Momentum-dependent scaling exponents of nodal self-energies measured in strange metal cuprates and modelled using semi-holography.

The anomalous strange metal phase found in high-Tc cuprates does not follow the conventional condensed-matter principles enshrined in the Fermi liquid and presents a great challenge for theory. Highly precise experimental determination of the electronic self-energy can provide a test bed for theoretical models of strange metals, and angle-resolved photoemission can provide this as a function of frequency, momentum, temperature and doping. Here we show that constant energy cuts through the nodal spectral function in (Pb,Bi)2Sr2-xLaxCuO6+δ have a non-Lorentzian lineshape, consistent with a self-energy that is k dependent. This provides a new test for aspiring theories. Here we show that the experimental data are captured remarkably well by a power law with a k-dependent scaling exponent smoothly evolving with doping, a description that emerges naturally from anti-de Sitter/conformal-field-theory based semi-holography. This puts a spotlight on holographic methods for the quantitative modelling of strongly interacting quantum materials like the cuprate strange metals.

[Network meta-analysis comparing the clinical outcomes and safety of robotic, laparoscopic, and transanal total rectal mesenteric resection for rectal cancer].

Objective: To methodically assess the clinical effectiveness and safety of robot-assisted total rectal mesenteric resection (RTME), laparoscopic-assisted total rectal mesenteric resection (laTME), and transanal total rectal mesenteric resection (taTME). Methods: A computer search was conducted on PubMed, Embase, Cochrane Library, and Ovid databases to identify English-language reports published between January 2017 and January 2022 that compared the clinical efficacy of the three surgical procedures of RTME, laTME, and taTME. The quality of the studies was evaluated using the NOS and JADAD scales for retrospective cohort studies and randomized controlled trials, respectively. Direct meta-analysis and reticulated meta-analysis were performed using Review Manager software and R software, respectively. Results: Twenty-nine publications comprising 8,339 patients with rectal cancer were ultimately included. The direct meta-analysis indicated that the length of hospital stay was longer after RTME than after taTME, whereas according to the reticulated meta-analysis the length of hospital stay was shorter after taTME than after laTME (MD=-0.86, 95%CI: -1.70 to -0.096, P=0.036). Moreover, the incidence of anastomotic leak was lower after taTME than after RTME (OR=0.60, 95%CI: 0.39 to 0.91, P=0.018). The incidence of intestinal obstruction was also lower after taTME than after RTME (OR=0.55, 95%CI: 0.31 to 0.94, P=0.037). All of these differences were statistically significant (all P<0.05). There were no statistically significant differences between the three surgical procedures regarding the number of lymph nodes cleared, length of the inferior rectal margin, or rate of positive circumferential margins (all P>0.05). An inconsistency test using nodal analysis revealed no statistically significant differences between the results of direct and indirect comparisons of the six outcome indicators (all P>0.05). Furthermore, we detected no significant overall inconsistency between direct and indirect evidence. Conclusion: taTME has advantages over RTME and laTME, in terms of radical and surgical short-term outcomes in patients with rectal cancer.

Chemical and Cellular Formation of Reactive Oxygen Species from Secondary Organic Aerosols in Epithelial Lining Fluid.

INTRODUCTION: Oxidative stress mediated by reactive oxygen species (ROS) is a key process for adverse aerosol health effects. Secondary organic aerosols (SOA) account for a major fraction of particulate matter with aerodynamic diameter ≤2.5 µm (PM2.5). PM2.5 inhalation and deposition into the respiratory tract causes the formation of ROS by chemical reactions and phagocytosis of macrophages in the epithelial lining fluid (ELF), but their relative contributions are not well quantified and their link to oxidative stress remains uncertain. The specific aims of this project were (1) elucidating the chemical mechanism and quantifying the formation kinetics of ROS in the ELF by SOA; (2) quantifying the relative importance of ROS formation by chemical reactions and macrophages in the ELF. METHODS: SOA particles were generated using reaction chambers from oxidation of various precursors including isoprene, terpenes, and aromatic compounds with or without nitrogen oxides (NOx). We collected size-segregated PM at two highway sites in Anaheim, CA, and Long Beach, CA, and at an urban site in Irvine, CA, during two wildfire events. The collected particles were extracted into water or surrogate ELF that contained lung antioxidants. ROS generation was quantified using electron paramagnetic resonance (EPR) spectroscopy with a spin-trapping technique. PM oxidative potential (OP) was also quantified using the dithiothreitol assay. In addition, kinetic modeling was applied for analysis and interpretation of experimental data. Finally, we quantified cellular superoxide release by RAW264.7 macrophage cells upon exposure to quinones and isoprene SOA using a chemiluminescence assay as calibrated with an EPR spin-probing technique. We also applied cellular imaging techniques to study the cellular mechanism of superoxide release and oxidative damage on cell membranes. RESULTS: Superoxide radicals (·O2-) were formed from aqueous reactions of biogenic SOA generated by hydroxy radical (·OH) photooxidation of isoprene, ß-pinene, α-terpineol, and d-limonene. The temporal evolution of ·OH and ·O2- formation was elucidated by kinetic modeling with a cascade of aqueous reactions, including the decomposition of organic hydroperoxides (ROOH), ·OH oxidation of primary or secondary alcohols, and unimolecular decomposition of α-hydroxyperoxyl radicals. Relative yields of various types of ROS reflected the relative abundance of ROOH and alcohols contained in SOA, which generated under high NOx conditions, exhibited lower ROS yields. ROS formation by SOA was also affected by pH. Isoprene SOA had higher ·OH and organic radical yields at neutral than at acidic pH. At low pH ·O2- was the dominant species generated by all types of SOA. At neutral pH, α-terpineol SOA exhibited a substantial yield of carbon-centered organic radicals (R·), while no radical formation was observed by aromatic SOA.Organic radicals in the ELF were formed by mixtures of Fe2+ and SOA generated from photooxidation of isoprene, α-terpineol, and toluene. The molar yields of organic radicals by SOA were 5-10 times higher in ELF than in water. Fe2+ enhanced organic radical yields by a factor of 20-80. Ascorbate mediated redox cycling of iron ions and sustained organic peroxide decomposition, as supported by kinetic modeling reproducing time- and concentration-dependence of organic radical formation, as well as by additional experiments observing the formation of Fe2+ and ascorbate radicals in mixtures of ascorbate and Fe3+. ·OH and superoxide were found to be efficiently scavenged by antioxidants.Wildfire PM mainly generated ·OH and R· with minor contributions from superoxide and oxygen-centered organic radicals (RO·). PM OP was high in wildfire PM, exhibiting very weak correlation with radical forms of ROS. These results were in stark contrast with PM collected at highway and urban sites, which generated much higher amounts of radicals dominated by ·OH radicals that correlated well with OP. By combining field measurements of size-segregated chemical composition, a human respiratory tract model, and kinetic modeling, we quantified production rates and concentrations of different types of ROS in different regions of the ELF by considering particle-size-dependent respiratory deposition. While hydrogen peroxide (H2O2) and ·O2- production were governed by Fe and Cu ions, ·OH radicals were mainly generated by organic compounds and Fenton-like reactions of metal ions. We obtained mixed results for correlations between PM OP and ROS formation, providing rationale and limitations of the use of oxidative potential as an indicator for PM toxicity in epidemiological and toxicological studies.Quinones and isoprene SOA activated nicotinamide adenine dinucleotide phosphate (NADPH) oxidase in macrophages, releasing massive amounts of superoxide via respiratory burst and overwhelming the superoxide formation by aqueous chemical reactions in the ELF. The threshold dose for macrophage activation was much smaller for quinones compared with isoprene SOA. The released ROS caused lipid peroxidation to increase cell membrane fluidity, inducing oxidative damage and stress. Further increases of doses led to the activation of antioxidant response elements, reducing the net cellular superoxide production. At very high doses and long exposure times, chemical production became comparably important or dominant if the escalation of oxidative stress led to cell death. CONCLUSIONS: The mechanistic understandings and quantitative information on ROS generation by SOA particles provided a basis for further elucidation of adverse aerosol health effects and oxidative stress by PM2.5. For a comprehensive assessment of PM toxicity and health effects via oxidative stress, it is important to consider both chemical reactions and cellular processes for the formation of ROS in the ELF. Chemical composition of PM strongly influences ROS formation; further investigations are required to study ROS formation from various PM sources. Such research will provide critical information to environmental agencies and policymakers for the development of air quality policy and regulation.

A preliminary study of peripheral T-cell subsets in porokeratosis patients with MVK or MVD variants.

Background: Porokeratosis (PK) is considered a skin-specific autoinflammatory keratinization disease. Intriguingly, four causative genes of PK are in turn arranged in mevalonate pathway, with MVD variants being the commonest followed by MVK variants in a cohort of Chinese patients. Evidence indicates that mevalonate metabolites induce trained immunity in human monocytes and regulate T cells at multiple levels. Of note, γδT cells are dually regulated by intracellular and extracellular mevalonate metabolism. Aims: To identify the possible differences in T-cell between MVK or MVD variants from PK patients. Materials & Methods: Targeted exome sequencing and exonic CNV screening were performed in 26 patients with PK. Sanger sequencing was used to validate all identified variants. Among them, 22 patients were identified with MVK or MVD variants. PBMCs from 22 PK patients and 27 normal controls (NCs) were analysed by flow cytometry for the frequencies of T cells subsets, including IFN-γ-, and TNF-α-producing T cells. Results: There were 14 mutations identified in the 26 PK patients, including 6 novel mutations (MVK: c.118_226+1337dup, c.388_392delGATATinsC, c.613A>T, c.768G>C, and MVD: c.250C>T, c.988T>G). In contrast to NCs, significantly decreased frequencies of CD8+ and Vγ9Vδ2 T cells were observed in the PK patients with MVD variants. Moreover, it was found that dysregulated secretion of pro-inflammatory cytokines by T cells in both PK patients with MVK and MVD variants. Conclusions: Our findings enriched the Human Gene Mutation Databases and showed probable differences in peripheral T cells subsets between PK patients and controls.

Atomic manipulation of the gap in Bi2Sr2CaCu2O8+x.

Single-atom manipulation within doped correlated electron systems could help disentangle the influence of dopants, structural defects, and crystallographic characteristics on local electronic states. Unfortunately, the high diffusion barrier in these materials prevents conventional manipulation techniques. Here, we demonstrate the possibility to reversibly manipulate select sites in the optimally doped high-temperature superconductor Bi2Sr2CaCu2O8+x using the local electric field of the tip of a scanning tunneling microscope. We show that upon shifting individual Bi atoms at the surface, the spectral gap associated with superconductivity is seen to reversibly change by as much as 15 milli-electron volts (on average ~5% of the total gap size). Our toy model, which captures all observed characteristics, suggests that the electric field induces lateral movement of local pairing potentials in the CuO2 plane.

Superconductivity under pressure in the Dirac semimetal PdTe2.

The Dirac semimetal PdTe2 was recently reported to be a type-I superconductor (T c = 1.64 K, [Formula: see text] mT) with unusual superconductivity of the surface sheath. We here report a high-pressure study, [Formula: see text] GPa, of the superconducting phase diagram extracted from ac-susceptibility and transport measurements on single crystalline samples. T c (p ) shows a pronounced non-monotonous variation with a maximum T c = 1.91 K around 0.91 GPa, followed by a gradual decrease to 1.27 K at 2.5 GPa. Surface superconductivity is robust under pressure as demonstrated by the large superconducting screening signal that persists for applied dc-fields [Formula: see text]. Surprisingly, for [Formula: see text] GPa the superconducting transition temperature at the surface [Formula: see text] is larger than T c of the bulk. Therefore surface superconductivity may possibly have a non-trivial topological nature. We compare the measured pressure variation of T c with recent results from band structure calculations and discuss the importance of a Van Hove singularity.

Author Correction: Noisy defects in the high-Tc superconductor Bi2Sr2CaCu2O8+x.

The original version of this Article contained an error in the right-hand y-axis of Fig. 2c, which incorrectly read 'S/2e (pA)'. The correct version states 'nA' in place of 'pA'. This has been corrected in both the PDF and HTML versions of the Article.

Noisy defects in the high-Tc superconductor Bi2Sr2CaCu2O8+x.

Dopants and impurities are crucial in shaping the ground state of host materials: semiconducting technology is based on their ability to donate or trap electrons, and they can even be used to transform insulators into high temperature superconductors. Due to limited time resolution, most atomic-scale studies of the latter materials focussed on the effect of dopants on the electronic properties averaged over time. Here, by using atomic-scale current-noise measurements in optimally doped Bi2Sr2CaCu2O8+x, we visualize sub-nanometre sized objects where the tunnelling current-noise is enhanced by at least an order of magnitude. We show that these objects are previously undetected oxygen dopants whose ionization and local environment leads to unconventional charge dynamics resulting in correlated tunnelling events. The ionization of these dopants opens up new routes to dynamically control doping at the atomic scale, enabling the direct visualization of local charging on e.g. high-Tc superconductivity.

Penetration depth study of the type-I superconductor PdTe2.

Superconductivity in the topological non-trivial Dirac semimetal PdTe2 was recently shown to be type-I. We hereby report measurements of the relative magnetic penetration depth, [Formula: see text], on several single crystals using a high precision tunnel diode oscillator technique. The temperature variation [Formula: see text] follows an exponential function for [Formula: see text], consistent with a fully-gapped superconducting state and weak or moderately coupling superconductivity. By fitting the data we extract a [Formula: see text]-value of ∼500 nm. The normalized superfluid density is in good agreement with the computed curve for a type-I superconductor with nonlocal electrodynamics. Small steps are observed in [Formula: see text], which possibly relates to a locally lower [Formula: see text] due to defects in the single crystalline sample.

[Efficacy of Yisaipu tapering in the treatment of ankylosing spondylitis].

Objective: To assess the efficacy of Yisaipu tapering in patients with ankylosing spondylitis (AS). Methods: A total of 87 cases of AS patients from Guangdong Second Provincial General Hospital who were treated with Yisaipu and celecoxib were retrospectively analyzed from February 2013 to April 2017.All patients received full dose Yisaipu and celecoxib in the initial 12 weeks.After that, the patients in the full dose group maintained Yisaipu (50 mg/w) treatment from the 13(rd) to 24(th) week, while tapering group received Yisaipu 50 mg subcutaneous injection once every other week.By using AS disease activity score (ASDAS), Bath AS functional index (BASFI) and magnetic resonance (MR) score of sacroiliac joint (SIJ) plus recording adverse events, differences of efficacy and safety between groups were compared. Results: ASDAS and BASFI of tapering group were 1.1±0.7 and 1.3±1.1, while those of full dose group were 1.0±0.7 and 1.1±1.0, respectively.No significant difference of ASDAS or BASFI was found between groups.Besides, the MR scores of tapering and full dose groups were 8±7 and 8±6 respectively before therapy, while they were significantly lower in the 24(th) week (4±4 and 4±3, P<0.05). However, changes of MR score between groups were similar (P>0.05). Conclusion: Dose tapering of Yisaipu subcutaneous injection might be effective for keeping stable of disease activity and function in patients with AS.Its efficacy is similar to those of full dose Yisaipu.

Loss of cane and sugar yield resulting from Ceratovacuna lanigera Zehntner damage in cane-growing regions in China.

Ceratovacuna lanigera Zehntner is a major leaf pest of sugarcane. Widely distributed, it affects both the yield and quality of sugarcane in China. This study aimed to assess real yield and sugar yield losses, and the effect of C. lanigera damage on emergence of newly planted and ratoon cane under current production levels. Field experiments were carried out from 2014 to 2016 in Yunnan Province China. At maturity, plants were harvested and weighed to determine yield, and the effect on sugarcane quality and sucrose content analyzed. Real yield decreased by average of 46,185 kg hm-2 (range: 37,545-61,845 kg hm-2) in damaged versus undamaged areas, with an average yield loss rate of 35.9% (28.5-45.7%). Juice yield decreased by an average of 3.01% (2.4-4.13%) and sucrose content by 6.38% (5.48-8.16%). Juice brix decreased by an average of 7.66°BX (6.95-9.05°BX) and juice gravity purity by 12.35% (8.43-19.97%). In contrast, the reducing sugar content increased by an average of 1.21% (1.01-1.3%). Emergence rates of newly planted cane decreased by an average of 26.0% (24.7-27.3%). The emergence number of ratoon cane decreased by 66,834 hm2 (57,429-76,238 hm-2) and relative emergence loss rates of ratoon cane decreased by an average of 57.8% (57.6-58.0%). These findings confirm that C. lanigera damage severely affects sugarcane yield and quality in Yunnan Province. The results will help the implementation of effective control measures, thereby supporting sustainable development of the Chinese sugar industry.

Macroscopic phase separation of superconductivity and ferromagnetism in Sr0.5Ce0.5FBiS2-x Se x revealed by µSR.

The compound Sr0.5Ce0.5FBiS2 belongs to the intensively studied family of layered BiS2 superconductors. It attracts special attention because superconductivity at T sc = 2.8 K was found to coexist with local-moment ferromagnetic order with a Curie temperature T C = 7.5 K. Recently it was reported that upon replacing S by Se T C drops and ferromagnetism becomes of an itinerant nature. At the same time T sc increases and it was argued superconductivity coexists with itinerant ferromagnetism. Here we report a muon spin rotation and relaxation study (µSR) conducted to investigate the coexistence of superconductivity and ferromagnetic order in Sr0.5Ce0.5FBiS2-x Se x with x = 0.5 and 1.0. By inspecting the muon asymmetry function we find that both phases do not coexist on the microscopic scale, but occupy different sample volumes. For x = 0.5 and x = 1.0 we find a ferromagnetic volume fraction of ~8 % and ~30 % at T = 0.25 K, well below T C = 3.4 K and T C = 3.3 K, respectively. For x = 1.0 (T sc = 2.9 K) the superconducting phase occupies most (~64 %) of the remaining sample volume, as shown by transverse field experiments that probe the Gaussian damping due to the vortex lattice. We conclude ferromagnetism and superconductivity are macroscopically phase separated.

Rotational symmetry breaking in the topological superconductor SrxBi2Se3 probed by upper-critical field experiments.

Recently it was demonstrated that Sr intercalation provides a new route to induce superconductivity in the topological insulator Bi2Se3. Topological superconductors are predicted to be unconventional with an odd-parity pairing symmetry. An adequate probe to test for unconventional superconductivity is the upper critical field, Bc2. For a standard BCS layered superconductor Bc2 shows an anisotropy when the magnetic field is applied parallel and perpendicular to the layers, but is isotropic when the field is rotated in the plane of the layers. Here we report measurements of the upper critical field of superconducting SrxBi2Se3 crystals (Tc = 3.0 K). Surprisingly, field-angle dependent magnetotransport measurements reveal a large anisotropy of Bc2 when the magnet field is rotated in the basal plane. The large two-fold anisotropy, while six-fold is anticipated, cannot be explained with the Ginzburg-Landau anisotropic effective mass model or flux flow induced by the Lorentz force. The rotational symmetry breaking of Bc2 indicates unconventional superconductivity with odd-parity spin-triplet Cooper pairs (Δ4-pairing) recently proposed for rhombohedral topological superconductors, or might have a structural nature, such as self-organized stripe ordering of Sr atoms.

Micro-metric electronic patterning of a topological band structure using a photon beam.

In an ideal 3D topological insulator (TI), the bulk is insulating and the surface conducting due to the existence of metallic states that are localized on the surface; these are the topological surface states. Quaternary Bi-based compounds of Bi(2-x)Sb(x)Te(3-y)Se(y) with finely-tuned bulk stoichiometries are good candidates for realizing ideal 3D TI behavior due to their bulk insulating character. However, despite its insulating bulk in transport experiments, the surface region of Bi(2-x)Sb(x)Te(3-y)Se(y) crystals cleaved in ultrahigh vacuum also exhibits occupied states originating from the bulk conduction band. This is due to adsorbate-induced downward band-bending, a phenomenon known from other Bi-based 3D TIs. Here we show, using angle-resolved photoemission, how an EUV light beam of moderate flux can be used to exclude these topologically trivial states from the Fermi level of Bi1.46Sb0.54Te1.7Se1.3 single crystals, thereby re-establishing the purely topological character of the low lying electronic states of the system. We furthermore prove that this process is highly local in nature in this bulk-insulating TI, and are thus able to imprint structures in the spatial energy landscape at the surface. We illustrate this by 'writing' micron-sized letters in the Dirac point energy of the system.

Maternal gestational diabetes mellitus and overweight and obesity in offspring: a study in Chinese children.

The purpose of this study was to investigate the effects of maternal gestational diabetes mellitus (GDM) and breast feeding on childhood overweight and obesity in a mainland Chinese population. The incidence of and factors associated with overweight and obesity were compared between children of mothers with (n=1068) and without (n=1756) GDM. The independent roles of the associated factors were examined by multiple logistic regression analysis. The incidence of overweight was higher (16.6 v. 12.6%, P=0.002) in the GDM group, but that of obesity was not different (10.7 v. 12.0%, P=0.315). At age 1-2 and 2-5 years, no difference in overweight (11.0 v. 12.0%, P=0.917, and 15.7 v. 14.6%, P=0.693, respectively) was found, while obesity (8.0 v. 13.6%, P=0.019, and 8.4 v. 13.4%, P=0.014, respectively) was less frequent in the GDM offspring. At age 5-10 years, increased overweight (22.2 v. 12.1%, P<0.001) and obesity (15.9 v. 9.0%, P=0.001) were found in the GDM group, which was associated with maternal obesity, being born large-for-gestational age, male gender and formula feeding. After adjusting for confounding factors, GDM remained an independent determinant of offspring overweight and obesity (aOR 2.28, 95% CI 1.61-3.22), suggesting that the effects of GDM were independent of breast feeding, as well as of maternal obesity and birth size.

Magnetic and superconducting phase diagram of the half-Heusler topological semimetal HoPdBi.

We report a study of the magnetic and electronic properties of the non-centrosymmetric half-Heusler antiferromagnet HoPdBi (TN = 2.0 K). Magnetotransport measurements show HoPdBi has a semimetallic behavior with a carrier concentration n = 3.7 × 10(18) cm(-3) extracted from the Shubnikov-de Haas effect. The magnetic phase diagram in the field-temperature plane has been determined by transport, magnetization, and thermal expansion measurements: magnetic order is suppressed at BM ~ 3.6 T for T --> 0. Superconductivity with Tc ~ 1.9 K is found in the antiferromagnetic phase. Ac-susceptibility measurements provide solid evidence for bulk superconductivity below Tc = 0.75 K with a screening signal close to a volume fraction of 100%. The upper critical field shows an unusual linear temperature variation with Bc2(T --> 0) = 1.1 T. We also report electronic structure calculations that classify HoPdBi as a new topological semimetal, with a non-trivial band inversion of 0.25 eV.

Hypoxia inducible factor 2α/insulin-like growth factor receptor signal loop supports the proliferation and Oct-4 maintenance of mouse germline stem cells.

Hypoxia inducible factor 2α (HIF-2α) is critical for primordial germ cell (PGC) survival as knockout of HIF-2α (HIF-2α(-/-)) decreases both expression of Oct-4 and PGC number in genital ridge. Hypoxia is known to stabilize HIF-2α protein from proteasomal degradation. However, little is known about the hypoxia-associated endocrinal signaling in HIF-2α expression. The current work demonstrates a role for an endocrine insulin-like growth factor-I receptor (IGF-IR)-PI3K/Akt-mTOR-HIF-2α regulatory loop in the proliferation and Oct-4 maintenance of PGC-like alkaline phosphatase positive mouse germline stem cells (AP(+)GSCs). We found that hypoxia greatly increased the cell proliferation and the levels of nuclear Oct-4/HIF-2α protein of AP(+)GSCs. The hypoxic-AP(+)GSCs presented stronger stemness ability for germ cell differentiation than normoxic, with expressions of c-KIT (differentiation germ cell marker), VASA (differentiation germ cell marker) and SCP3 (meiotic marker) using a renal capsule transplantation assay. Meanwhile, hypoxia significantly increased the expression levels of secreted-IGF-I and IGF-IR. The IGF-I dose dependently increased the HIF-2α expression levels in AP(+)GSCs; and, the inhibition of IGF-IR by RNA interference (shIGF-IR) or LY294002 (PI3K inhibitor)/Rapamycin (mTOR inhibitor) effectively suppressed the IGF-I- and/or hypoxia-induced HIF-2α and Oct-4 expression, suggesting that the IGF-IR and its downstream Akt/mTOR signaling are involved in the IGF-I/hypoxia effects. Additionally, knockdown of HIF-2α dramatically suppressed Oct-4 and IGF-IR protein levels in AP(+)GSC cells. In conclusion, the present study demonstrates a regulatory loop of IGF-IR-PI3K/Akt-mTOR-HIF-2α in proliferation and Oct-4 maintenance of PGC-like AP(+)GSCs under hypoxia. This finding provides insights into the niche endocrinology underlying early germ cell development.

(3 + 1)-dimensional crystal and antiferromagnetic structures in CeRuSn.

At 320 K, the crystal structure of CeRuSn is commensurate with the related CeCoAl-type of structure by the doubling of the c lattice parameter. However, with lowering the temperature it becomes incommensurate with x and z position parameters at all three elemental sites being modulated as one moves along the c-axis. The resulting crystal structure can be conveniently described within the superspace formalism in (3 + 1) dimensions. The modulation vector, after initially strong temperature dependence, approaches a value close to qnuc = (0 0 0.35). Below TN = 2.8 (1) K, CeRuSn orders antiferromagnetically with a propagation vector qmag = (0 0 0.175), i.e. with the magnetic unit cell doubled along the c-axis direction with respect to the incommensurate crystal structure. Ce moments appear to be nearly collinear, confined to the a-c plane, forming ferromagnetically coupled pairs. Their magnitudes are modulated between 0.11 and 0.95 µB as one moves along the c-axis.

First Report of Meloidogyne enterolobii on Carrot in China.

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) µm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) µm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.