Genome-Led Discovery of the Antibacterial Cyclic Lipopeptide Kutzneridine A and Its Silent Biosynthetic Gene Cluster from Kutzneria Species.

Genome analysis of Kutzneria sp. CA-103260 revealed a putative lipopeptide-encoding biosynthetic gene cluster (BGC) that was cloned into a bacterial artificial chromosome (BAC) and heterologously expressed in Streptomyces coelicolor M1152. As a result, a novel cyclic lipo-tetrapeptide containing two diaminopropionic acid residues and an exotic N,N-acetonide ring, kutzneridine A (1), was isolated and structurally characterized. Evaluation of the extraction conditions and isotope-labeling chemical modifications showed that the acetonide ring originated from acetone during isolation. The BGC was analyzed in silico and a biosynthetic pathway to 1 was proposed. Kutzneridine A displayed remarkable antibacterial activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococci.

Tobacco as a promising crop for low-carbon biorefinery.

Energy crops play a vital role in meeting future energy and chemical demands while addressing climate change. However, the idealization of low-carbon workflows and careful consideration of cost-benefit equations are crucial for their more sustainable implementation. Here, we propose tobacco as a promising energy crop because of its exceptional water solubility, mainly attributed to a high proportion of water-soluble carbohydrates and nitrogen, less lignocellulose, and the presence of acids. We then designed a strategy that maximizes biomass conversion into bio-based products while minimizing energy and material inputs. By autoclaving tobacco leaves in water, we obtained a nutrient-rich medium capable of supporting the growth of microorganisms and the production of bioproducts without the need for extensive pretreatment, hydrolysis, or additional supplements. Additionally, cultivating tobacco on barren lands can generate sufficient biomass to produce approximately 573 billion gallons of ethanol per year. This approach also leads to a reduction of greenhouse gas emissions by approximately 76% compared to traditional corn stover during biorefinery processes. Therefore, our study presents a novel and direct strategy that could significantly contribute to the goal of reducing carbon emissions and global sustainable development compared to traditional methods.

A review on antitumor effect of pachymic acid.

Poria cocos, also known as Jade Ling and Songbai taro, is a dry fungus core for Wolfiporia cocos, which is parasitic on the roots of pine trees. The ancients called it "medicine of four seasons" because of its extensive effect and ability to be combined with many medicines. Pachymic acid (PA) is one of the main biological compounds of Poria cocos. Research has shown that PA has various pharmacological properties, including anti-inflammatory and antioxidant. PA has recently attracted much attention due to its anticancer properties. Researchers have found that PA showed anticancer activity by regulating apoptosis and the cell cycle in vitro and in vivo. Using PA with anticancer drugs, radiotherapy, and biomaterials could also improve the sensitivity of cancer cells and delay the progression of cancer. The purpose of this review was to summarize the anticancer mechanism of PA by referencing the published documents. A review of the collected data indicated that PA had the potential to be developed into an effective anticancer agent.

In-situ construction of integrated asymmetric micro-supercapacitors achieving monolithic hundred-volt output.

Asymmetric micro-supercapacitors (MSCs) exhibit higher energy density while face significant challenges in power density as well as cycling life and large dimensions. The key factors contributing to these dilemmas include the match of electrode materials and electrolytes, poor uniformity of device, and complicated while low-precise fabrication processes. Herein we develop a laser scribing-engraving (LSE) strategy to fabricate MSCs with monolithic high-voltage output and scalable array integration. Utilizing this strategy, we induce the conversion of the majority of Ti3C2Tx-MXene into TiO2 and graphene oxide into laser-scribed graphene (LSG), yielding asymmetric MSCs with laser-induced MXene/graphene oxide as the negative electrode and MXene/graphene oxide as the positive electrode. A single asymmetric micro-supercapacitor exhibits a high voltage window of 1.8 V, delivering an outstanding energy density (240 mWh cm-3) and power density (9503 mW cm-3), coupled with excellent cycling stability. Moreover, the LSE strategy enables monolithically integrated 64 devices to achieve a high-voltage output of 115.2 V. Our approach showcases the potential for integrating micro-energy storage devices into various microsystems, increasing the practicality of asymmetric micro-supercapacitors.

Biosynthesis of the Azoxy Compound Azodyrecin from Streptomyces mirabilis P8-A2.

Azoxy compounds are a distinctive group of bioactive secondary metabolites characterized by a unique RN═N+(O-)R moiety. The azoxy moiety is present in various classes of metabolites that exhibit various biological activities. The enzymatic mechanisms underlying azoxy bond formation remain enigmatic. Azodyrecins are cytotoxic azoxy metabolites produced by Streptomyces mirabilis P8-A2. Here, we cloned and confirmed the putative azd biosynthetic gene cluster through CATCH cloning followed by expression and production of azodyrecins in two heterologous hosts, S. albidoflavus J1074 and S. coelicolor M1146, respectively. We explored the function of 14 enzymes in azodyrecin biosynthesis through gene knockout using CRISPR-Cas9 base editing in the native producer, S. mirabilis P8-A2. The key intermediates were analyzed in the mutants through MS/MS fragmentation studies, revealing azoxy bond formation via the conversion of hydrazine to an azo compound followed by further oxygenation. Enzymes involved in modifications of the precursor could be postulated based on their predicted function and the intermediates identified in the knockout strains. Moreover, the distribution of the azoxy biosynthetic gene clusters across Streptomyces spp. genomes is explored, highlighting the presence of these clusters in over 20% of the Streptomyces spp. genomes and revealing that azoxymycin and valanimycin are scarce, while azodyrecin and KA57A-like clusters are widely distributed across the phylogenetic tree.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Vertical-MXene based micro-supercapacitors with thickness-independent capacitance.

MXenes have shown great potential as an emerging two-dimensional (2D) material for micro-supercapacitors (MSCs) due to their high conductivity, rich surface chemistry, and high capacity. However, MXene sheets inherently tend to lay flat on the substrate during film formation to assemble into compact stacked structures, which hinders ion accessibility and prolongs ion transport paths, leading to highly dependent electrochemical properties on the thickness of the film. Here, we demonstrate a vertically aligned Ti3C2Tx MXene based micro-supercapacitor with an excellent electrochemical performance by a liquid nitrogen-assisted freeze-drying method. The vertical arrangement of the 2D MXene sheets allows for directional ion transport, enabling the vertical-MXene based MSCs to exhibit thickness-independent electrochemical properties even in thick films. In addition, the MSCs displayed a high areal capacitance of 87 mF cm-2 at 10 mV s-1 along with an excellent stability of ∼87.4% after 10 000 charge-discharge cycles. Furthermore, the vertical-MXene approach proposed here is scalable and can be extended to other systems involving directional transport.

Identification and heterologous expression of the globomycin biosynthetic gene cluster.

Globomycin is a cyclic lipodepsipeptide originally isolated from several Streptomyces species which displays strong and selective antibacterial activity against Gram-negative pathogens. Its mode of action is based on the competitive inhibition of the lipoprotein signal peptidase II (LspA), which is absent in eukaryotes and considered an attractive target for the development of new antibiotics. Despite its interesting biological properties, the gene cluster encoding its biosynthesis has not yet been identified. In this study we employed a genome-mining approach in the globomycin-producing Streptomyces sp. CA-278952 to identify a candidate gene cluster responsible for its biosynthesis. A null mutant was constructed using CRISPR base editing where production was abolished, strongly suggesting its involvement in the biosynthesis. The putative gene cluster was then cloned and heterologously expressed in Streptomyces albus J1074 and Streptomyces coelicolor M1146, therefore unambiguously linking globomycin and its biosynthetic gene cluster. Our work paves the way for the biosynthesis of new globomycin derivatives with improved pharmacological properties.

Identification and mechanistic analysis of a bifunctional enzyme involved in the C-N and N-N bond formation.

N-N bonded compounds are a relatively small but valuable group of natural products with a variety of important biological activities, including anti-inflammatory, anti-tumor, anti-bacterial and anti-oxidant activities. Currently, the synthesis of natural products containing N-N bonds is mainly based on chemical synthesis, but the chemical synthesis of N-N bonds may have safety issues and raw material sustainability problems. A variety of N-N bond biosynthetic mechanisms exist in nature, including comproportionation, rearrangement, and radical recombination reactions, which provide ideas for the biosynthesis of many N-N bond compounds. But at this stage, only a few N-N bond synthases have been reported, and difficulties exist in the biosynthesis of N-N bond-containing compounds. The new N-N-bond synthase PAI2, which was found to catalyze the synthesis of piperazinic acid, expands the family of N-N-bond synthases and provides better catalytic activity and different enzymatic properties for the substrate L-N5-hydroxyornithine than the known enzyme KtzT derived from the piperazinic acid biosynthetic gene cluster of Kutzneria sp. 744. Moreover, PAI2 was found to have the ability to catalyze the formation of C-N bonds in Pro.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Association between ACAT1 rs1044925 and increased hypertension risk in Tongdao Dong.

Hypertension is a multifactorial disease that partially caused by genetic factors, including variation in genes related to lipid metabolism. ACAT1 gene is implicated in lipid metabolism for its encoding product, the enzyme acetyl-CoA acetyltransferase 1, catalyzing the synthesis of cholesteryl ester from cholesterol and playing an important role in the metabolism of cholesterol. Until now, there's little study on the relationship between ACAT1 variants and hypertension. Here, we report a link between ACAT1 rs1044925 and hypertension in Tongdao Dong population. Polymerase chain reaction-restriction fragment length polymorphism was used to detect the genotypes of the ACAT1 SNP rs1044925 in a total of 637 subjects, including 406 hypertensive patients and 231 normotensive controls. The genotypic and allelic frequencies of rs1044925 were significantly different between the normotensive and hypertensive subjects (P = .001). AC/CC genotypes of rs1044925 were associated with an increased risk of hypertension (AC/CC vs AA: adjusted odds ratio = 1.723, 95% confidence interval = 1.160-2.559, P = .007). However, the AC/CC genotypes showed no relationship with serum lipid levels. The results suggest that the C carriers of ACAT1 rs1044925 might increase the risk of hypertension in Tongdao Dong population, and the underlying mechanism needs to be further studied.

Inhibition of miR-144-3p exacerbates non-small cell lung cancer progression by targeting CEP55.

Increasing evidence has indicated that microRNA dysregulation is closely related to the occurrence and development of cancers. Herein, we investigated the relationship between miR-144-3p and CEP55 expression. We then evaluated the association between miR-144-3p and CEP55 expression and proliferation, invasion and apoptosis of non-small cell lung cancer (NSCLC) cells. Real-time quantitative PCR results revealed that CEP55 was over-expressed whereas miR-144-3p was under-expressed in NSCLC tissues. CCK-8 assay, wound healing assay, and flow cytometry further revealed that overexpression of miR-144-3p significantly inhibited proliferation and migration, but promoted apoptosis of A549 cells. Conversely, inhibition of miR-144-3p promoted proliferation and migration but suppressed apoptosis of H460 cells. Dual-luciferase reporter assay revealed that miR-144-3p modulated malignant properties of cancer cells by targeting CEP55. Overexpression of CEP55 partially blocked the inhibitory effect of miR-144-3p on proliferation and migration of A549 cells and induced apoptosis of A549 cells. CEP55 knockdown modulated the increase in proliferation and migration and the decrease in apoptosis of H460 cells following miR-144-3p inhibition. These findings demonstrated that miR-144-3p suppresses NSCLC development by inhibiting CEP55 expression.

Discovery and Characterization of Epemicins A and B, New 30-Membered Macrolides from Kutzneria sp. CA-103260.

Actinobacteria have been a rich source of novel, structurally complex natural products for many decades. Although the largest genus is Streptomyces, from which the majority of antibiotics in current and past clinical use were originally isolated, other less common genera also have the potential to produce a wealth of novel secondary metabolites. One example is the Kutzneria genus, which currently contains only five reported species. One of these species is Kutzneria albida DSM 43870T, which has 46 predicted biosynthetic gene clusters and is known to produce the macrolide antibiotic aculeximycin. Here, we report the isolation and structural characterization of two novel 30-membered glycosylated macrolides, epemicins A and B, that are structurally related to aculeximycin, from a rare Kutzneria sp. The absolute configuration for all chiral centers in the two compounds is proposed based on extensive 1D and 2D NMR studies and bioinformatics analysis of the gene cluster. Through heterologous expression and genetic inactivation, we have confirmed the link between the biosynthetic gene cluster and the new molecules. These findings show the potential of rare Actinobacteria to produce new, structurally diverse metabolites. Furthermore, the gene inactivation represents the first published report to genetically manipulate a representative of the Kutzneria genus.

Chain-Elongated Ionic Liquid Electrolytes for Low Self-Discharge All-Solid-State Supercapacitors at High Temperature.

High power and good stability enable supercapacitors to work efficiently at high temperatures. However, the high-temperature-induced excessive ion transfer of the electrolyte would lead to severe self-discharge behavior, which has often been overlooked but can be highly detrimental. In this study, solid electrolytes consisting of poly(ethylene oxide) (PEO), bentonite clay, and ionic liquids (IL)-PEO-clay@[EMIM][BF4 ] (PCE), PEO-clay@[BMIM][BF4 ] (PCB), and PEO-clay@[HMIM][BF4 ] (PCH) lead to dramatic decreases in self-discharge when used in all-solid-state supercapacitors at high temperature of 70 °C, which correlate with chain elongation (i. e., [EMIM+ ]<[BMIM+ ]<[HMIM+ ]). Benefiting from both cation adsorption and high-temperature stabilization by bentonite clay, PCH-based supercapacitors (IL=[HMIM][BF4 ]) deliver an extremely low self-discharge rate, with only a 30.7 % voltage drop over 10 h at 70 °C (44.5 % for 38 h), which is much lower than that of traditional liquid supercapacitors (63.7 % drop over 10 h at 70 °C). This improvement in high-temperature self-discharge behavior is found to be from the decrease in diffusion-controlled faradaic process. Based on the longer-chain [HMIM+ ], soft-packaged supercapacitors exhibit a low self-discharge rate and work consistently at 70 °C. This chain-elongation strategy provides a new possibility for the suppression of self-discharge behavior in supercapacitors and further aids long-term energy storage by supercapacitors at high temperatures.

[Age-related differences in the management and outcome of acute coronary syndrome under the chest pain center model: a multicenter retrospective study].

OBJECTIVE: To assess the age-related differences in the management strategies and outcomes of patients with acute coronary syndrome (ACS) under the chest pain center model. METHODS: Clinical data of 2 833 patients with ACS were enrolled in the retrospective observational registry between January 2017 and June 2019 at 11 hospitals with chest pain centers in Chengdu. The patients were divided into four groups according to their ages: < 55 years old group (n = 569), 55-64 years old group (n = 556), 65-74 years old group (n = 804), ≥ 75 years old group (n = 904). The collected data included the patients' demographic characteristics, cardiovascular risk factors, medical history, symptoms and signs of onset, experimental examination, types of ACS and the time from the symptom to the hospital (S-to-D), etc., and the clinical characteristics, management strategies, all-cause mortality in the hospital, and the incidence of major adverse cardiovascular and cerebrovascular events (MACCE) within 1 year after discharge were compared. The primary end point was the clinical outcome of ACS patients in different age groups, including all-cause deaths in the hospital and the incidence of MACCE within 1 year after discharge. The secondary end point was the proportion of ACS patients underwent percutaneous coronary intervention (PCI) in different age groups. Multivariate Logistic regression was used to analyze the risk factors of all-cause deaths in ACS patients. Kaplan-Meier curve was used to express the incidence of MACCE within 1 year after discharge in different age groups. Multivariate Cox regression was used to analyze the factors affecting the incidence of MACCE within 1 year after discharge of ACS patients. RESULTS: As age increased, the proportion of male patients gradually decreased, and the percentages of male patients aged < 55 years old, 55-64 years old, 65-74 years old, and ≥ 75 years old were 87.2% (496/569), 77.0% (428/556), 66.4% (534/804), and 60.1% (543/904), respectively; and ACS patients combined with hypertension, diabetes, coronary heart disease, and stroke history were more common [the percentages of patients with hypertension aged < 55 years old, 55-64 years old, 65-74 years old, ≥ 75 years old were 41.3% (235/569), 52.2% (290/556), 59.7% (480/804), and 66.9% (605/904); the percentages of diabetes were 18.6% (106/569), 25.5% (142/556), 27.0% (217/804), and 28.2% (255/904); the percentages of coronary heart disease were 10.1% (57/564), 13.9% (77/555), 17.6% (141/803), and 23.7% (213/899); the percentages of stroke were 0.7% (4/564), 4.0% (22/552), 4.5% (36/801), and 8.6% (77/894)]. But the percentages of patients with a history of active smoking, typical chest pain/chest tightness and dyslipidemia were significantly reduced [the percentages of smoking history were 60.2% (340/565), 48.0% (266/554), 33.7% (270/801), and 21.7% (195/899), typical chest pain/chest tightness were 96.9% (536/553), 96.4% (516/535), 91.8% (716/780), 90.2% (776/860); the percentages of dyslipidemia were 11.2% (63/565), 9.2% (51/553), 5.7% (46/802), and 4.9% (44/896)], the time of S-to-D was significantly prolonged [minutes: 176.0 (73.5, 557.0), 194.5 (89.3, 682.3), 221.0 (98.8, 940.5), and 270.0 (115.0, 867.0)], hemoglobin (Hb) level was significantly reduced (g/L: 145.44±17.43, 135.95±19.25, 129.75±19.03, 122.19±20.55), and the incidence of non-ST-segment elevation myocardial infarction (NSTEMI) increased significantly [18.6% (106/569), 20.5% (114/556), 26.6% (214/804), 26.5% (240/904)], and the differences were statistically significant (all P < 0.05). The proportion of Killip grade III-IV were the highest in patients aged ≥ 75 years old, 9.0% and 12.6%, respectively. Compared with the groups aged < 55 years old, 55-64 years old, and 65-74 years old, the proportion of patients aged ≥ 75 years old who underwent PCI was the lowest, and the all-cause mortality in the hospital and the incidence of 1-year MACCE of patients underwent PCI were significantly lower than those of patients underwent conservative treatment [6.0% (28/463) vs. 10.4% (45/434), 14.6% (43/294) vs. 24.3 % (55/226), both P < 0.05]. As age increased, the hospital all-cause mortality and the 1-year MACCE incidence increased (all-cause mortality rates in < 55 years old, 55-64 years old, 65-74 years old, ≥ 75 years old groups were 0.9%, 2.2%, 5.5%, 8.3%, and the 1-year MACCE incidences were 5.0%, 6.7%, 13.9%, 18.7%, both P < 0.01). The multivariate Logistic regression analysis showed that age, cardiogenic shock, ST-segment elevation myocardial infarction (STEMI), the number of vascular disease and underwent PCI were the independent risk factors of all-cause mortality [the odds ratio (OR) and 95% confidence interval (95%CI) were 1.644 (1.356-1.993), 11.794 (7.469-18.621), 2.449 (1.419-4.227), 1.334 (1.096-1.624), 0.391 (0.247-0.619), all P < 0.001]. Cox regression analysis showed that age, STEMI, the number of vascular disease and underwent PCI were independent risk factors of the occurrence of MACCE within 1 year after discharge [hazard ratio (HR) and 95%CI were 1.354 (1.205-1.521), 1.387 (1.003-1.916), 1.314 (1.155-1.495), 0.547 (0.402-0.745), all P < 0.05]. CONCLUSIONS: In the chest pain center model, compared with other age of ACS patients, the proportion of NSTEMI in elderly patients group aged ≥ 75 years old was higher, the proportion of PCI was lower, and the clinical outcome was worse. However, the prognosis of elderly patients receiving PCI treatment was better than the patients receiving conservative treatment.

Distribution of ε-Poly-l-Lysine Synthetases in Coryneform Bacteria Isolated from Cheese and Human Skin.

ε-Poly-l-lysine is a potent antimicrobial produced through fermentation of Streptomyces and used in many Asian countries as a food preservative. It is synthesized and excreted by a special nonribosomal peptide synthetase (NRPS)-like enzyme called Pls. In this study, we discovered a gene from cheese bacterium Corynebacterium variabile that showed high similarity to the Pls from Streptomyces in terms of domain architecture and gene context. By cloning it into Streptomyces coelicolor with a Streptomyces albulus Pls promoter, we confirmed that its product is indeed ε-poly-l-lysine. A comprehensive sequence analysis suggested that Pls genes are widely spread among coryneform actinobacteria isolated from cheese and human skin; 14 out of 15 Brevibacterium isolates and 10 out of 12 Corynebacterium isolates contain it in their genomes. This finding raises the possibility that ε-poly-l-lysine as a bioactive secondary metabolite might be produced and play a role in the cheese and skin ecosystems.IMPORTANCE Every year, microbial contamination causes billions of tons of food wasted and millions of cases of illness. ε-Poly-l-lysine has potent, wide-spectrum inhibitory activity and is heat stable and biodegradable. It has been approved for food preservation by an increasing number of countries. ε-Poly-l-lysine is produced from soil bacteria of the genus Streptomyces, also producers of various antibiotic drugs and toxins and not considered to be a naturally occurring food component. The frequent finding of pls in cheese and skin bacteria suggests that ε-poly-l-lysine may naturally exist in cheese and on our skin, and ε-poly-l-lysine producers are not limited to filamentous actinobacteria.

Admission hyperglycemia as an independent predictor of long-term prognosis in acute myocardial infarction patients without diabetes: A retrospective study.

AIMS/INTRODUCTION: The predictive value of admission hyperglycemia in the long-term prognosis of acute myocardial infarction patients is still controversial. We aimed to investigate this value based on the diabetes status. MATERIALS AND METHODS: We carried out a multicenter, retrospective study of 1,288 acute myocardial infarction patients enrolled in 11 hospitals between March 2014 and June 2019 in Chengdu, China. The patients were classified into those with diabetes and those without diabetes, each was further divided into: hyperglycemia and non-hyperglycemia subgroups, according to the optimal cut-off value of the blood glucose to predict all-cause mortality during follow up. The end-points were all-cause death and major adverse cardiovascular and cerebrovascular events, including all-cause death, non-fatal myocardial infarction, vessel revascularization and non-fatal stroke. RESULTS: In the follow-up period of 15 months, we observed 210 (16.3%), 6 (0.5%), 57 (4.4%) and 34 (2.6%) cases of death, non-fatal myocardial infarction, revascularization and non-fatal stroke, respectively. The optimal cut-off values of admission blood glucose for patients with diabetes and patients without diabetes to predict all-cause mortality during follow up were 14.80 and 6.77 mmol/L, respectively. We divided patients with diabetes (n = 331) into hyperglycemia (n = 92) and non-hyperglycemia (n = 239), and patients without diabetes (n = 897) into hyperglycemia (n = 425) and non-hyperglycemia (n = 472). The cumulative rates of all-cause death and major adverse cardiovascular and cerebrovascular events among the patients in each hyperglycemia group was higher than that in the corresponding non-hyperglycemia group (P < 0.001). In patients without diabetes, admission hyperglycemia was an independent predictor of all-cause mortality and major adverse cardiovascular and cerebrovascular events. CONCLUSION: Admission hyperglycemia was an independent predictor for long-term prognosis in acute myocardial infarction patients without diabetes.

Automating Cloning by Natural Transformation.

Affordable and automated cloning platforms are essential to many synthetic biology studies. However, the traditional E. coli-based cloning is a major bottleneck as it requires heat shock or electroporation implemented in the robotic workflows. To overcome this problem, we explored bacterial natural transformation for automatic DNA cloning and engineering. Recombinant plasmids are efficiently generated from Gibson or overlap extension PCR (OE-PCR) products by simply adding the DNA into Acinetobacter baylyi ADP1 cultures. No DNA purification, competence induction, or special equipment is required. Up to 10,000 colonies were obtained per microgram of DNA, while the number of false positive colonies was low. We cloned and engineered 21 biosynthetic gene clusters (BGCs) of various types, with length from 1.5 to 19 kb and GC content from 35% to 72%. One of them, a nucleoside BGC, showed antibacterial activity. Furthermore, the method was easily transferred to a low-cost benchtop robot with consistent cloning efficiency. Thus, this automatic natural transformation (ANT) cloning provides an easy, robust, and affordable platform for high throughput DNA engineering.

Comparative Study on Pretreatment Processes for Different Utilization Purposes of Switchgrass.

Switchgrass (Panicum virgatum, L., Poaceae) with the advantages of high cellulose yield, and high growth even under low input and poor soil quality, has been identified as a promising candidate for production of low-cost biofuels, papermaking, and nanocellulose. In this study, 12 chemical pretreatments on a laboratory scale were compared for different utilization purposes of switchgrass. It was found that the pretreated switchgrass with sodium hydroxide showed considerable potential for providing mixed sugars for fermentation with 11.10% of residual lignin, 53.85% of residual cellulose, and 22.06% of residual hemicellulose. The pretreatment with 2.00% (v/v) nitric acid was the best method to remove 78.37% of hemicellulose and 39.82% of lignin under a low temperature (125 °C, 30 min), which can be used in the production of nanocellulose. Besides, a completely randomized design analysis of switchgrass pretreatments provided the alternative ethanol organosolv delignification of switchgrass for the papermaking industry with a high residual cellulose of 58.56%. Finally, scanning electron microscopy (SEM), X-ray diffraction (XRD), and Fourier-transform infrared spectroscopy (FT-IR) were carried out to confirm the changes in functional groups, crystallinity, and thermal behavior of the three materials, respectively, from the optimal pretreatments.