RESUMEN
AIM: To analyze efficacy of endoscopic lithotripsy combined with drug lithotripsy as compared with drug lithotripsy for the treatment of phytobezoars. METHODS: We collected and evaluated case records of 165 patients with phytobezoars from 2014 to 2023. And we analyzed demographic and clinical characteristics, imaging features, endoscopic features, complications of phytobezoars, and compared efficacy between endoscopic lithotripsy combined with drug lithotripsy (Group A) and drug lithotripsy (sodium bicarbonate combined with proton pump inhibitor) (Group B). RESULTS: The median age of patients with phytobezoars was 67.84 ± 4.286 years old. Abdominal pain was the most common symptom and peptic ulcers (67.5%) were the most common complication. Bezoar-induced ulcers were more frequent in the gastric angle. The success rate of phytobezoars vanishing in Group A and Group B were similar (92.3% vs. 85.1% within 48 h, 98.7% vs. 97.7% within a week), while the average hospitalization period, average hospitalization cost, second endoscopy rate, and average endoscopic operation time were significantly lower in patients in Group B than in Group A. CONCLUSION: Drug lithotripsy is the preferred effective and safe treatment option for phytobezoars. We advise that an endoscopy should be completed after 48 h for drug lithotripsy.
Asunto(s)
Bezoares , Litotricia , Humanos , Bezoares/terapia , Masculino , Femenino , Litotricia/métodos , Anciano , Persona de Mediana Edad , Estudios Retrospectivos , Inhibidores de la Bomba de Protones/uso terapéutico , Inhibidores de la Bomba de Protones/administración & dosificación , Resultado del Tratamiento , Bicarbonato de Sodio/administración & dosificación , Bicarbonato de Sodio/uso terapéutico , Terapia Combinada , Dolor Abdominal/etiología , Dolor Abdominal/terapiaRESUMEN
The dynamic changes between glycolysis and oxidative phosphorylation (OXPHOS) for adenosine triphosphate (ATP) output, along with glucose, glutamine, and fatty acid utilization, etc., lead to the maintenance and selection of growth advantageous to tumor cell subgroups in an environment of iron starvation and hypoxia. Iron plays an important role in the three major biochemical reactions in nature: photosynthesis, nitrogen fixation, and oxidative respiration, which all require the participation of iron-sulfur proteins, such as ferredoxin, cytochrome b, and the complex I, II, III in the electron transport chain, respectively. Abnormal iron-sulfur cluster synthesis process or hypoxia will directly affect the function of mitochondrial electron transfer and mitochondrial OXPHOS. More research results have indicated that iron metabolism, oxygen availability and hypoxia-inducible factor mutually regulate the shift between glycolysis and OXPHOS. In this article, we make a perspective review to provide novel opinions of the regulation of glycolysis and OXPHOS in tumor cells.
RESUMEN
Periphytic algae are often used as an indicator to evaluate water quality. Here, the community structure of periphytic algae and its relationship with environment factors were analyzed in the main stream of the Songhua River during the summers of 2014 to 2019. The status and trends in ecological water quality were also evaluated based on bioassessments. Phytoplankton species belonging to 4 phyla and 58 genera were recorded, including 28 Bacillariophyta genera, 17 Chlorophyta genera, 10 Cyanophyta genera, and 3 Euglenophyta genera; Bacillariophyta, Chlorophyta, and Cyanophyta accounted for 48.28%, 29.31%, and 17.24% of the community, respectively. Cell densities varied between 1.29×104 and 8.42×104 ind·cm-3, with an average of 4.35×104 ind·cm-3. The dominant genera were Cyclotella, Melosira, Asterionella, Cymbella, Synedra, Pinnularia, Navicula, and Scenedesmus. The physicochemical water quality showed notable changes during the past six-year monitoring period. Specifically, the dissolved oxygen content increased year on year; ammonia nitrogen, total phosphorus, and total nitrogen first increased and then decreased; and, overall, water quality significantly improved in 2019. Relationship between periphytic algae and environmental factors was further examined using redundancy analysis (RDA), which showed that time was the main factor driving the succession of algal community structure. Dissolved oxygen (DO), ammonia nitrogen (NH4+-N), total nitrogen (TN), total phosphorus (TP), five-day biochemical oxygen demand (BOD), and chemical oxygen demand (COD) were also important environmental variables affecting algal community structure.
Asunto(s)
Diatomeas , Ríos , China , Monitoreo del Ambiente , Nitrógeno/análisis , Fósforo/análisis , Fitoplancton , Estaciones del Año , Calidad del AguaRESUMEN
Habitat consist of the physical, chemical, and biological features that support the survival and growth of aquatic organisms, and the maintenance of biological processes and ecological function. However, habitat is spatially and temporally heterogeneous and displays spatial autocorrelation, mean that at large spatial scales, the maintenance of ecological function is complex. Consequently, it is difficult to characterize and interpret habitat characteristics, especially over large space-time scales. Although a wide variety of habitat monitoring methods have been proposed, there is still lack of well-developed methods for long-term tracking and monitoring of habitat changes at the watershed scale. Here, the characteristics of watershed habitats and the importance of monitoring in environmental management were explored based on the concept, purpose, and significance of habitat monitoring. Several monitoring methods were summarized and compared, and the key scientific limitations and requirements of habitat monitoring (e.g., spatial scale, survey scope, characteristic parameters, data acquisition, etc.) evaluated. Based on this, key aspects for successful habitat monitoring in China are proposed as baseline information for the research and application of habitat monitoring for watershed-scale ecological space management.
Asunto(s)
Conservación de los Recursos Naturales , Ecosistema , Organismos Acuáticos , China , Monitoreo del AmbienteRESUMEN
BACKGROUND: Most small intestinal lipomas are treated surgically, and some require repeated surgeries for multiple lipomas. However, application of endoscopic submucosal dissection (ESD) technology in the deep small intestine is rarely reported owing to the special anatomical structure of the small intestine, medical equipment limitations, and the lack of relevant experience among endoscopists. CASE SUMMARY: Two patients with small intestinal lipomas treated at the Air Force Medical Center from November 2015 to September 2019 were selected to undergo balloon-assisted ESD to treat the lipomas and explore the technical feasibility and safety of ESD for treating small intestinal lipomas. The two patients successfully underwent balloon-assisted ESD to treat four small intestinal lipomas, with a complete resection rate of 100% (4/4), without intraoperative or postoperative bleeding, perforation, or other complications. After 3-6 mo of postoperative follow-up, the clinical symptoms caused by the lipomas were significantly relieved or disappeared after treatment. CONCLUSION: Balloon-assisted ESD is a safe and reliable new method for treating deep intestinal lipomas and shows good clinical feasibility.
RESUMEN
The coordination interactions between transition-metal ions (Cu2+, Ag+) and sulfur atoms on ultrathin two-dimensional (2D) nanosheets of spin-crossover (SCO) metal-organic frameworks {[Fe(1,3-bpp)2(NCS)2]2}n (1,3-bpp = 1,3-di(4-pyridyl)propane), which constructed the ultrathin 2D nanosheets into three-dimensional (3D) nanoparticles, have made a profound effect on the SCO performance. Compared with 2D nanosheets, both the intraligand π-π* transition band and the metal-to-ligand charge transition band from the d(Fe) + π(NCS) to π*(1,3-bpp), for the 3D nanoparticles, have shown dramatic blue-shifts; meanwhile, the d-d transition band for the high-spin (HS) state Fe(II) ions has been generated, suggesting significantly the influence of 3D assemble-caused dimensional changes on the solid-state SCO performance of ultrathin 2D nanosheets. More importantly, by loading on the ytterbium ion (Yb3+)-sensitized hexagonal phase upconverting nanoparticles in the aqueous colloidal suspension, the near infrared (NIR) light (980 nm) triggered HS (high spin) to LS (low spin) state transitions have been observed, demonstrating the achievement of challenging target of NIR light-triggered molecular conversion under environment conditions.
RESUMEN
BACKGROUND: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known. AIMS: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy. METHODS: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis. RESULTS: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9). CONCLUSIONS: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight.
Asunto(s)
Enteroscopia de Balón/efectos adversos , Obstrucción Intestinal/etiología , Adolescente , Adulto , Factores de Edad , Anciano , Anciano de 80 o más Años , Constricción Patológica , Femenino , Humanos , Obstrucción Intestinal/diagnóstico por imagen , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Medición de Riesgo , Factores de Riesgo , Índice de Severidad de la Enfermedad , Delgadez/complicaciones , Adulto JovenRESUMEN
For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:⢠Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.⢠BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:⢠BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old.
Asunto(s)
Enteroscopía de Doble Balón/métodos , Síndrome de Peutz-Jeghers/cirugía , Adolescente , Niño , Femenino , Humanos , Pólipos Intestinales/etiología , Intestino Delgado , Intususcepción/etiología , Masculino , Síndrome de Peutz-Jeghers/complicaciones , Estudios ProspectivosRESUMEN
By analyzing Newton's rings, often encountered in interferometry, using fractional Fourier transform (FRFT), we can estimate the physical parameters, such as the curvature radius of the spherical surface and the rings' center. However, parameter estimation from large images using FRFT consumes considerable time. We introduce an improved method that resamples the image before applying FRFT. Because Newton's rings are sparse in the FRFT domain, this method reduces the computational time without decreasing the accuracy. Experimental results show that compared to traditional FRFT-based algorithms, this method can estimate parameters in about 1.3 s when processing 1920×1080 pixel images.
RESUMEN
BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.
Asunto(s)
Síndrome de Peutz-Jeghers/diagnóstico por imagen , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinasas/genética , Quinasas de la Proteína-Quinasa Activada por el AMP , Niño , Endoscopía Gastrointestinal , Humanos , Masculino , Mutación , Síndrome de Peutz-Jeghers/cirugía , Espera VigilanteRESUMEN
BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.
Asunto(s)
Mutación/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinasas/genética , Transducción de Señal/genética , Proteína p53 Supresora de Tumor/genética , Quinasas de la Proteína-Quinasa Activada por el AMP , Adolescente , Adulto , Niño , Femenino , Humanos , Masculino , Persona de Mediana Edad , Fenotipo , Adulto JovenRESUMEN
AIMS: To investigate the pharmacokinetics and pharmacodynamics of a dual-acting glucokinase activator, dorzagliatin, and its safety, tolerability and effect on pancreatic ß-cell function in Chinese patients with type 2 diabetes (T2D). MATERIALS AND METHODS: A total of 24 T2D patients were selected, utilizing a set of predefined clinical biomarkers, and were randomized to receive dorzagliatin 75 mg twice or once daily (BID, QD respectively) for 28 days. Changes in HbA1c and glycaemic parameters from baseline to Day 28 were assessed. In addition, changes in ß-cell function from baseline to Day 32 were evaluated. RESULTS: Significant reductions in HbA1c were observed in both regimens on Day 28 (-0.79%, 75 mg BID; -1.22%, 75 mg QD). Similar trends were found in the following parameters, including reductions from baseline in fasting plasma glucose by 1.20 mmol/L and 1.51 mmol/L, in 2-hour postprandial glucose by 2.48 mmol/L and 5.03 mmol/L, and in glucose AUC0-24 by 18.59% and 20.98%, for the BID and QD groups, respectively. Both regimens resulted in improvement in ß-cell function as measured by steady state HOMA 2 parameter, %B, which increased by 36.31% and 40.59%, and by dynamic state parameter, ΔC30 /ΔG30 , which increased by 24.66% and 167.67%, for the BID and QD groups, respectively. Dorzagliatin was well tolerated in both regimens, with good pharmacokinetic profiles. CONCLUSIONS: Dorzagliatin treatment for 28 days in Chinese T2D patients, selected according to predefined biomarkers, resulted in significant improvement in ß-cell function and glycaemic control. The safety and pharmacokinetic profile of dorzagliatin supports a subsequent Phase II trial design and continued clinical development.
Asunto(s)
Diabetes Mellitus Tipo 2/tratamiento farmacológico , Activadores de Enzimas/uso terapéutico , Glucoquinasa/metabolismo , Hipoglucemiantes/uso terapéutico , Selección de Paciente , Pirazoles/farmacología , Biomarcadores/sangre , Glucemia/análisis , Diabetes Mellitus Tipo 2/sangre , Femenino , Hemoglobina Glucada/análisis , Humanos , Células Secretoras de Insulina/efectos de los fármacos , Masculino , Persona de Mediana Edad , Pirazoles/uso terapéutico , Resultado del TratamientoRESUMEN
BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.
Asunto(s)
Síndrome de Peutz-Jeghers/genética , Pólipos , Proteínas Serina-Treonina Quinasas/genética , Quinasas de la Proteína-Quinasa Activada por el AMP , Pueblo Asiatico , Niño , Femenino , Heterocigoto , Humanos , Intususcepción/complicaciones , Mutación , Síndrome de Peutz-Jeghers/complicacionesRESUMEN
The magnetic and electrical properties of complex oxide thin films are closely related to the phase stability and cation ordering, which demands that we understand the process-structure-property relationships microscopically in functional materials research. Here we study multiferroic thin films of double-perovskite La2NiMnO6 epitaxially grown on SrTiO3, KTaO3, LaAlO3 and DyScO3 substrates by pulsed laser deposition. The effect of epitaxial strains imposed by the substrate on the microstructural properties of La2NiMnO6 has been systematically investigated by means of advanced electron microscopy. It is found that La2NiMnO6 films under tensile strain exhibit a monoclinic structure, while under compressive strain the crystal structure of La2NiMnO6 films is rhombohedral. In addition, by optimizing the film deposition conditions a long-range ordering of B-site cations in La2NiMnO6 films has been obtained in both monoclinic and rhombohedral phases. Our results not only provide a strategy for tailoring phase stability by strain engineering, but also shed light on tuning B-site ordering by controlling film growth temperature in double-perovskite La2NiMnO6 films.
RESUMEN
RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.
Asunto(s)
Mutación de Línea Germinal , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinasas/genética , Quinasas de la Proteína-Quinasa Activada por el AMP , Pueblo Asiatico , Preescolar , Femenino , HumanosRESUMEN
BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.
Asunto(s)
Pueblo Asiatico/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinasas/genética , Quinasas de la Proteína-Quinasa Activada por el AMP , Secuencia de Aminoácidos , China , Exones , Mutación del Sistema de Lectura , Mutación de Línea Germinal , Humanos , Masculino , Persona de Mediana Edad , Neoplasias/diagnóstico , Linaje , Síndrome de Peutz-Jeghers/diagnóstico , Conformación Proteica , Factores de Riesgo , Análisis de Secuencia de ADNRESUMEN
BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
Asunto(s)
Biomarcadores de Tumor/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinasas/genética , Eliminación de Secuencia , Quinasas de la Proteína-Quinasa Activada por el AMP , Adulto , Pueblo Asiatico/genética , Secuencia de Bases , Biomarcadores de Tumor/química , Biomarcadores de Tumor/metabolismo , China , Análisis Mutacional de ADN , Exones , Femenino , Predisposición Genética a la Enfermedad , Herencia , Heterocigoto , Humanos , Modelos Moleculares , Linaje , Síndrome de Peutz-Jeghers/diagnóstico , Síndrome de Peutz-Jeghers/enzimología , Síndrome de Peutz-Jeghers/etnología , Fenotipo , Conformación Proteica , Proteínas Serina-Treonina Quinasas/química , Proteínas Serina-Treonina Quinasas/metabolismo , Relación Estructura-ActividadRESUMEN
Peutz-Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz-Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz-Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21-67). The relative risk for cancer in Peutz-Jeghers syndrome patients was 63.858 (confidence interval: 47.514-85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz-Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417-366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas ( p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found ( p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.
Asunto(s)
Neoplasias Colorrectales/epidemiología , Neoplasias Colorrectales/patología , Síndrome de Peutz-Jeghers/epidemiología , Síndrome de Peutz-Jeghers/patología , Adulto , Anciano , China , Neoplasias Colorrectales/complicaciones , Bases de Datos Genéticas , Femenino , Humanos , Masculino , Persona de Mediana Edad , Síndrome de Peutz-Jeghers/complicaciones , Estudios Retrospectivos , Factores de RiesgoRESUMEN
Small intestinal obstruction is a common complication of primary gastrointestinal cancer or metastatic cancers. Patients with this condition are often poor candidates for surgical bypasses, and placement of self-expanding metal stent (SEMS) can be technically challenging. In this study, we examined the feasibility of combined application of single-balloon enteroscope (SBE) and colonoscope for SEMS placement in patients with malignant small intestinal obstruction. Thirty-four patients were enrolled in this study, among which 22 patients received SEMS placement by using SBE and colonoscope, while the other 12 patients received conservative medical treatment. The patients were followed up for one year. Stent placement was technically feasible in 95.5% (21/22). Clinical improvement was achieved in 86.4% (19/22). For the 19 clinical success cases, the average time of benefits from a gastric outlet obstruction scoring system (GOOSS) increase ≥1 was 111.9±89.5 days. For the 12 patients receiving conservative medical treatment, no significant improvement in GOOSS score was observed. Moreover, a significant increase of Short-Form-36 health survey score was observed in the 19 patients at time of 30 days after stent placement. By Kaplan-Meier analysis, a significant survival improvement was observed in patients with successful SEMS placement, compared with patients receiving conservative medical treatment. Taken together, combined use of SBE and colonoscope makes endoscopic stent placement feasible in patients with malignant small intestinal obstruction, and patients can benefit from it in terms of prolonged survival and improved quality of life.
Asunto(s)
Colonoscopía/métodos , Obstrucción de la Salida Gástrica/cirugía , Neoplasias Gastrointestinales/cirugía , Obstrucción Intestinal/cirugía , Stents Metálicos Autoexpandibles , Enteroscopia de Balón Individual/métodos , Anciano , Colonoscopía/instrumentación , Femenino , Obstrucción de la Salida Gástrica/mortalidad , Obstrucción de la Salida Gástrica/patología , Obstrucción de la Salida Gástrica/terapia , Neoplasias Gastrointestinales/mortalidad , Neoplasias Gastrointestinales/patología , Neoplasias Gastrointestinales/terapia , Humanos , Obstrucción Intestinal/mortalidad , Obstrucción Intestinal/patología , Obstrucción Intestinal/terapia , Intestino Delgado/patología , Intestino Delgado/cirugía , Masculino , Persona de Mediana Edad , Cuidados Paliativos/métodos , Calidad de Vida/psicología , Enteroscopia de Balón Individual/instrumentación , Análisis de SupervivenciaRESUMEN
Small intestinal obstruction is a common complication of primary gastrointestinal cancer or metastatic cancers.Patients with this condition are often poor candidates for surgical bypasses,and placement of self-expanding metal stent (SEMS) can be technically challenging.In this study,we examined the feasibility of combined application of single-balloon enteroscope (SBE) and colonoscope for SEMS placement in patients with malignant small intestinal obstruction.Thirty-four patients were enrolled in this study,among which 22 patients received SEMS placement by using SBE and colonoscope,while the other 12 patients received conservative medical treatment.The patients were followed up for one year.Stent placernent was technically feasible in 95.5% (21/22).Clinical improvement was achieved in 86.4% (19/22).For the 19 clinical success cases,the average time of benefits from a gastric outlet obstruction scoring system (GOOSS) increase ≥1 was 111.9±89.5 days.For the 12 patients receiving conservative medical treatment,no significant improvement in GOOSS score was observed.Moreover,a significant increase of Short-Form-36 health survey score was observed in the 19 patients at time of 30 days after stent placement.By Kaplan-Meier analysis,a significant survival improvement was observed in patients with successful SEMS placement,compared with patients receiving conservative medical treatment.Taken together,combined use of SBE and colonoscope makes endoscopic stent placement feasible in patients with malignant small intestinal obstruction,and patients can benefit from it in terms of prolonged survival and improved quality of life.