy for the MCF-7 cells under low-intensity focused ultrasound (LIFU) guidance in vitro. Therefore, Fe-Cur-NDs represent a promising smart responsive theranostic integrated micro/nano drug delivery system.

Comparison of outcomes between early-stage cervical cancer patients without high-risk factors undergoing adjuvant concurrent chemoradiotherapy and radiotherapy alone after radical surgery.

PURPOSE: For patients with early-stage cervical cancer without high-risk factors, there is no consensus regarding the optimal postoperative treatment regimen and whether postoperative concurrent radiochemotherapy (CCRT) is superior to radiotherapy (RT) alone. PATIENTS AND METHODS: The medical records of patients with stage I-IIA cervical cancer, who underwent radical surgery and postoperative RT or CCRT between June 2012 and December 2017, were retrospectively reviewed. Patients with any high-risk factors, including positive pelvic lymph node(s), positive resection margin(s), and parametrial invasion, were excluded. Patients with large tumors (≥ 4 cm), deep stromal invasion (≥ 1/2), and lymphovascular space involvement were categorized as the intermediate-risk group. Patients without intermediate-risk factors were categorized as the low-risk group. RESULTS: A total of 403 patients were enrolled and divided into 2 groups according to postoperative treatment: RT alone (n = 105); and CCRT (n = 298). For risk stratification, patients were also divided into 2 groups: intermediate-risk (n = 350); and low-risk (n = 53). The median follow-up was 51.7 months. Patients in the intermediate-risk group and those with multiple intermediate-risk factors were more likely to undergo CCRT. For patients who underwent RT alone or CCRT in the intermediate-risk group, 5-year overall survival (OS) rates were 93.4% and 93.8% (p = 0.741), and 5-year disease-free survival (DFS) rates were 90.6% and 91.4%, respectively (p = 0.733). Similarly, for patients who underwent RT alone or CCRT in the low-risk group, the 5-year OS rates were 100.0% and 93.5% (p = 0.241), and 5-year DFS rates were 94.4% and 93.5%, respectively (p = 0.736). Adjuvant CCRT or RT were not independent risk factors for either OS or DFS. Patients who underwent CCRT appeared to develop a higher proportion of grade ≥ 3 acute hematological toxicities than those in the RT group (44.0% versus 11.4%, respectively; p < 0.001). There was no significant difference in grade ≥ 3 chronic toxicities of the urogenital and gastrointestinal systems between the CCRT and RT groups. CONCLUSION: There was no significant difference in 5-year OS and DFS rates between patients with early-stage cervical cancer without high-risk factors undergoing postoperative CCRT versus RT alone. Patients who underwent CCRT appeared to develop a higher proportion of grade ≥ 3 acute hematological toxicities than those who underwent RT alone.

Genipin ameliorates diabetic retinopathy via the HIF-1α and AGEs-RAGE pathways.

BACKGROUND: Traditional Chinese medicine (TCM) is useful in disease treatment and prevention. Genipin is an active TCM compound used to treat diabetic retinopathy (DR). In this study, a network pharmacology (NP)-based approach was employed to investigate the therapeutic mechanisms underlying genipin administration in DR. METHODS: The potential targets of DR were identified using the gene expression omnibus (GEO) database. TCM database screening and NP were used to predict the potential active targets and pathways of genipin in DR. Cell viability was tested in vitro to determine the effects of different doses of glucose and genipin on Human Retinal Microvascular Endothelial Cells (hRMECs). CCK-8, CCK-F, colony formation, CellTiter-Lum, Annexin V-FITC, wound healing, Transwell, tube-forming, reactive oxygen species (ROS), and other assay kits were used to detect the effects of genipin on hRMECs during high levels of glucose. In vivo, a streptozotocin (STZ)-mouse intraocular genipin injection (IOI.) model was used to explore the effects of genipin on diabetes-induced retinal dysfunction. Western blotting was performed to identify the cytokines involved in proliferation, apoptosis, angiogenesis, ROS, and inflammation. The protein expression of the AKT/ PI3K/ HIF-1α and AGEs/ RAGE pathways was also examined. RESULTS: Approximately 14 types of TCM, and nearly 300 active ingredients, including genipin, were identified. The NP approach successfully identified the HIF-1α and AGEs-RAGE pathways, with the EGR1 and UCP2 genes, as key targets of genipin in DR. In the in vitro and in vivo models, we discovered that high glucose increased cell proliferation, apoptosis, angiogenesis, ROS, and inflammation. However, genipin application regulated cell proliferation and apoptosis, inhibited angiogenesis, and reduced ROS and inflammation in the HRMECs exposed to high glucose. Furthermore, the retinal thickness in the genipin-treated group was lower than that in the untreated group. AKT/ PI3K/ HIF-1α and AGEs/ RAGE signaling was increased by high glucose levels; however, genipin treatment decreased AKT/ PI3K and AGEs/ RAGE pathway expressions. Genipin also increased HIF-1α phosphorylation, oxidative phosphorylation of ATP synthesis, lipid peroxidation, and the upregulation of oxidoreductase. Genipin was found to protect HG-induced hRMECs and the retina of STZ-mice, based on; 1 the inhibition of UCP2 and Glut1 decreased intracellular glucose, and glycosylation; 2 the increased presence of HIF-1α, which increased oxidative phosphorylation and decreased substrate phosphorylation; 3 the increase in oxidative phosphorylation from ATP synthesis increased lipid peroxidation and oxidoreductase activity, and; 4 the parallel effect of phosphorylation and glycosylation on vascular endothelial growth factor (VEGF), MMP9, and Scg3. CONCLUSION: Based on NP, we demonstrated the potential targets and pathways of genipin in the treatment of DR and confirmed its effective molecular mechanism in vitro and in vivo. Genipin protects cells and tissues from high glucose levels by regulating phosphorylation and glycosylation. The activation of the HIF-1α pathway can also be used to treat DR. Our study provides new insights into the key genes and pathways associated with the prognosis and pathogenesis of DR.

Cardiac autonomic dysfunction and structural remodeling: the potential mechanism to mediate the relationship between obstructive sleep apnea and cardiac arrhythmias.

Background: Cardiac arrhythmias are very common in patients with obstructive sleep apnea (OSA), especially atrial fibrillation (AF) and nonsustained ventricular tachycardia (NVST). Cardiac autonomic dysfunction and structural remodeling caused by OSA provide the milieu for cardiac arrhythmia development. This study aimed to determine whether OSA is associated with various cardiac arrhythmias and investigate potential pathophysiologic pathways between them. Methods: The analysis covered 600 patients with clinical suspicion of OSA hospitalized in Renmin Hospital of Wuhan University between January 2020 and May 2023. After undergoing sleep apnea monitor, all subjects received laboratory tests, Holter electrocardiography, and Echocardiography. Results: Compared with those without OSA and adjusting for potential confounders, subjects with moderate OSA had three times the odds of AF (odds ratio [OR] 3.055; 95% confidence interval [CI], 1.002-9.316; p = 0.048). Subjects with severe OSA had three times the odds of AF (OR 3.881; 95% CI, 1.306-11.534; p = 0.015) and NSVT (OR 3.690; 95% CI, 0.809-16.036; p = 0.046). There were significant linear trends for the association between OSA severity with AF and NVST (p < 0.05). And this association was mediated by cardiac structural changes including left atrial diameter, left ventricular diastolic diameter, right atrial diameter and right ventricular diameter. In addition, the ratio of low-frequency and high-frequency individually mediated the association between severe OSA and NVST. Conclusion: This study demonstrated that severe OSA was independently associated with AF and NSVT, and this association was mediated by autonomic nervous system changes and cardiac structural remodeling.