RESUMEN
We studied whether cannabinoid CB(1) receptors occur on the sympathetic neurones innervating the guinea-pig atrium and renal cortex. Atrial and cortical kidney pieces preincubated with [(3)H]-noradrenaline were superfused and the electrically (3 Hz)-evoked tritium overflow was examined. The evoked overflow in atrium was inhibited by the cannabinoid agonist WIN 55,212-2 maximally by 35%; its concentration-response curve was shifted to the right by the CB(1) antagonist rimonabant (pA(2) 8.3), which, by itself, did not affect the evoked overflow. The evoked overflow in the renal cortex was not altered by WIN 55,212-2. The muscarinic agonist oxotremorine and prostaglandin E(2) inhibited the evoked overflow maximally by 55 and 65% in atrium and by 80 and 55% in kidney, respectively. Furthermore, the nucleotide sequence of the guinea-pig CB(1) receptor was determined (GenBank DQ355990). The deduced amino acid sequence has a high homology to the corresponding sequence of man (98.7%) and rat or mouse (99.2%). In conclusion, presynaptic CB(1) receptors leading to inhibition of noradrenaline release occur in guinea-pig atrium but not renal cortex. The deduced amino acid sequence of the guinea-pig CB(1) receptor shows a homology of 99% to the CB(1) receptor sequence of rodents and humans.
Asunto(s)
Secuencia de Aminoácidos , Norepinefrina/metabolismo , Receptor Cannabinoide CB1/metabolismo , Animales , Estimulación Eléctrica , Cobayas , Atrios Cardíacos/metabolismo , Corteza Renal/metabolismo , Masculino , Datos de Secuencia Molecular , Neuronas/metabolismo , Análisis de Secuencia de Proteína , Especificidad de la Especie , Sistema Nervioso Simpático/metabolismoRESUMEN
Presynaptic receptors for four families of neuropeptides will be discussed: opioids, neuropeptide Y, adrenocorticotropic hormone (ACTH), and orexins. Presynaptic receptors for the opioids (micro, delta, kappa, and ORL(1)) and neuropeptide Y (Y(2)) inhibit transmitter release from a variety of neurones, both in the peripheral and central nervous systems. These receptors, which were also identified in human tissue, are coupled to G(i/o) proteins and block voltage-dependent Ca(2+) channels, activate voltage-dependent K(+) channels, and/or interfere with the vesicle release machinery. Presynaptic receptors for ACTH (MC(2) receptors) have so far been identified almost exclusively in cardiovascular tissues from rabbits, where they facilitate noradrenaline release; they are coupled to G(s) protein and act via stimulation of adenylyl cyclase. Presynaptic receptors for orexins (most probably OX(2) receptors) have so far almost exclusively been identified in the rat and mouse brain, where they facilitate the release of glutamate and gamma-aminobutyric acid (GABA); they are most probably linked to G(q) and directly activate the vesicle release machinery or act via a transduction mechanism upstream of the release process. Agonists and antagonists at opioid receptors owe at least part of their therapeutic effects to actions on presynaptic receptors. Therapeutic drugs targeting neuropeptide Y and orexin receptors and presynaptic ACTH receptors so far are not available.
Asunto(s)
Neuropéptidos/metabolismo , Receptores de Neuropéptido/metabolismo , Receptores Presinapticos/metabolismo , Animales , Humanos , Receptores de Orexina , Receptores de Corticotropina/efectos de los fármacos , Receptores de Corticotropina/metabolismo , Receptores Acoplados a Proteínas G/efectos de los fármacos , Receptores Acoplados a Proteínas G/metabolismo , Receptores de Neuropéptido/efectos de los fármacos , Receptores de Neuropéptido Y/efectos de los fármacos , Receptores de Neuropéptido Y/metabolismo , Receptores Opioides/efectos de los fármacos , Receptores Opioides/metabolismo , Receptores Presinapticos/efectos de los fármacosRESUMEN
Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 microM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 microM WIN 55,212-2 on the evoked overflow from the guinea-pig aorta was comparable in size to that obtained with agonists at the histamine H3, kappa opioid (KOP) and ORL1 (NOP) receptor (1 or 10 microM, producing the respective near-maximum effects) whereas prostaglandin E2 1 microM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guinea-pig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guinea-pig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2.
Asunto(s)
Fibras Adrenérgicas/metabolismo , Norepinefrina/metabolismo , Terminales Presinápticos/metabolismo , Receptor Cannabinoide CB1/metabolismo , Fibras Adrenérgicas/efectos de los fármacos , Animales , Aorta , Benzoxazinas , Dinoprostona/farmacología , Relación Dosis-Respuesta a Droga , Estimulación Eléctrica , Cobayas , Técnicas In Vitro , Masculino , Ratones , Morfolinas/farmacología , Naftalenos/farmacología , Piperidinas/farmacología , Terminales Presinápticos/efectos de los fármacos , Pirazoles/farmacología , Ratas , Ratas Wistar , Receptor Cannabinoide CB1/efectos de los fármacos , Rimonabant , Especificidad de la Especie , TritioRESUMEN
1. We determined the effects of nociceptin/orphanin FQ and the NOP receptor ligands acetyl-Arg-Tyr-Tyr-Arg-Ile-Lys-NH(2) (Ac-RYYRIK-NH(2)) and naloxone benzoylhydrazone on transmitter release in vitro. 2. The electrically evoked tritium overflow from guinea-pig and mouse striatal slices and guinea-pig retinal discs preincubated with [(3)H]-dopamine was inhibited by nociceptin/orphanin FQ (pEC(50) 7.9, 7.6 and 8.6; E(max) 30, 50 and 55%). Ac-RYYRIK-NH(2) 0.032 microM and naloxone benzoylhydrazone 5 microM antagonized the effect of nociceptin/orphanin FQ in striatal slices of the guinea-pig (apparent pA(2) 9.1 and 6.8) and the mouse (apparent pA(2) 9.2 and 7.5) and strongly attenuated the effect of nociceptin/orphanin FQ 0.1 microM in guinea-pig retinal discs. Ac-RYYRIK-NH(2) 0.032 microM did not affect the evoked overflow by itself whereas naloxone benzoylhydrazone 5 microM inhibited it in each tissue. 3. The electrically evoked tritium overflow from mouse brain cortex slices preincubated with [(3)H]-noradrenaline was inhibited by nociceptin/orphanin FQ (pEC(50) 7.9, E(max) 85%), Ac-RYYRIK-NH(2) (pEC(50) 8.3, E(max) 47%) but not affected by naloxone benzoylhydrazone 5 microM. Ac-RYYRIK-NH(2) and naloxone benzoylhydrazone showed apparent pA(2) values of 8.6 and 6.9. 4. In conclusion, the inhibitory effect of nociceptin/orphanin FQ on dopamine release in the striatum and retina and on noradrenaline release in the cerebral cortex is mediated via NOP receptors. Ac-RYYRIK-NH(2) behaves as an extremely potent NOP receptor antagonist in the striatum and retina and as a partial agonist in the cortex.
Asunto(s)
Cuerpo Estriado/metabolismo , Dopamina/metabolismo , Péptidos Opioides/metabolismo , Receptores Opioides/fisiología , Retina/metabolismo , Animales , Cuerpo Estriado/efectos de los fármacos , Antagonistas de Dopamina/metabolismo , Antagonistas de Dopamina/farmacología , Cobayas , Técnicas In Vitro , Masculino , Ratones , Péptidos Opioides/farmacología , Receptores Opioides/agonistas , Retina/efectos de los fármacos , Receptor de Nociceptina , NociceptinaRESUMEN
Cannabis (marijuana) is not only a frequently abused drug but also has the potential for the development of useful agents for the treatment of emesis, anorexia and multiple sclerosis. In this article, the effects of modulation of transmitter release by cannabinoids in both the CNS and the PNS of various species, including humans, will be discussed. Cannabinoids inhibit neurotransmitter release via specific presynaptic cannabinoid CB1 receptors. Studies using either the CB1 receptor antagonist and inverse agonist SR141716 or CB1-receptor-deficient mice suggest that numerous presynaptic cannabinoid receptors are tonically activated by endogenous cannabinoids and/or are constitutively active. CB1-receptor-mediated inhibition of transmitter release might explain, for example, reinforcing properties and memory impairment caused by cannabinoids.
Asunto(s)
Cannabinoides/farmacología , Neurotransmisores/metabolismo , Receptores de Droga/metabolismo , Receptores Presinapticos/metabolismo , Animales , Humanos , Receptores de Cannabinoides , Receptores de Droga/efectos de los fármacos , Receptores Presinapticos/efectos de los fármacosRESUMEN
We determined the affinities of eight novel histamine H(3)-receptor ligands (ethers and carbamates) for H(3)-receptor binding sites and their agonistic/antagonistic effects in two functional H(3)-receptor models. The compounds differ from histamine in that the ethylamine chain is replaced by a propyloxy chain; in the three ethers mentioned below (FUB 335, 373 and 407), R is n-pentyl, 3-methylbutyl and 3,3-dimethylbutyl, respectively. The compounds monophasically inhibited [(3)H]-N(alpha)-methylhistamine binding to mouse cerebral cortex membranes (pK(i) 7.51 - 9.53). The concentration-response curve of histamine for its inhibitory effect on the electrically evoked [(3)H]-noradrenaline overflow from mouse cortex slices was shifted to the right by these compounds (apparent pA(2) 6.61 - 8.00). Only FUB 373 and 407 inhibited the evoked overflow by themselves (intrinsic activities 0.3 and 0.4); these effects were counteracted by the H(3)-receptor antagonist clobenpropit. [(35)S]-GTPgammaS binding to mouse cortex membranes was stimulated by the H(3)-receptor agonist (R)-alpha-methylhistamine in a manner sensitive to clobenpropit. Among the novel compounds only FUB 373 and 407 stimulated [(35)S]-GTPgammaS binding (intrinsic activities 0.6 and 0.4). In conclusion, the novel compounds are partial H(3)-receptor agonists (FUB 373 and 407) or H(3)-receptor antagonists; comparison with FUB 335 shows that the transition from antagonist to agonist is caused by a slight structural change. A protonated N atom in the side chain is not necessary for agonism at H(3) receptors, proposing a receptor-ligand interaction different from that of classical agonists.
Asunto(s)
Agonistas de los Receptores Histamínicos/farmacología , Antagonistas de los Receptores Histamínicos/farmacología , Receptores Histamínicos H3/efectos de los fármacos , Aminas/química , Animales , Química Encefálica/efectos de los fármacos , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Estimulación Eléctrica , Guanosina 5'-O-(3-Tiotrifosfato)/metabolismo , Histamina/farmacología , Agonistas de los Receptores Histamínicos/química , Técnicas In Vitro , Metilhistaminas/farmacología , Ratones , Norepinefrina/metabolismo , Perfusión , Ratas , Ratas WistarRESUMEN
We examined whether acetylcholine release in the hippocampus and striatum and noradrenaline release in the hippocampus is altered in CB(1) receptor-deficient mice. The electrically evoked tritium overflow from hippocampal slices preincubated with [(3)H]-choline was increased by about 100% in CB(1)(-/-) compared to CB(1)(+/+) mice whereas the electrically evoked tritium overflow from striatal slices preincubated with [(3)H]-choline and from hippocampal slices preincubated with [(3)H]-noradrenaline did not differ. The cannabinoid receptor agonist, WIN 55,212-2, inhibited, and the CB(1) receptor antagonist, SR 141716, facilitated, the evoked tritium overflow from hippocampal slices (preincubated with [(3)H]-choline) from CB(1)(+/+) as opposed to CB(1)(-/-) mice. Both drugs did not affect the evoked tritium overflow from striatal slices (preincubated with [(3)H]-choline) and from hippocampal slices (preincubated with [(3)H]-noradrenaline) from CB(1)(+/+) and CB(1)(-/-) mice. The selective increase in acetylcholine release in CB(1)(-/-) mice may indicate that the presynaptic CB(1) receptors on the cholinergic neurones of the mouse hippocampus are tonically activated and/or constitutively active in vivo.
Asunto(s)
Acetilcolina/metabolismo , Hipocampo/metabolismo , Receptores de Droga/metabolismo , Animales , Benzoxazinas , Bloqueadores de los Canales de Calcio/farmacología , Cuerpo Estriado/efectos de los fármacos , Cuerpo Estriado/metabolismo , Estimulación Eléctrica , Hipocampo/efectos de los fármacos , Ratones , Ratones Endogámicos C57BL , Morfolinas/farmacología , Naftalenos/farmacología , Norepinefrina/metabolismo , Piperidinas/farmacología , Pirazoles/farmacología , Receptores de Cannabinoides , Receptores de Droga/deficiencia , Rimonabant , TritioRESUMEN
Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and <5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.
Asunto(s)
Acetilcolina/metabolismo , Encéfalo/metabolismo , Receptores de Droga/fisiología , Animales , Benzoxazinas , Encéfalo/efectos de los fármacos , Calcio/farmacología , Colina/metabolismo , Ciclohexanoles/farmacología , Relación Dosis-Respuesta a Droga , Estimulación Eléctrica , Hipocampo/efectos de los fármacos , Hipocampo/metabolismo , Técnicas In Vitro , Masculino , Ratones , Ratones Endogámicos C57BL , Ratones Endogámicos , Morfolinas/farmacología , Naftalenos/farmacología , Oxotremorina/farmacología , Piperidinas/farmacología , Pirazoles/farmacología , Ratas , Ratas Sprague-Dawley , Receptores de Cannabinoides , Receptores de Droga/agonistas , Receptores de Droga/antagonistas & inhibidores , Rimonabant , TritioRESUMEN
The hypoxia-inducible factor (HIF-1alpha), a basic helix-loop-helix transcription factor, is known to heterodimerize with ARNT1, a nuclear translocator, to trigger the overexpression in many cells of genes involved in resistance to hypoxia. Although HIF-1alpha and ARNT1 are both expressed in brain, their cellular localization and function therein are unknown. Here, using in situ hybridization and immunocytochemistry, we show that HIF-1alpha is expressed in normoxic cerebral neurons together with not only ARNT1 but also ARNT2, a cerebral translocator homologous to ARNT1 but displaying, unlike ARNT1, a selective neuronal expression. In contrast, other potential partners of the translocators, i.e. the aryl hydrocarbon receptor (AHR) and the single-minded protein 2 (SIM2), are not expressed in the adult brain. We also identify two splice variants of HIF-1alpha in brain, one of which dimerizes with ARNT2 even more avidly than with ARNT1. The resulting heterodimer, in contrast with the HIF-1alpha/ARNT1 complex, does not recognize the HIF-1-binding site of the hypoxia-induced erythropoietin (Epo) gene, suggesting that it controls transcription of a distinct set of genes. We therefore propose that HIF-1alpha and ARNT2 function as preferential dimerization partners in neurons to control specific responses, some of which may not be triggered by hypoxia. In support of this proposal, in nonhypoxic PC12 cells constitutively coexpressing HIF-1alpha, ARNT1 and ARNT2, downregulation of either HIF-1alpha or ARNT2, obtained with selective antisense nucleotides, resulted in inhibition of [3H]thymidine incorporation.
Asunto(s)
Empalme Alternativo/fisiología , Proteínas de Unión al ADN/metabolismo , Hipoxia/genética , Neuronas/metabolismo , Proteínas Nucleares/metabolismo , Receptores de Hidrocarburo de Aril , Factores de Transcripción/metabolismo , Factores de Edad , Animales , Translocador Nuclear del Receptor de Aril Hidrocarburo , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico , Encéfalo/embriología , Encéfalo/metabolismo , Encéfalo/fisiopatología , Clonación Molecular , Proteínas de Unión al ADN/genética , Dimerización , Regulación de la Expresión Génica/fisiología , Hipoxia/metabolismo , Hipoxia/fisiopatología , Factor 1 Inducible por Hipoxia , Subunidad alfa del Factor 1 Inducible por Hipoxia , Neuronas/citología , Proteínas Nucleares/genética , Oligonucleótidos Antisentido/farmacología , Células PC12/metabolismo , Isoformas de Proteínas/genética , Ratas , Ratas Wistar , Transactivadores/genética , Transactivadores/metabolismo , Factores de Transcripción/genéticaRESUMEN
In segments of rat vena cava preincubated with [(3)H]-noradrenaline and superfused with physiological salt solution, the influence of agmatine on the electrically evoked [(3)H]-noradrenaline release, the EP(3) prostaglandin receptor-mediated and the alpha(2D)-adrenoceptor-mediated inhibition of evoked [(3)H]-noradrenaline release was investigated. Agmatine (0.1-10 microM) by itself was without effect on evoked [(3)H]-noradrenaline release. In the presence of 10 microM agmatine, the prostaglandin E(2)(PGE(2))-induced EP(3)-receptor-mediated inhibition of [(3)H]-noradrenaline release was not modified, whereas the alpha(2D)-adrenoceptor-mediated inhibition of [(3)H]-noradrenaline release induced by noradrenaline, moxonidine or clonidine was more pronounced than in the absence of agmatine. However, 1 mM agmatine antagonized the moxonidine-induced inhibition of [(3)H]-noradrenaline release. Agmatine concentration-dependently inhibited the binding of [(3)H]-clonidine and [(3)H]-rauwolscine to rat brain cortex membranes (K(i) values 6 microM and 12 microM, respectively). In addition, 30 and 100 microM agmatine increased the rate of association and decreased the rate of dissociation of [(3)H]-clonidine resulting in an increased affinity of the radioligand for the alpha(2D)-adrenoceptors. [(14)C]-agmatine labelled specific binding sites on rat brain cortex membranes. In competition experiments. [(14)C]-agmatine was inhibited from binding to its specific recognition sites by unlabelled agmatine, but not by rauwolscine and moxonidine. In conclusion, the present data indicate that agmatine both acts as an antagonist at the ligand recognition site of the alpha(2D)-adrenoceptor and enhances the effects of alpha(2)-adrenoceptor agonists probably by binding to an allosteric binding site of the alpha(2D)-adrenoceptor which seems to be labelled by [(14)C]-agmatine.
Asunto(s)
Antagonistas de Receptores Adrenérgicos alfa 2 , Agmatina/farmacología , Corteza Cerebral/efectos de los fármacos , Radiofármacos/farmacología , Agonistas alfa-Adrenérgicos/farmacología , Regulación Alostérica , Animales , Unión Competitiva , Radioisótopos de Carbono , Membrana Celular/efectos de los fármacos , Membrana Celular/metabolismo , Corteza Cerebral/metabolismo , Dinoprostona/farmacología , Relación Dosis-Respuesta a Droga , Técnicas In Vitro , Ensayo de Unión Radioligante , Ratas , Ratas Wistar , Receptores Adrenérgicos alfa 2/metabolismo , Tritio , Vena Cava Superior/efectos de los fármacos , Vena Cava Superior/fisiología , Yohimbina/farmacologíaRESUMEN
We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi<4.5). [35S]GTPgammaS binding was increased by WIN 55,212-2 (maximum effect of 80%, pEC50=6.94) but not affected by WIN 55,212-3. In conclusion, serotonin release in the mouse brain cortex is inhibited via CB1 receptors, which may be located presynaptically and are not activated by endogenous cannabinoids. The extent of inhibition is smaller than that obtained (1) via another three presynaptic receptors on serotoninergic neurones and (2) via CB1 receptors on cholinergic neurones in the same tissue.
Asunto(s)
Química Encefálica/efectos de los fármacos , Receptores de Droga/metabolismo , Receptores Presinapticos/metabolismo , Antagonistas de la Serotonina/farmacología , Serotonina/metabolismo , Animales , Benzoxazinas , Bloqueadores de los Canales de Calcio/metabolismo , Bloqueadores de los Canales de Calcio/farmacología , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Estimulación Eléctrica , Guanosina 5'-O-(3-Tiotrifosfato)/metabolismo , Guanosina 5'-O-(3-Tiotrifosfato)/farmacología , Técnicas In Vitro , Masculino , Membranas/efectos de los fármacos , Membranas/metabolismo , Ratones , Morfolinas/metabolismo , Morfolinas/farmacología , Naftalenos/metabolismo , Naftalenos/farmacología , Potasio/farmacología , Receptores de Cannabinoides , Receptores de Droga/efectos de los fármacos , Receptores Presinapticos/efectos de los fármacosRESUMEN
We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.
Asunto(s)
Corteza Cerebral/efectos de los fármacos , Hipocampo/efectos de los fármacos , Oligodesoxirribonucleótidos Antisentido/farmacología , Receptores de Droga/efectos de los fármacos , Corteza Visual/efectos de los fármacos , Acetilcolina/metabolismo , Animales , Corteza Cerebral/metabolismo , Guanosina 5'-O-(3-Tiotrifosfato)/metabolismo , Hipocampo/metabolismo , Inyecciones Intraventriculares , Masculino , Oligodesoxirribonucleótidos Antisentido/clasificación , Piperidinas/metabolismo , Unión Proteica , Pirazoles/metabolismo , Ensayo de Unión Radioligante , Ratas , Ratas Wistar , Receptores de Cannabinoides , Receptores de Droga/metabolismo , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Rimonabant , Corteza Visual/metabolismoRESUMEN
Guinea-pig hippocampal slices preincubated with [3H]noradrenaline were superfused with medium containing desipramine and rauwolscine and rat striatal slices preincubated with [3H]dopamine were superfused with medium containing nomifensine; the effect of cannabinoid receptor ligands on tritium overflow stimulated by NMDA or kainate was examined. Furthermore, the affinity of the drugs for cannabinoid CB1 receptors was determined in rat brain cortex membranes using [3H]SR 141716. In guinea-pig hippocampal slices preincubated with [3H]noradrenaline, tritium overflow stimulated by NMDA 100 microM and 1000 microM and by kainate 1000 microM was inhibited by the cannabinoid receptor agonists CP-55,940 and/or WIN 55,212-2. The CB1 receptor antagonist SR 141716 increased the NMDA (1000 microM)-stimulated tritium overflow but did not affect tritium overflow stimulated by NMDA 100 microM or kainate 1000 microM. The inhibitory effect of WIN 55,212-2 on the NMDA (100 microM)- and kainate (1000 microM)-evoked tritium overflow was antagonized by SR 141716. In rat striatal slices preincubated with [3H]dopamine, WIN 55,212-2 inhibited the NMDA (1000 microM)-stimulated tritium overflow. SR 141716, which, by itself, did not affect tritium overflow, counteracted the inhibitory effect of WIN 55,212-2. [3H]SR 141716 binding to rat cortical membranes was inhibited by SR 141716, CP-55,940 and WIN 55,212-2 (pKi 8.53, 7.34 and 5.93, respectively) but not affected by desipramine, rauwolscine and nomifensine (pKi < 5). In conclusion, activation of CB1 receptors inhibits the NMDA- and kainate-stimulated noradrenaline release in guinea-pig hippocampus and the NMDA-stimulated dopamine release in rat striatum. The explanation for the facilitatory effect of SR 141716 might be that it acts as an inverse agonist at CB1 receptors or that these receptors are activated by endogenous cannabinoids.
Asunto(s)
Química Encefálica/efectos de los fármacos , Cannabinoides/farmacología , Dopamina/metabolismo , Agonistas de Aminoácidos Excitadores/farmacología , Ácido Kaínico/farmacología , N-Metilaspartato/farmacología , Norepinefrina/metabolismo , Receptores de Droga/efectos de los fármacos , Animales , Benzoxazinas , Unión Competitiva/efectos de los fármacos , Cannabinoides/antagonistas & inhibidores , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Ciclohexanoles/farmacología , Cobayas , Masculino , Membranas/efectos de los fármacos , Membranas/metabolismo , Morfolinas/farmacología , Naftalenos/farmacología , Piperidinas/farmacología , Pirazoles/farmacología , Ratas , Ratas Wistar , Receptores de Cannabinoides , Rimonabant , Estimulación QuímicaRESUMEN
Mouse brain slices preincubated with [3H]-noradrenaline or [3H]-serotonin were superfused with medium containing naloxone 10 microM; we studied whether nociceptin (the endogenous ligand at ORL1 receptors) affects monoamine release. Furthermore, the affinities of ORL1 ligands were determined using [3H]-nociceptin binding. The electrically (0.3 Hz) evoked tritium overflow in mouse cortex slices preincubated with [3H]-noradrenaline was inhibited by nociceptin and [Tyr14]-nociceptin (maximally by 80%; pEC50 7.52 and 8.28) but not affected by [des-Phe1]-nociceptin (pEC50<6). The ORL1 antagonist naloxone benzoylhydrazone antagonized the effect of nociceptin and [Tyr14]-nociceptin. The effect of nociceptin did not desensitize, was not affected by blockade of NO synthase, cyclooxygenase and P1-purinoceptors and was decreased by the alpha2-adrenoceptor agonist talipexole. Nociceptin also inhibited the evoked overflow in mouse cerebellar, hippocampal and hypothalamic slices in a manner sensitive to naloxone benzoylhydrazone. The electrically (3 Hz) evoked tritium overflow in mouse cortex slices preincubated with [3H]-serotonin was inhibited by nociceptin; naloxone benzoylhydrazone antagonized this effect. The affinities (pKi) for [3H]-nociceptin binding to mouse cortex membranes were: nociceptin, 8.71; [Tyr14]-nociceptin, 9.82; [des-Phe1]-nociceptin, <5.5; naloxone benzoylhydrazone, 5.85; naloxone, <4.5. In conclusion, nociceptin inhibits noradrenaline release in the mouse cortex via ORL1 receptors, which interact with presynaptic alpha2-autoreceptors on noradrenergic neurones. The effect of nociceptin does not desensitize nor does it involve NO, prostanoids or adenosine. Nociceptin also attenuates noradrenaline release from several subcortical regions and serotonin release from cortical slices by a naloxone benzoylhydrazone-sensitive mechanism.
Asunto(s)
Encéfalo/metabolismo , Norepinefrina/antagonistas & inhibidores , Receptores Opioides/efectos de los fármacos , Animales , Encéfalo/anatomía & histología , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Inhibidores de la Ciclooxigenasa/farmacología , Estimulación Eléctrica , Inhibidores Enzimáticos/farmacología , Técnicas In Vitro , Masculino , Ratones , Corteza Motora/efectos de los fármacos , Corteza Motora/fisiología , Óxido Nítrico Sintasa/antagonistas & inhibidores , Norepinefrina/metabolismo , Péptidos Opioides/antagonistas & inhibidores , Péptidos Opioides/farmacología , Antagonistas de Receptores Purinérgicos P1 , Ratas , Ratas Wistar , Receptores Adrenérgicos alfa 2/efectos de los fármacos , Receptores Opioides/agonistas , Receptores Opioides/metabolismo , Serotonina/metabolismo , Receptor de Nociceptina , NociceptinaRESUMEN
The processes responsible for the limited ability to divide and long survival of neurons are not well understood but may involve aryl hydrocarbon receptor nuclear translocator 2 (ARNT2), a recently identified protein, apparently belonging to the basic helix-loop-helix superfamily of transcription factors, which is expressed almost exclusively in brain during the whole lifetime. In agreement, we show, in the rat, that ARNT2 immunoreactivity could be observed only within nuclei of brain neurons and of dividing and neuronal PC12 cells, a localization consistent with a role in transcription regulation. Cell death elicited either by focal ischaemia in brain or oxidative stress in PC12 cells was largely preceded by an almost complete suppression of ARNT2 expression. In contrast, when PC12 cell cycle progression was impaired, ARNT2 expression was enhanced. Finally, the downregulation of ARNT2 levels induced by antisense oligonucleotides prevented PC12 cell proliferation and induced apoptosis. These observations support the hypothesis that ARNT2 is a neuronal transcription factor, regulating cell cycle progression and preventing cell death, whose sustained expression might ensure brain neuron survival.
Asunto(s)
Neuronas/química , Neuronas/citología , Factores de Transcripción/genética , Factores de Edad , Animales , Elementos sin Sentido (Genética) , Apoptosis/fisiología , Translocador Nuclear del Receptor de Aril Hidrocarburo , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico , Isquemia Encefálica/genética , Isquemia Encefálica/fisiopatología , Ciclo Celular/fisiología , Supervivencia Celular/fisiología , Corteza Cerebral/irrigación sanguínea , Corteza Cerebral/citología , Corteza Cerebral/embriología , Regulación hacia Abajo/fisiología , Regulación del Desarrollo de la Expresión Génica/fisiología , Etiquetado Corte-Fin in Situ , Masculino , Neuronas/fisiología , Células PC12 , ARN Mensajero/análisis , Ratas , Ratas Sprague-Dawley , Factores de Transcripción/metabolismoRESUMEN
Mr 2266 [(-)-(1R,5R,9R)-5,9-diethyl-2-(3-furylmethyl)-2'-hydroxy-6,7-benzomorpha n] is an antagonist at kappa-opioid receptors and at ORL1 receptors as well. The aim of our study was to examine whether the known stereoselective antagonism of Mr 2266 at kappa-opioid receptors also extends to ORL1 receptors. In mouse brain cortex membranes, the binding of the ORL1 receptor agonist [3H]nociceptin was equipotently inhibited by Mr 2266 and its enantiomer Mr 2267 (pK(i) 4.82 and 5.14, respectively), whereas the binding of the kappa-opioid receptor agonist [3H]U-69,593 was inhibited by Mr 2266 more potently (pK(i) 9.11) than by its enantiomer Mr 2267 (pK(i)7.15). In mouse brain cortex slices preincubated with [3H]noradrenaline, the concentration-response curve of nociceptin for inhibition of the electrically evoked overflow of tritium was equipotently shifted to the right by Mr 2266 and Mr 2267 (pA2 5.77 and 5.64, respectively). On the other hand, the inhibitory effect of U-69,593 on the electrically evoked overflow of tritium in guinea-pig brain cortex slices preincubated with [3H]noradrenaline was more potently antagonized by Mr 2266 (pA2 8.81) than by Mr 2267 (pA2 7.15). These data show that the stereoselective antagonism of Mr 2266 at kappa-opioid receptors does not extend to ORL1 receptors.
Asunto(s)
Bencenoacetamidas , Benzomorfanos/farmacología , Antagonistas de Narcóticos/farmacología , Receptores Opioides kappa/antagonistas & inhibidores , Animales , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Estimulación Eléctrica , Cobayas , Técnicas In Vitro , Masculino , Ratones , Péptidos Opioides/farmacología , Perfusión , Pirrolidinas/farmacología , Ratas , Receptores Opioides , Receptores Opioides kappa/agonistas , Estereoisomerismo , Receptor de Nociceptina , NociceptinaRESUMEN
A fourth type of opioid receptor, termed ORL1, has been cloned and nociceptin (also known as orphanin FQ) has been identified as an endogenous ligand at this receptor. We examined whether nociceptin affects the release of noradrenaline in the brain. For this purpose, cerebral cortex slices from the mouse, rat or guinea-pig were preincubated with [3H]noradrenaline and then superfused with medium containing desipramine and rauwolscine. Tritium overflow was evoked electrically (0.3 Hz) or by introduction of Ca2+ 1.3 mM into Ca2+-free K+-rich (15 mM) medium. Nociceptin 1 microM reduced the electrically evoked tritium overflow from mouse, rat and guinea-pig brain cortex slices by 80, 71 and 36%, respectively. Naloxone 10 microM did not change the effect of nociceptin. All subsequent experiments were performed on mouse brain cortex slices and in the presence of naloxone 10 microM. The concentration-response curve of nociceptin (maximum inhibition by 80%, pEC50 7.5) was shifted to the right by the non-selective ORL1 receptor antagonist naloxone benzoylhydrazone and the selective ORL1 receptor antagonist [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (pA2 6.6 and 7.2, respectively). Naloxone benzoylhydrazone did not affect the evoked overflow by itself whereas [Phe1psi(CH2-NH)Gly2]nociceptin(1-13)NH2 caused an inhibition by maximally 35% (pEC50 7.0; intrinsic activity alpha 0.45). The inhibitory effect of [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 was counteracted by naloxone benzoylhydrazone. Nociceptin also reduced the Ca2+-evoked tritium overflow in mouse brain cortex slices superfused in the presence of tetrodotoxin. This effect was also antagonized by naloxone benzoylhydrazone, which, by itself, did not affect the evoked tritium overflow. In conclusion, nociceptin inhibits noradrenaline release more markedly in the mouse than in the rat or guinea-pig brain cortex. The effect of nociceptin in the mouse brain cortex involves ORL1 receptors, which are located presynaptically on noradrenergic neurones.
Asunto(s)
Corteza Cerebral/efectos de los fármacos , Norepinefrina/metabolismo , Péptidos Opioides/farmacología , Receptores Opioides/efectos de los fármacos , Receptores Presinapticos/efectos de los fármacos , Animales , Calcio/farmacología , Corteza Cerebral/metabolismo , Cobayas , Masculino , Ratones , Ratas , Ratas Wistar , Receptores Opioides/fisiología , Receptores Presinapticos/fisiología , Receptor de Nociceptina , NociceptinaRESUMEN
We determined the affinities of five newly synthesized histamine H3-receptor antagonists in an H3-receptor binding assay and their potencies in a functional H3-receptor model. Furthermore, we determined their potencies in a histamine H2- and H1-receptor model. The compounds differ from histamine in that the ethylamine side chain is replaced by an aryl-substituted propyloxy chain and they differ from one another by varying substituents of the aryl rest. Iodoproxyfan, a highly potent and selective antagonist at H3 receptors, is structurally related to these five compounds. The specific binding of [3H]-Nalpha-methylhistamine to rat brain cortex membranes was monophasically displaced by each of the five compounds at pKi values ranging from 8.24 to 9.27. Inhibition by histamine of the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]noradrenaline was antagonized by all compounds and the concentration-response curve was shifted to the right with apparent pA2 values ranging from 7.78 to 9.39. The five compounds under study possess negligible potencies at histamine H2 and H1 receptors studied in the guinea-pig right atrium and ileum, respectively (pD'2 or pKp values < or = 5.2). The present paper shows that the five compounds under study possess high affinities and potencies at histamine H3 receptors, four out of the five compounds in this respect being equipotent with iodoproxyfan. Like iodoproxyfan, the five compounds show an at least 1000-fold selectivity for H3 as compared to H2 and H1 receptors.
Asunto(s)
Antagonistas de los Receptores Histamínicos/farmacología , Imidazoles/farmacología , Norepinefrina/metabolismo , Receptores Histamínicos H3/efectos de los fármacos , Animales , Corteza Cerebral/efectos de los fármacos , Relación Dosis-Respuesta a Droga , Femenino , Atrios Cardíacos/efectos de los fármacos , Antagonistas de los Receptores Histamínicos H1/farmacología , Antagonistas de los Receptores H2 de la Histamina/farmacología , Íleon/efectos de los fármacos , Técnicas In Vitro , Masculino , Ratones , Modelos Biológicos , Estructura Molecular , Ratas , Tritio/farmacocinéticaRESUMEN
The present study was carried out to clarify whether the imidazolines clonidine, moxonidine and cirazoline as well as the guanidine aganodine inhibit noradrenaline release in the rat and rabbit brain via imidazoline receptors, alpha 2-adrenoceptors and/or histamine H3 receptors. Slices or synaptosomes from the rat or the rabbit brain were incubated with 3H-noradrenaline and exposed to phenoxybenzamine, which irreversibly blocks presynaptic alpha 2-adrenoceptors and, at considerably lower potency, imidazoline receptors. Tritium overflow in the superfused preparations was evoked electrically (3 Hz; slices) or by K+ 15 mmol/l (synaptosomes). Noradrenaline and rauwolscine, which possess low affinity, if any, for imidazoline receptors, were used as reference drugs. The evoked overflow in rat brain cortex slices and synaptosomes and in rat medulla oblongata slices, not exposed to phenoxybenzamine, was inhibited by clonidine, moxonidine and noradrenaline. Phenoxybenzamine markedly attenuated the effect of each drug to about the same extent. In rabbit brain cortex slices, not exposed to phenoxybenzamine, the evoked overflow was inhibited by clonidine, moxonidine, aganodine and noradrenaline, facilitated by BDF 6143 (4-chloro-2-(2-imidazoline-2-yl-amino)-isoindoline), idazoxan and rauwolscine and not affected by cirazoline. In slices exposed to phenoxybenzamine, the inhibitory effects of the imidazolines, of aganodine and of noradrenaline were again attenuated by about the same high degree, the facilitatory effects of BDF 6143, idazoxan and rauwolscine were abolished and cirazoline produced a slight inhibition of the evoked overflow. The latter effect was not affected by high concentrations of rauwolscine and idazoxan (at which these drugs act antagonistic at imidazoline receptors in other models). The specific binding of 3H-N alpha-methylhistamine to H3 receptors in rat brain cortex membranes was displaced only by high concentrations of moxonidine (pKi = 6.16) and at even lower affinity by aganodine, BDF 6143, cirazoline, clonidine and idazoxan (pKi < 5). Histamine, which was used as a reference drug, proved to be very potent (pKi = 8.20). In conclusion, imidazolines affect noradrenaline release in the rat and rabbit brain cortex and medulla oblongata via alpha 2-adrenoceptors but not via imidazoline receptors resembling the presynaptic imidazoline receptors previously identified in peripheral tissues of the rabbit. In addition, the involvement of I1- or I2-imidazoline binding sites or of H3 receptors is very improbable in view of the low affinity of aganodine, moxonidine and/or clonidine for these recognition sites and/or incompatibility of the rank order of their affinities with the potencies of the drugs in inhibiting noradrenaline release.
Asunto(s)
Encéfalo/efectos de los fármacos , Encéfalo/metabolismo , Imidazoles/farmacología , Norepinefrina/metabolismo , Receptores Adrenérgicos alfa/fisiología , Receptores de Droga/fisiología , Receptores Histamínicos H3/fisiología , Agonistas alfa-Adrenérgicos/farmacología , Animales , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Clonidina/farmacología , Estimulación Eléctrica , Receptores de Imidazolina , Técnicas In Vitro , Masculino , Bulbo Raquídeo/efectos de los fármacos , Bulbo Raquídeo/metabolismo , Perfusión , Conejos , Ratas , Ratas Wistar , TritioRESUMEN
Arnt2, a new member of the basic-helix-loop-helix transcription factor family, was cloned from rat brain cDNAs. Its deduced 712 amino acid sequence displays 63% identity with that of the aryl hydrocarbon receptor nuclear translocator (Arnt1) that was completely established. Whereas Arnt2 gene expression, established by Northern blotting and in situ hybridization histochemistry, occurred selectively in brain and kidney, that of Arnt1 was ubiquitous, suggesting that the two proteins play distinct roles, presumably via dimerization and DNA binding with different partners.