RESUMEN
As an essential chemical intermediate, catechol (CC) residues may have adverse effects on human health. Herein, an effective and facile photoelectrochemical sensor platform based on MgIn2S4/CdWO4 composite is constructed for monitoring CC. MgIn2S4 increases light absorption range and activity, while CdWO4 enhances photoelectronic stability, and the type-II heterojunction formed can significantly enhance photocurrent response. Due to the autoxidation process, CC is converted into oligomeric products, which increase the spatial site resistance and attenuate the overall photocurrent response. It is worth noting that the cauliflower-like structure of MgIn2S4 can provide a large specific surface area, and the presence of Mg2+ promotes autoxidation, thus providing a suitable condition for detecting CC. Under optimal conditions, the MgIn2S4/CdWO4/GCE photoelectrochemical sensor has a prominent linear relationship in the range of CC concentration from 2 nM to 7 µM, with a limit of detection of 0.27 nM. With satisfactory selectivity, excellent stability, and remarkable reproducibility, this sensor provides a crucial reference value for effectively and rapidly detecting pollutants in environmental water samples.
RESUMEN
BACKGROUND: Failure to rescue (FTR) is a quality metric defined as mortality after potentially preventable complications after surgery. Predicting patients who are at the highest risk of mortality after a complication may aid in preventing deaths. Thirty-day follow-up period inadequately captures postoperative deaths; alternatively, a 90-day follow-up period has been advocated. This study aimed to examine the association of a validated frailty metric, the risk analysis index (RAI), with 90-day FTR (FTR-90). METHODS: Patients aged ≥65 years who underwent a major abdominal operation between 2014 and 2020 at a quaternary care center were abstracted. Institutional data were merged with the American College of Surgeons National Surgical Quality Improvement Program (ACS NSQIP) and Geriatric Surgery Research File variables. The association between RAI and FTR-90 was evaluated using multivariable logistic regression. RESULTS: A total of 398 patients with postoperative complications were included. Fifty-two patients (13.1%) died during the 90-day follow-up. The FTR-90 group was older (median age: 76 vs 73 years, respectively; P = .002), had a greater preoperative American Society of Anesthesiologists classification score (P < .001), and had a higher ACS NSQIP estimated risk of morbidity (0.33% vs 0.20%, P < .001) and mortality (0.067% vs 0.012%, P < .001). The FTR-90 group had a greater median RAI score (23 vs 19; P = .002). The RAI score was independently associated with FTR-90 (odds ratio, 1.04; 95% CI, 1.0042-1.0770; P = .028) but not with FTR-30 (P = .13). CONCLUSION: Preoperative frailty, as defined by RAI, is independently associated with FTR at 90-day follow-up. FTR-90 captured nearly 60% more deaths than did FTR-30. Frailty has major implications beyond the typical 30-day follow-up period, and a longer follow-up period must be considered.
Asunto(s)
Fragilidad , Humanos , Anciano , Fragilidad/complicaciones , Abdomen/cirugía , Complicaciones Posoperatorias/epidemiología , Complicaciones Posoperatorias/etiología , Oportunidad Relativa , Mejoramiento de la CalidadRESUMEN
Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.
RESUMEN
In this study, 2219 aluminum alloy thick plate was joined by electron beam welding. Defect-free joints with excellent surface formation were obtained. There were significant differences in the microstructure along the thickness direction of the weld zone (WZ). The upper region of the WZ was mainly striated grains, while the lower region was fine equiaxed grains. The WZ of 2219 joint is composed of α-Al and Al-Cu eutectic. Fine equiaxed grains were formed in the partially melted zone (PMZ) due to the existence of high-melting nucleation particles including Ti-Al and Ti-Zr compounds. The eutectic microstructure in the PMZ and the heat-affected zone (HAZ) presented net-like and block-shape distribution. Due to the formation of fine grains and high content of Al-Cu eutectic, the WZ showed the highest microhardness (80 HV). Therefore, the 2219 joint obtained excellent mechanical properties. The tensile strength of the 2219 joint was equal to that of the base metal (BM), but the elongation of the 2219 joint significantly decreased to 15.1%, about 67.7% of that of BM. The fracture mode of the 2219 joint presented typical ductile fracture.
RESUMEN
In this work, novel adsorbent polyaniline-modified halloysite nanotubes (HNT@PA-2) were synthesized successfully by in situ polymerization to increase active adsorption sites. With the increase of the amount of aniline, the adsorption capacity of naproxen becomes higher. The optimal ratio of halloysite nanotubes to aniline was 1 : 2. The effects of adsorption conditions such as pH, mass of HNT@PA-2, time and initial concentration of naproxen were systematically researched. The optimum adsorption for naproxen was pH 9, mass 10 mg and contact time 4 h. The adsorption of naproxen conformed to the pseudo-first-order kinetic model, and the maximum adsorption capacity was 242.58 mg g-1 at 318 K. In addition, the effects of ionic strength and different heavy metals also were studied. Higher ionic strength of the system could influence the adsorption of naproxen. The effects of Al3+, Pb2+, Zn2+ and Co2+ ions on the adsorption of naproxen could be ignored, while Cu2+ and Fe3+ ions inhibited the process. The mechanisms for naproxen adsorbed by the HNT@PA-2 were π-π interaction, hydrogen bonding and hydrophobic reaction. Therefore, the HNT@PA-2 could be used for the treatment of medical wastewater for removing naproxen.
RESUMEN
Many efforts for decades have been made to explore electron wind force, produced by electric current itself under electropulsing treatment. However, the clear evidence of this force is hard to separate from Joule heating. Here we study a helical dislocation within quenched Al-Cu-Li alloy when subjected to a pulsed current. Such a helical configuration is quite suited for uncoupling this force from Joule heating effect because, contrary to general dislocations, it can take a unique reconfiguration under a driving force parallel to its Burgers vector. We find that within the pulsed samples, an initial helix happens to reconfigure, evolving into a line morphology. Therefore, it is this electron wind force Few, which parallel to the Burgers vector, would result in such novel helix reconfiguration when compared to the absence of this force. This is the first study to verify electron wind force by a helical dislocation reconfiguration.
RESUMEN
Soybean cyst nematode (Heterodera glycines Ichinohe), a devastating pathogen in soybean, was chosen as a model system to investigate nematode behavior and gene expression changes in response to acidic and basic pH and salt signals (pH 4.5, 5.25, 8.6, and 10 and NaCl) through full-length transcriptome sequencing of 18 samples. An average of 4.36 Gbp of clean reads per sample were generated, and 3972 novel genes and 29,529 novel transcripts were identified. Sequence structural variation during or after transcription may be associated with the nematode's behavioral response. The functional analysis of 1817/4962 differentially expressed genes/transcripts showed that signal transduction pathways, including transmembrane receptors, ion channels, and Ca2+ transporters, were activated, but pathways involved in nematode development (e.g., ribosome) and energy production (e.g., oxidative phosphorylation) were inhibited. A corresponding model was established. Our findings suggest that these receptors and ion channels might be potential targets for nematicides or drug discovery.
Asunto(s)
Glycine max , Nematodos , Animales , Glycine max/genética , Perfilación de la Expresión Génica , Canales Iónicos/genética , Concentración de Iones de HidrógenoRESUMEN
In end-stage kidney disease (ESKD), patient engagement and empowerment are associated with improved survival and complications. However, patients lack education and confidence to participate in self-care. The development of in center self-care hemodialysis can enable motivated patients to allocate autonomy, increase satisfaction and engagement, reduce human resource intensiveness, and cultivate a curiosity about home dialysis. In this review, we emphasize the role of education to overcome barriers to home dialysis, strategies of improving home dialysis utilization in the COVID 19 era, the significance of in-center self-care dialysis (e.g., cost containment and empowering patients), and implementation of an in-center self-care dialysis as a bridge to home hemodialysis (HHD).
Asunto(s)
COVID-19 , Fallo Renal Crónico , Humanos , Diálisis Renal , Autocuidado , Nefrólogos , Fallo Renal Crónico/terapia , Hemodiálisis en el DomicilioRESUMEN
This paper is concerned with an analysis of the electrical conductivity of graphene/cement composites by means of DC (direct current) and AC (alternating current) techniques. Moreover, the micrograph and element composition of composites have been characterized through SEM (scanning electron microscopy) and EDS (energy-dispersive spectrometers) techniques, respectively. Results revealed that a percolation transition region Φ2-Φ1 (Φ2 and Φ1 values are determined as 0.8% and 1.8%, respectively) can be observed in the S-shaped curve. In addition, the logistic model has been recommended to characterize the relationship between the conductivity and the graphene concentration, which ranged from 0.001% to 2.5%. The micrographs obtained by SEM technique clearly indicate a complete conductive network as well as agglomeration of graphene slices when the graphene content reaches the threshold value. Furthermore, graphene slices can be distinguished from the cement hydration products by means of the analysis of element composition obtained through the EDS technique. It is promising to apply the graphene/cement composites as intelligent materials.
RESUMEN
The experimental and theoretical studies on the adsorption of Cu(II) on the surface of Na-montmorillonite (Na-Mt) were reported. Effects of batch adsorption experimental parameters were studied. Density functional theory and molecular dynamics simulations were used to study the adsorption of Cu(II) on montmorillonite (001) surface. The adsorption reached equilibrium within 80 min and the adsorption capacity was 35.23 mg·g-1 at 25 °C. The adsorption data of Cu(II) were consistent with pseudo-second-order kinetics and Langmuir isotherm models. The adsorption process was dominated by physical adsorption (Ea was 37.08 kJ·mol-1) with spontaneous endothermic behavior. The influence of coexisting cations on the adsorption capacity of Cu(II) was Mg(II) > Co(II) > Ca(II) > Na(I). The simulation results demonstrated that there were no significant differences in the adsorption energy of Cu(II) at the four adsorption sites on the montmorillonite (001) surface. Cu(II) had more electron transfer than Na(I). The diffusion coefficient of Cu(II) in the aqueous solution system containing montmorillonite was 0.85×10-10 m2·s-1. Considerable amounts of Cu(II) ions were adsorbed at a distance of 0.26 and 2.25 Å from the montmorillonite (001) surface. The simulation results provided strong supporting evidence for experimental conclusions.
Asunto(s)
Bentonita , Iones , Adsorción , Simulación por Computador , CinéticaRESUMEN
Microorganisms play crucial roles in the global iodine cycling through iodine oxidation, reduction, volatilization, and deiodination. In contrast to iodate formation in radionuclide-contaminated groundwater by the iodine-oxidizing bacteria, microbial contribution to the formation of high level of iodide in geogenic high iodine groundwater is poorly understood. In this study, our results of comparative metagenomic analyses of deep groundwater with typical high iodide concentrations in the North China Plain revealed the existence of putative dissimilatory iodate-reducing idrABP1P2 gene clusters in groundwater. Heterologous expression and characterization of an identified idrABP1P2 gene cluster confirmed its functional role in iodate reduction. Thus, microbial dissimilatory iodate reduction could contribute to iodide formation in geogenic high iodine groundwater. In addition, the identified iron-reducing, sulfur-reducing, sulfur-oxidizing, and dehalogenating bacteria in the groundwater could contribute to the release and production of iodide through the reductive dissolution of iron minerals, abiotic iodate reduction of derived ferrous iron and sulfide, and dehalogenation of organic iodine, respectively. These microbially mediated iodate reduction and organic iodine dehalogenation processes may also result in the transformation among iodine species and iodide enrichment in other geogenic iodine-rich groundwater systems worldwide.
Asunto(s)
Agua Subterránea , Yodo , Contaminantes Químicos del Agua , Yoduros/análisis , Yodatos/análisis , Yodo/análisis , Hierro , Bacterias/genética , Bacterias/metabolismo , Oxidación-Reducción , China , Azufre/análisis , Contaminantes Químicos del Agua/análisisRESUMEN
The restoration of submerged macrophytes is an important step in lake ecosystem restoration, during which artificially assisted measures have been widely used for macrophyte recolonization. Compared with natural restoration, the impact of artificially assisted methods on methane (CH4) production and oxidation of lake sediments remains unclear. Therefore, after the restoration of submerged macrophytes in some parts of West Lake (Hangzhou, China), sediment samples from West Lake were collected according to restoration methods and plant coverage. The CH4 production potential, oxidation potential, and microbial community structure in the sediment were discussed through whole-lake sample analysis and resampling verification from typical lake areas. From the analysis of the whole lake, the average daily CH4 production potential (ADP) of artificially restored lake areas (0.12 µg g-1 d-1) was significantly lower than that of the naturally restored lake areas (0.52 µg g-1 d-1). From the resampling analysis of typical lake areas, the ADP of naturally restored lake areas was 1.8 times that of artificially restored lake areas (P < 0.01). Although there was no significant difference in the CH4 oxidation potential between the two restoration methods, the presence of submerged macrophytes significantly increased the abundance of the dominant methanotroph Methylocaldum in the sediment, and the rate of increase in the abundance of the dominant methanotroph Methylosinus was significantly higher in artificially assisted restoration than in natural restoration. This study revealed that the artificially assisted restoration of submerged macrophytes reduced the potential for CH4 production and increased the abundance of dominant methanotrophs in the lake sediment, which would be beneficial for the reduction of CH4 emissions during lake ecological restoration and environmental management.
Asunto(s)
Ecosistema , Lagos , Lagos/química , China , Oxidación-Reducción , Metano/análisis , Sedimentos GeológicosRESUMEN
BACKGROUND: Group 2 innate lymphoid cells (ILC2s) are the most dominant ILCs in heart tissue, and sex-related differences exist in mouse lung ILC2 phenotypes and functions; however, it is still unclear whether there are sex differences in heart ILC2s. RESULTS: Compared with age-matched wild-type (WT) male mice, 8-week-old but not 3-week-old WT female mice harbored an obviously greater percentage and number of heart ILC2s in homeostasis. However, the percentage of killer-cell lectin-like receptor G1 (Klrg1)- ILC2s was higher, but the Klrg1+ ILC2s were lower in female mice than in male mice in both heart tissues of 3- and 8-week-old mice. Eight-week-old Rag2-/- mice also showed sex differences similar to those of age-matched WT mice. Regarding surface marker expression, compared to age-matched male mice, WT female mice showed higher expression of CD90.2 and Ki67 and lower expression of Klrg1 and Sca-1 in heart total ILC2s. There was no sex difference in IL-4 and IL-5 secretion by male and female mouse heart ILC2s. Increased IL-33 mRNA levels within the heart tissues were also found in female mice compared with male mice. By reanalyzing published single-cell RNA sequencing data, we found 2 differentially expressed genes between female and male mouse heart ILC2s. Gene set variation analysis revealed that the glycine, serine and threonine metabolism pathway was upregulated in female heart ILC2s. Subcluster analysis revealed that one cluster of heart ILC2s with relatively lower expression of Semaphorin 4a and thioredoxin interacting protein but higher expression of hypoxia-inducible lipid droplet-associated. CONCLUSIONS: These results revealed greater numbers of ILC2s, higher expression of CD90.2, reduced Klrg1 and Sca-1 expression in the hearts of female mice than in male mice and no sex difference in IL-4 and IL-5 production in male and female mouse heart ILC2s. These sex differences in heart ILC2s might be due to the heterogeneity of IL-33 within the heart tissue.
Asunto(s)
Corazón , Inmunidad Innata , Interleucina-33 , Linfocitos , Caracteres Sexuales , Animales , Femenino , Masculino , Ratones , Interleucina-33/genética , Interleucina-33/metabolismo , Interleucina-4/metabolismo , Interleucina-5/metabolismo , Pulmón/metabolismo , Linfocitos/metabolismo , Ratones Noqueados , Antígenos Thy-1/metabolismoRESUMEN
Catechin is one of the flavonoids with antioxidant activity and has attracted great interest. A rapid and accurate detection of catechin is of great significance. Herein, an ultrasensitive catechin electrochemical sensor based on uniform ordered mesoporous carbon hollow spheres (MCHSs) advanced carbon-based conductive material modified glass carbon electrode was constructed. The MCHSs were synthesized by pyrolysis using nitrogen protection and template removal methods, and they exhibited excellent electrochemical detection for catechin owing to their high conductivity and uniform and small spheres with a large specific surface area and hollow structure. Under optimal conditions for the detection of catechin, the MCHSs/GCE showed a wider linear range (10 -1400 nM) and lower detection limit (LOD, 2.82 nM, (S/N = 3)). Furthermore, the electrochemical reaction sites and redox mechanisms of catechin were revealed by electrochemical behavior and density flooding theory. Moreover, the sensor we constructed exhibited good accuracy and stability for the detection of catechin in actual sample detections.
Asunto(s)
Carbono , Catequina , Carbono/química , Electrodos , Nitrógeno/química , Vidrio/química , Técnicas Electroquímicas/métodosRESUMEN
We propose a simple but rapid strategy to fabricate self-crosslinked dual-crosslinking elastomers (SCDCEs) with high mechanical properties. The SCDCEs are synthesized through one-pot copolymerization of Butyl acrylate (BA), acrylic amide (AM), and 3-Methacryloxypropyltrimethoxysilane (MEMO). Both the amino group on AM and the methoxy group on MEMO can be self-crosslinked after polymerization to form a dual-network crosslink consisting of hydrogen bonds crosslink and Si-O-Si covalent bonds crosslink. The SCDC endow optimal elastomer with high mechanical properties (the tensile strength is 6MPa and elongation at break is 490%) as the hydrogen bonds crosslink can serve as sacrificial construction to dissipate stress energy, while covalent crosslinking networks can ensure the elasticity and strength of the material. These two networks also contribute to the recoverability of the elastomers, leading them to recover their original shape and mechanical properties after being subjected to deformation in a short time.
RESUMEN
Full-length transcriptome sequencing with long reads is a powerful tool to analyze transcriptional and post-transcriptional events; however, it has not been applied on soybean (Glycine max). Here, a comparative full-length transcriptome analysis was performed on soybean genotype 09-138 infected with soybean cyst nematode (SCN, Heterodera glycines) race 4 (SCN4, incompatible reaction) and race 5 (SCN5, compatible reaction) using Oxford Nanopore Technology. Each of 9 full-length samples collected 8 days post inoculation with/without nematodes generated an average of 6.1 GB of clean data and a total of 65,038 transcript sequences. After redundant transcripts were removed, 1,117 novel genes and 41,096 novel transcripts were identified. By analyzing the sequence structure of the novel transcripts, a total of 28,759 complete open reading frame (ORF) sequences, 5,337 transcription factors, 288 long non-coding RNAs, and 40,090 novel transcripts with function annotation were predicted. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of differentially expressed genes (DEGs) revealed that growth hormone, auxin-activated signaling pathway and multidimensional cell growth, and phenylpropanoid biosynthesis pathway were enriched by infection with both nematode races. More DEGs associated with stress response elements, plant-hormone signaling transduction pathway, and plant-pathogen interaction pathway with more upregulation were found in the incompatible reaction with SCN4 infection, and more DEGs with more upregulation involved in cell wall modification and carbohydrate bioprocess were detected in the compatible reaction with SCN5 infection when compared with each other. Among them, overlapping DEGs with a quantitative difference was triggered. The combination of protein-protein interaction with DEGs for the first time indicated that nematode infection activated the interactions between transcription factor WRKY and VQ (valine-glutamine motif) to contribute to soybean defense. The knowledge of the SCN-soybean interaction mechanism as a model will present more understanding of other plant-nematode interactions.
RESUMEN
'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10â for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28â and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.
RESUMEN
Gallic acid (GA) is found in a wide range of natural plants and is relevant to the health of human beings. Here, a photoelectrochemical sensing platform based on g-C3N4@CNT heterojunction has been prepared for the highly sensitive and selective detection of GA. Under the light of xenon lamp, the photocurrent of g-C3N4@CNT is 7 times higher than that of g-C3N4. And the sensor generates 4 times more photocurrent in the presence of GA than without GA. This sensor has a wide linear range from 10 nM to 10 µM with a limit of detection as low as 2 nM. Also, the abundant amino groups of g-C3N4 provide excellent selectivity for the sensor. Furthermore, the sensor can be used for the analysis of GA in black tea samples, which provides a novel and rapid method for the detection of GA in food samples.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Antioxidantes , Técnicas Biosensibles/métodos , Técnicas Electroquímicas/métodos , Ácido Gálico , Humanos , LuzRESUMEN
BACKGROUND: Docosahexaenoic acid (DHA) supplementation is beneficial for several chronic diseases; however, its effect on immune regulation is still debated. Given the prevalence of cytomegalovirus (CMV) infection and because natural killer (NK) cells are a component of innate immunity critical for controlling CMV infection, the current study explored the effect of a DHA-enriched diet on susceptibility to murine (M) CMV infection and the NK cell effector response to MCMV infection. RESULTS: Male C57BL/6 mice fed a control or DHA-enriched diet for 3 weeks were infected with MCMV and sacrificed at the indicated time points postinfection. Compared with control mice, DHA-fed mice had higher liver and spleen viral loads at day 7 postinfection, but final MCMV clearance was not affected. The total numbers of NK cells and their terminal mature cell subset (KLRG1+ and Ly49H+ NK cells) were reduced compared with those in control mice at day 7 postinfection but not day 21. DHA feeding resulted in higher IFN-γ and granzyme B expression in splenic NK cells at day 7 postinfection. A mechanistic analysis showed that the splenic NK cells of DHA-fed mice had enhanced glucose uptake, increased CD71 and CD98 expression, and higher mitochondrial mass than control mice. In addition, DHA-fed mice showed reductions in the total numbers and activation levels of CD4+ and CD8+ T cells. CONCLUSIONS: These results suggest that DHA supplementation represses the early response to CMV infection but preserves NK cell effector functions by improving mitochondrial activity, which may play critical roles in subsequent MCMV clearance.