Optimized RNA interference therapeutics combined with interleukin-2 mRNA for treating hepatitis B virus infection.

This study aimed to develop a pan-genotypic and multifunctional small interfering RNA (siRNA) against hepatitis B virus (HBV) with an efficient delivery system for treating chronic hepatitis B (CHB), and explore combined RNA interference (RNAi) and immune modulatory modalities for better viral control. Twenty synthetic siRNAs targeting consensus motifs distributed across the whole HBV genome were designed and evaluated. The lipid nanoparticle (LNP) formulation was optimized by adopting HO-PEG2000-DMG lipid and modifying the molar ratio of traditional polyethylene glycol (PEG) lipid in LNP prescriptions. The efficacy and safety of this formulation in delivering siHBV (tLNP/siHBV) along with the mouse IL-2 (mIL-2) mRNA (tLNP/siHBVIL2) were evaluated in the rAAV-HBV1.3 mouse model. A siRNA combination (terms "siHBV") with a genotypic coverage of 98.55% was selected, chemically modified, and encapsulated within an optimized LNP (tLNP) of high efficacy and security to fabricate a therapeutic formulation for CHB. The results revealed that tLNP/siHBV significantly reduced the expression of viral antigens and DNA (up to 3log10 reduction; vs PBS) in dose- and time-dependent manners at single-dose or multi-dose frequencies, with satisfactory safety profiles. Further studies showed that tLNP/siHBVIL2 enables additive antigenic and immune control of the virus, via introducing potent HBsAg clearance through RNAi and triggering strong HBV-specific CD4+ and CD8+ T cell responses by expressed mIL-2 protein. By adopting tLNP as nucleic acid nanocarriers, the co-delivery of siHBV and mIL-2 mRNA enables synergistic antigenic and immune control of HBV, thus offering a promising translational therapeutic strategy for treating CHB.

First report of the maize cyst nematode Heterodera zeae in Sichuan Province of Southwest China.

Maize is the largest crop planted in China. Nine species of cyst nematodes have been reported to affect maize production. Heterodera zeae, H. avenae and Punctodera chalcoensis can cause significant maize yield losses annually (Luc et al. 2005). In 1971, the maize cyst nematode H. zeae was first detected in Rajasthan, India (Koshy et al. 1971). Subsequently, it has been reported in many other countries such as the United States, Greece, Pakistan, and Egypt. In China, H. zeae was first identified in the maize fields of Laibin City, Guangxi Zhuang Autonomous Region (Wu et al., 2017). Cui et al. (2020) identified H. zeae in a maize field of Yuzhou City, Henan Province of Central China in 2018. From 2018 to 2022, a survey of cyst-forming nematodes was conducted in Southwest China. Fifteen soil samples of about 500 g each were collected from Luding County, Ganzi Prefecture of Sichuan Province. No major aboveground symptoms were shown on maize, but a few females were observed on the roots of maize in one field. The cysts and second-stage juveniles (J2s) were collected from each soil sample using Cobb's screening gravity method. A total of 8.50±2.0 cysts per 100 ml of soil on the average were observed in the field. A thin subcrystalline layer was discernible only in young cysts. Morphological and molecular studies of cysts and J2s indicated that the nematodes were identified to be H. zeae in a maize-field. Morphologically, the cysts were in a lemon shape, light brown or pearly white in color. The vulval cone was prominent. Fenestra ambifenestrate, and semifenestra were separated by a fairly wide vulval bridge, fenestral length and width were variable, and the cyst wall was shown in a zigzag pattern. The J2s' body was in a vermiform, tapering at both ends, with a hyaline tail. Stylet was strongly developed with round or slightly anteriorly directed knobs. Morphological measurements of the cysts (n = 9) determined that the mean body length was 417.2 µm (403.6 to 439.4 µm), body width was 429.7 µm (397.6 to 456.9µm); length-width ratio was 1.4 (0.75 to 3); fenestra length was 525.3 µm (498.5 to 570.7 µm); and the mean semifenestra width was 458.6 µm (403.6 to 546.3 µm). Morphometric measurements of second-stage juveniles (n = 20) showed a body length of 419.7µm (355.8 to 492.5 µm); a stylet length of 20.8 µm (19.51 to 23.3µm); a tail length of 41.5 µm (20 to 49.4 µm); and a hyaline tail length of 20.7 µm (16.6 to 24 µm). The main morphological characteristics and measured values were basically consistent with those described by Cui et al. (2022), and all of which were similar to those of H. zeae. Amplification of DNA from random single cysts (n = 5) was conducted using the protocol described by Cui et al. (2022). The rDNA-internal transcribed spacer (ITS) was amplified and sequenced using a pair of universal primers TW81 (5'-GTTTCCGTAGGTGAA CCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'). The ITS sequences were deposited at GenBank with the accession number OR811029.1. Alignments of sequences showed an identity of 98% with H. zeae sequences from China (OP692769.2, MW785772.1) and the USA (GU145616.1), which were confirmed using a pair of species-specific primers HzF1 (5'-GGGGAGGTGAATGTGGG-3') and HzR1 (5'-CCTTTGGCAATCGGTGA-3') of H. zeae with a targeted PCR fragment of 393 bp (Cui et al. 2022). Pathogenicity was conducted and confirmed by infection and reproduction on maize. Seeds (cv. Zhengda 619) were sown in three pots that contained 150 ml of a sterile soil mixture (loamy soil: sand=1:1), and 5 cysts (103 eggs/cyst on the average) were inoculated in each pot at 25/30°C, under a 12-h dark/12-h light condition (Cui et al. 2023). Fifteen days after sowing, third- and fourth-stage juveniles were observed in the rootstained with acid fuchsin, and a total of 32 cysts per maize plant on the average were collected at 40 days after sowing. The new cysts' morphological and molecular characteristics were identical to the cysts from the original soil samples. To the best of our knowledge, this is the first report of H. zeae as a pathogen on maize in Sichuan Province, Southwest China. Our findings will be useful for management and further research of maize cyst nematodes.

Effects of PEG antibodies on in vivo performance of LNP-mRNA vaccines.

Polyethylene glycol (PEG) plays important roles in stabilizing and lengthening circulation time of lipid nanoparticle (LNP) vaccines. Nowadays various levels of PEG antibodies have been detected in human blood, but the impact and mechanism of PEG antibodies on the in vivo performance of LNP vaccines has not been clarified thoroughly. By illustrating the distribution characteristics of PEG antibodies in human, the present study focused on the influence of PEG antibodies on the safety and efficacy of LNP-mRNA vaccine against COVID-19 in animal models. It was found that PEG antibodies led to shortened blood circulation duration, elevated accumulation and mRNA expression in liver and spleen, enhanced expression in macrophage and dendritic cells, while without affecting the production of anti-Spike protein antibodies of COVID-19 LNP vaccine. Noteworthily, PEG antibodies binding on the LNP vaccine increased probability of complement activation in animal as well as in human serum and led to lethal side effect in large dosage via intravenous injection of mice. Our data suggested that PEG antibodies in human was a risky factor of LNP-based vaccines for biosafety concerns but not efficacy.

Reexamining the effects of drug loading on the in vivo performance of PEGylated liposomal doxorubicin.

Higher drug loading employed in nanoscale delivery platforms is a goal that researchers have long sought after. But such viewpoint remains controversial because the impacts that nanocarriers bring about on bodies have been seriously overlooked. In the present study we investigated the effects of drug loading on the in vivo performance of PEGylated liposomal doxorubicin (PLD). We prepared PLDs with two different drug loading rates: high drug loading rate, H-Dox, 12.9% w/w Dox/HSPC; low drug loading rate, L-Dox, 2.4% w/w Dox/HSPC (L-Dox had about 5 folds drug carriers of H-Dox at the same Dox dose). The pharmaceutical properties and biological effects of H-Dox and L-Dox were compared in mice, rats or 4T1 subcutaneous tumor-bearing mice. We showed that the lowering of doxorubicin loading did not cause substantial shifts to the pharmaceutical properties of PLDs such as in vitro and in vivo stability (stable), anti-tumor effect (equivalent effective), as well as tissue and cellular distribution. Moreover, it was even more beneficial for mitigating the undesired biological effects caused by PLDs, through prolonging blood circulation and alleviating cutaneous accumulation in the presence of pre-existing anti-PEG Abs due to less opsonins (e.g. IgM and C3) deposition on per particle. Our results warn that the effects of drug loading would be much more convoluted than expected due to the complex intermediation between nanocarriers and bodies, urging independent investigation for each individual delivery platform to facilitate clinical translation and application.

Protein corona on brain targeted nanocarriers: Challenges and prospects.

Safe and efficient medical therapy for brain diseases is still an unmet clinical need due to various barriers represented by the blood-brain barrier. Well-designed brain targeted nanocarriers are potential solutions for enhanced brain drug delivery; however, the complicated in vivo process attenuates performance of nanocarriers, which severely hampers clinical translation. The formation of protein corona (PC) is inevitable for nanocarriers circulation and transport in biofluids, acting as an important factor to regulate in vivo performance of nanocarriers. In this review, the reported strategies have been retrospected for better understanding current situation in developing brain targeted nanocarriers. The interplay between brain targeted nanocarriers and plasma proteins is emphasized to comprehend how the nanocarriers adsorb proteins by certain synthetic identity, and following regulations on in vivo performance of nanocarriers. More importantly, the mainstream methods to promote efficiency of nanocarriers by regulating PC, defined as in vitro functionalization and in vivo functionalization strategies, are also discussed. Finally, viewpoints about future development of brain targeted nanocarriers according to the understanding on nanocarriers-PC interaction are proposed.

First record of cyst nematode (Heterodera filipjevi) on winter wheat from Shanxi Province in North China.

Heterodera avenae, H. filipjevi, and H. laptipons are considered to be the major cyst nematode pathogens affecting most cereals and causing severe crop losses (Smiley and Yan 2015). In China, H. filipjevi was first recorded in Xuchang, Henan Province (Peng et al. 2010). Recently, H. filipjevi has been found in Anhui, Hebei, Shandong and Xinjiang provinces of China (Cui et al. 2021). To further understand the latest occurrence and distribution of H. filipjevi in China, a survey of cyst nematodes was conducted in the wheat planting area of Shanxi Province of North China from June 2018 to November 2020. White female cysts (5.8 ± 2.99 cysts per plant) were found on wheat roots in the sandy soil, and wheat was displaying symptoms of dwarfing, yellowing, and had few tillers in Licheng of Changzhi (N36°32´010´´, E113°27´039´´; N36°29´050´´, E113°23´023´´; N36°29´035´´, E113°22´020´´) and Zezhou of Jincheng (N35°33´057´´, E112°56´020´´) in Shanxi Province, and second-stage juveniles (J2s) were obtained from 13 soil samples using the sieving-decanting method. Four of the 13 samples were identified as H. filipjevi on the basis of morphological and molecular studies of female cysts and J2s. Morphologically, the cysts were lemon shaped and featured a pronounced vulval cone. The color ranged from light to dark brown. The white female shell was covered with a white crystalline layer. The vulval cone was bifenestrate with horseshoe-shaped bullae numerous and distinct, and a strongly developed underbridge. The main measurements (mean ± SD, range) of cysts (n = 13) were as follows: body length including neck 780.5 ± 53.9 µm (692 to 843 µm); body width 527.3 ± 55.5 µm (435 to 620 µm); length/width ratio 1.50 ± 0.21 (1.20 to 1.93); fenestra length 55.5 ± 4.1 µm (49 to 61 µm); fenestra width 24.8 ± 2.2 µm (21.1 to 28.8 µm); vulval slit length 9.0 ± 0.7 µm (7.8 to 9.6 µm); and underbridge length 66.8 ± 5.0 µm (61 to 77 µm). The measurements of J2s (n = 13) were as follows: body length 554.4 ± 23.4 µm (520to 587 µm); stylet length 22.7 ± 0.7 µm (21.5 to 23.8 µm); tail length 61.0 ± 5.5 µm (51.2 to 68.9 µm); and hyaline tail terminus length 37.3 ± 2.7 µm (33.4 to 42.3 µm). These morphological measurements are within the range characteristic of H. filipjevi (Peng et al. 2010). Genomic DNA was extracted from individual cyst (n = 6) and the rDNA internal transcribed spacer (ITS) sequence was amplified using the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR test for each sample was repeated five times. The obtained ITS sequences (GenBank accession No. OQ421499 to OQ421502, 1054 bp) showed more than 99.5% similarity to those of H. filipjevi from the United States (GU079654 and KP878490), Turkey (KR704304 and KR704292), and China (MW789611, KY448473 and KT314234). The results were confirmed again by the species-specific primers HfF1 and HfR1of H. filipjevi and the target PCR fragments of 646 bp were obtained (Peng et al. 2013). The pathogenicity of H. filipjevi was verified by infesting winter wheat (Triticum aestivum 'Wenmai 19') and studying nematode developmentand reproduction with growth chamber (Cui et al. 2015). Eggs were hatched at 14-16°C, and freshly hatched J2s were used to inoculate wheat plants when the roots were approximately 1-centimeter long. Fifteen wheat plants were inoculated with 200 J2s, and three wheat plants without J2s were set as controls (Cui et al. 2021). Parasitic J2s and third- and fourth-stage juveniles were found in roots stained with acid fuchsin at 5, 15, and 25 days after inoculation (DAI), adult females were detected at 50 DAI, and a mean of 23.7 cysts per pot were extracted at 70 DAI (Cui et al. 2015). The morphological and molecular characteristics of the new cysts were identical to those of the H. filipjevi cysts from the original field samples, and no cysts formed in the control groups. Wheat is the main food and economic crop in Shanxi, and H. filipjevi, a potential threat to cereal crop production in Shanxi, should arouse sufficient attention. H. filipjevi is major cyst nematode pathogens of wheat and shows high prevalence in China. The loss of wheat production due to H. filipjevi is as high as 32.3% when the initial density ≥ 64 eggs/mL in soil (Li 2018). To the best of our knowledge, this is the first report of H. filipjevi in Shanxi Province of North China.

Interplay between Liposomes and IgM: Principles, Challenges, and Opportunities.

Liposomes have received tremendous attention as a class of versatile pharmaceutical vehicles of great potential over the past several decades. However, the application of liposomes encounters major challenges due to the knowledge gaps in their in vivo delivery process. Immunoglobulin M (IgM) displays both pervasiveness and complexity in regulating the biological functions as well as eliciting adverse effects of liposomes. Understanding, mitigating, and exploiting the duality of IgM are prerequisites for achieving various biomedical applications of liposomes. In this review, the intricate relationship between liposomes and their biological environments has been summarized, with an emphasis on the regulatory effects of IgM on in vivo performance of liposomes. Corresponding solutions have also been discussed to evade IgM-mediated opsonization for safe and efficient drug delivery.

Deleterious Mechanical Deformation Selects Mechanoresilient Cancer Cells with Enhanced Proliferation and Chemoresistance.

Cancer cells in secondary tumors are found to form metastases more efficiently as compared to their primary tumor counterparts. This is partially due to the unfavorable microenvironments encountered by metastasizing cancer cells that result in the survival of a more metastatic phenotype from the original population. However, the role of deleterious mechanical stresses in this change of metastatic potential is unclear. Here, by forcing cancer cells to flow through small capillary-sized constrictions, it is demonstrated that mechanical deformation can select a tumor cell subpopulation that exhibits resilience to mechanical squeezing-induced cell death. Transcriptomic profiling reveals up-regulated proliferation and DNA damage response pathways in this subpopulation, which are further translated into a more proliferative and chemotherapy-resistant phenotype. These results highlight a potential link between the microenvironmental physical stresses and the enhanced malignancy of metastasizing cancer cells which may be utilized as a therapeutic strategy in preventing the metastatic spread of cancer cells.

Ocular therapies with biomacromolecules: From local injection to eyedrop and emerging noninvasive delivery strategies.

The last two decades have witnessed a continuously increasing number of biomacromolecules approved for the treatment of ocular diseases. The eye possesses multiple protective mechanisms to resist the invasion of exogenous substances, but meanwhile these physiological defense systems also act as strong barriers, impeding absorption of most biomacromolecules into the eye. As a result, local injections play predominant roles for posterior ocular delivery of biomacromolecules in clinical practice. To achieve safe and convenient application of biomacromolecules, alternative strategies to realize noninvasive intraocular delivery are necessary. Various nanocarriers, novel penetration enhancers and physical strategies have been explored to facilitate delivery of biomacromolecules to both anterior and posterior ocular segments but still suffered difficulties in clinical translation. This review compares the anatomical and physiological characteristics of the eyes from those frequently adopted experimental species and profiles the well-established animal models of ocular diseases. We also summarize the ophthalmic biomacromolecules launched on the market and put emphasis on emerging noninvasive intraocular delivery strategies of peptides, proteins and genes.

Intraocular siRNA Delivery Mediated by Penetratin Derivative to Silence Orthotopic Retinoblastoma Gene.

Gene therapy brings a ray of hope for inherited ocular diseases that may cause severe vision loss and even blindness. However, due to the dynamic and static absorption barriers, it is challenging to deliver genes to the posterior segment of the eye by topical instillation. To circumvent this limitation, we developed a penetratin derivative (89WP)-modified polyamidoamine polyplex to deliver small interference RNA (siRNA) via eye drops to achieve effective gene silencing in orthotopic retinoblastoma. The polyplex could be spontaneously assembled through electrostatic and hydrophobic interactions, as demonstrated by isothermal titration calorimetry, and enter cells intactly. In vitro cellular internalization revealed that the polyplex possessed higher permeability and safety than the lipoplex composed of commercial cationic liposomes. After the polyplex was instilled in the conjunctival sac of the mice, the distribution of siRNA in the fundus oculi was significantly increased, and the bioluminescence from orthotopic retinoblastoma was effectively inhibited. In this work, an evolved cell-penetrating peptide was employed to modify the siRNA vector in a simple and effective way, and the formed polyplex interfered with intraocular protein expression successfully via noninvasive administration, which showed a promising prospect for gene therapy for inherited ocular diseases.

Does This Child With High Blood Pressure Have Secondary Hypertension?: The Rational Clinical Examination Systematic Review.

Importance: Guidelines recommend that all children and adolescents with hypertension undergo evaluation for secondary causes. Identifying clinical factors associated with secondary hypertension may decrease unnecessary testing for those with primary hypertension. Objective: To determine the utility of the clinical history, physical examination, and 24-hour ambulatory blood pressure monitoring for differentiating primary hypertension from secondary hypertension in children and adolescents (aged ≤21 years). Data Sources and Study Selection: The databases of MEDLINE, PubMed Central, Embase, Web of Science, and Cochrane Library were searched from inception to January 2022 without language limits. Two authors identified studies describing clinical characteristics in children and adolescents with primary and secondary hypertension. Data Extraction and Synthesis: For each clinical finding in each study, a 2 × 2 table was created that included the number of patients with and without the finding who had primary vs secondary hypertension. Risk of bias was assessed using the Quality Assessment of Diagnostic Accuracy Studies tool. Main Outcomes and Measures: Random-effects modeling was used to calculate sensitivity, specificity, and likelihood ratios (LRs). Results: Of 3254 unique titles and abstracts screened, 30 studies met inclusion criteria for the meta-analysis and 23 (N = 4210 children and adolescents) were used for pooling in the meta-analysis. In the 3 studies conducted at primary care clinics or school-based screening clinics, the prevalence of secondary hypertension was 9.0% (95% CI, 4.5%-15.0%). In the 20 studies conducted at subspecialty clinics, the prevalence of secondary hypertension was 44% (95% CI, 36%-53%). The demographic findings most strongly associated with secondary hypertension were family history of secondary hypertension (sensitivity, 0.46; specificity, 0.90; LR, 4.7 [95% CI, 2.9-7.6]), weight in the 10th percentile or lower for age and sex (sensitivity, 0.27; specificity, 0.94; LR, 4.5 [95% CI, 1.2-18]), history of prematurity (sensitivity range, 0.17-0.33; specificity range, 0.86-0.94; LR range, 2.3-2.8), and age of 6 years or younger (sensitivity range, 0.25-0.36; specificity range, 0.86-0.88; LR range, 2.2-2.6). Laboratory studies most associated with secondary hypertension were microalbuminuria (sensitivity, 0.13; specificity, 0.99; LR, 13 [95% CI, 3.1-53]) and serum uric acid concentration of 5.5 mg/dL or lower (sensitivity range, 0.70-0.73; specificity range, 0.65-0.89; LR range, 2.1-6.3). Increased daytime diastolic blood pressure load combined with increased nocturnal systolic blood pressure load on 24-hour ambulatory blood pressure monitoring was associated with secondary hypertension (sensitivity, 0.40; specificity, 0.82; LR, 4.8 [95% CI, 1.2-20]). Findings associated with a decreased likelihood of secondary hypertension were asymptomatic presentation (LR range, 0.19-0.36), obesity (LR, 0.34 [95% CI, 0.13-0.90]), and family history of any hypertension (LR, 0.42 [95% CI, 0.30-0.57]). Hypertension stage, headache, and left ventricular hypertrophy did not distinguish secondary from primary hypertension. Conclusions and Relevance: Family history of secondary hypertension, younger age, lower body weight, and increased blood pressure load using 24-hour ambulatory blood pressure monitoring were associated with a higher likelihood of secondary hypertension. No individual sign or symptom definitively differentiates secondary hypertension from primary hypertension.

TRPM1 promotes tumor progression in acral melanoma by activating the Ca2+/CaMKIIδ/AKT pathway.

INTRODUCTION: Acral melanoma is a predominant and aggressive subtype of melanoma in non-Caucasian populations. There is a lack of genotype-driven therapies for over 50% of patients. TRPM1 (transient receptor potential melastatin 1), a nonspecific cation channel, is mainly expressed in retinal bipolar neurons and skin. Nonetheless, the function of TRPM1 in melanoma progression is poorly understood. OBJECTIVES: We investigated the association between TRPM1 and acral melanoma progression and revealed the molecular mechanisms by which TRPM1 promotes tumor progression and malignancy. METHODS: TRPM1 expression and CaMKII phosphorylation in tumor specimens were tested by immunohistochemistry analysis and scored by two independent investigators. The functions of TRPM1 and CaMKII were assessed using loss-of-function and gain-of-function approaches and examined by western blotting, colony formation, cell migration and invasion, and xenograft tumor growth assays. The effects of a CaMKII inhibitor, KN93, were evaluated using both in vitro cell and in vivo xenograft mouse models. RESULTS: We revealed that TRPM1 protein expression was positively associated with tumor progression and shorter survival in patients with acral melanoma. TRPM1 promoted AKT activation and the colony formation, cell mobility, and xenograft tumor growth of melanoma cells. TRPM1 elevated cytosolic Ca2+ levels and activated CaMKIIδ (Ca2+/calmodulin-dependent protein kinase IIδ) to promote the CaMKIIδ/AKT interaction and AKT activation. The functions of TRPM1 in melanoma cells were suppressed by a CaMKII inhibitor, KN93. Significant upregulation of phospho-CaMKII levels in acral melanomas was related to increased expression of TRPM1. An acral melanoma cell line with high expression of TRPM1, CA11, was isolated from a patient to show the anti-tumor activity of KN93 in vitro and in vivo. CONCLUSIONS: TRPM1 promotes tumor progression and malignancy in acral melanoma by activating the Ca2+/CaMKIIδ/AKT pathway. CaMKII inhibition may be a potential therapeutic strategy for treating acral melanomas with high expression of TRPM1.

Extracellular matrix mechanobiology in cancer cell migration.

The extracellular matrix (ECM) is pivotal in modulating tumor progression. Besides chemically stimulating tumor cells, it also offers physical support that orchestrates the sequence of events in the metastatic cascade upon dynamically modulating cell mechanosensation. Understanding this translation between matrix biophysical cues and intracellular signaling has led to rapid growth in the interdisciplinary field of cancer mechanobiology in the last decade. Substantial efforts have been made to develop novel in vitro tumor mimicking platforms to visualize and quantify the mechanical forces within the tissue that dictate tumor cell invasion and metastatic growth. This review highlights recent findings on tumor matrix biophysical cues such as fibrillar arrangement, crosslinking density, confinement, rigidity, topography, and non-linear mechanics and their implications on tumor cell behavior. We also emphasize how perturbations in these cues alter cellular mechanisms of mechanotransduction, consequently enhancing malignancy. Finally, we elucidate engineering techniques to individually emulate the mechanical properties of tumors that could help serve as toolkits for developing and testing ECM-targeted therapeutics on novel bioengineered tumor platforms. STATEMENT OF SIGNIFICANCE: Disrupted ECM mechanics is a driving force for transitioning incipient cells to life-threatening malignant variants. Understanding these ECM changes can be crucial as they may aid in developing several efficacious drugs that not only focus on inducing cytotoxic effects but also target specific matrix mechanical cues that support and enhance tumor invasiveness. Designing and implementing an optimal tumor mimic can allow us to predictively map biophysical cue-modulated cell behaviors and facilitate the design of improved lab-grown tumor models with accurately controlled structural features. This review focuses on the abnormal changes within the ECM during tumorigenesis and its implications on tumor cell-matrix mechanoreciprocity. Additionally, it accentuates engineering approaches to produce ECM features of varying levels of complexity which is critical for improving the efficiency of current engineered tumor tissue models.

CHK2 activation contributes to the development of oxaliplatin resistance in colorectal cancer.

BACKGROUND: Colorectal cancer (CRC), the most common cancer type, causes high morbidity and mortality. Patients who develop drug resistance to oxaliplatin-based regimens have short overall survival. Thus, identifying molecules involved in the development of oxaliplatin resistance is critical for designing therapeutic strategies. METHODS: A proteomic screen was performed to reveal altered protein kinase phosphorylation in oxaliplatin-resistant (OR) CRC tumour spheroids. The function of CHK2 was characterised using several biochemical techniques and evident using in vitro cell and in vivo tumour models. RESULTS: We revealed that the level of phospho-CHK2(Thr68) was elevated in OR CRC cells and in ~30% of tumour samples from patients with OR CRC. We demonstrated that oxaliplatin activated several phosphatidylinositol 3-kinase-related kinases (PIKKs) and CHK2 downstream effectors and enhanced CHK2/PARP1 interaction to facilitate DNA repair. A phosphorylation mimicking CHK2 mutant, CHK2T68D, but not a kinase-dead CHK2 mutant, CHK2D347A, promoted DNA repair, the CHK2/PARP1 interaction, and cell growth in the presence of oxaliplatin. Finally, we showed that a CHK2 inhibitor, BML-277, reduced protein poly(ADP-ribosyl)ation (PARylation), FANCD2 monoubiquitination, homologous recombination and OR CRC cell growth in vitro and in vivo. CONCLUSION: Our findings suggest that CHK2 activity is critical for modulating oxaliplatin response and that CHK2 is a potential therapeutic target for OR CRC.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

Topical instillation of cell-penetrating peptide-conjugated melphalan blocks metastases of retinoblastoma.

Retinoblastoma is the most common primary intraocular malignancy in infancy with a metastases-related death risk. However, a safe and convenient treatment without enucleation is still an unmet clinical need. In this work, a cell-penetrating peptide, 89WP, was conjugated with melphalan (89WP-Mel), which achieved high tumor inhibition effects as intravitreally injected melphalan via topical instillation for the first time. Notably, the "outside-in" diffusion of instilled 89WP-Mel created a protective shield surrounding the eye, efficiently preventing tumor metastases, while the mice treated with intravitreally injected melphalan suffered more brain metastases related death. The ocular absorption of 89WP-conjugated melphalan and other small molecules, both hydrophobic and hydrophilic, occurred via non-corneal pathway with high safety and a prolonged residence duration in retina up to 24 h. The present work paves a new avenue for simultaneous intraocular tumor inhibition and extraocular metastases prevention in a safe and convenient way via topical instillation.

cRGD enables rapid phagocytosis of liposomal vancomycin for intracellular bacterial clearance.

RGD motif has long been exploited as a versatile tool for targeted drug delivery. However, there are so far no successful clinical translations of RGD functionalized nanomedicines. The lack of comprehensive understanding of their in vivo delivery process poses one of the main obstacles. As a reflection on cRGD-enabled targeting delivery, herein the in vivo fate of cyclic RGD peptide functionalized liposome (cRGD-sLip) and its fundamental mechanism are investigated. cRGD-sLip demonstrates incredibly rapid blood clearance and massive mononuclear phagocytic system (MPS) accumulation after intravenous injection. Phagocytes actively capture cRGD-sLip by recognizing αvß3 integrins and scavenger receptors, urging reinterrogation of RGD enabled targeting delivery. Intracellular infection with microbes invading and persisting in the phagocytic system poses serious threats to global public health. Most antimicrobial agents are unable to penetrate through host cell membrane and achieve optimal intracellular therapeutic concentration, resulting in ineffective bacterial killing. By leveraging the rapid phagocytic uptake, cRGD-sLip demonstrates the capability to facilitate effective targeted drug delivery to bacteria infected macrophages and successfully reduce the bacterial burden in a murine intracellular Methicillin-resistant Staphylococcus aureus (MRSA) infection model, verifying the potential value of cRGD-sLip in improving therapeutic efficacy of existing antibiotics in the treatment of intracellular bacterial infection.

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.