Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Effect of Urea on G-Quadruplex Stability.

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G3T2A)3G3] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔSA, is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the G-quadruplex and duplex conformations is a step toward elucidation of the modulating influence of different types of cosolvents on duplex-G-quadruplex molecular switches triggering genomic events.

Thermodynamic linkage analysis of pH-induced folding and unfolding transitions of i-motifs.

We describe the pH-induced folding/unfolding transitions of i-motifs by a linkage thermodynamics-based formalism in terms of three pKa's of cytosines, namely, an apparent pKa in the unfolded conformation, pKau, and two apparent pKa's in the folded state, pKaf1 and pKaf2. For the 5'-TTACCCACCCTACCCACCCTCA-3' sequence from the human c-MYC oncogene promoter region, the values of pKau, pKaf1, and pKaf2 are 4.8, 6.0, and 3.6, respectively. With these pKa's, we calculate the differential number of protons bound to the folded and unfolded states as a function of pH. Analysis along these lines offers an alternative interpretation to the experimentally observed shift in the pH-induced unfolded-to-i-motif transitions to neutral pH in the presence of cosolvents and crowders.

Ionic Effects on VEGF G-Quadruplex Stability.

In a potassium solution, a modified 22-meric DNA sequence Pu22-T12T13 from a region proximal to the transcription initiation site of the human VEGF gene adopts a single parallel-stranded G-quadruplex conformation with a 1:4:1 loop-size arrangement. We measured the thermal stability, TM, of the K(+)-stabilized Pu22-T12T13 G-quadruplex as a function of stabilizing K(+) ions and nonstabilizing Cs(+) and TMA(+) ions. The thermal stability, TM, of the Pu22-T12T13 G-quadruplex increases with the concentration of the stabilizing potassium ions, while it sharply decreases upon the addition of the nonstabilizing cations. We interpret these results as underscoring the opposing effects of internal binding and counterion condensation on the stability of the Pu22-T12T13 G-quadruplex. While centrally bound ions stabilize the G-quadruplex conformation, counterion condensation destabilizes it, favoring the coil conformation. From the initial slopes of the dependences of TM on the concentration of Cs(+) and TMA(+) cations, we estimate that the deleterious effect of counterion condensation stems from roughly one extra counterion associated with the coil relative to the G-quadruplex state of Pu22-T12T13. The reduced accumulation of counterions around the G-quadruplex state of Pu22-T12T13 relative to its coil state is due to the low surface charge density of the G-quadruplex reflecting its structural characteristics. On the basis of the analysis of our data along with the results of a previous study, we propose that the differential effect of internally (stabilizing) and externally (destabilizing) bound cations may be a general feature of parallel intramolecular G-quadruplexes.

Effects of Salt on the Stability of a G-Quadruplex from the Human c-MYC Promoter.

In an atmosphere of potassium ions, a modified c-MYC NHE III1 sequence with two G-to-T mutations (MYC22-G14T/G23T) forms a highly stable parallel-stranded G-quadruplex. The G-quadruplex exhibits a steady increase in its melting temperature, T(M), with an increase in the concentration of the stabilizing cation K(+). On the other hand, an increase in the concentration of nonstabilizing Cs(+) or TMA(+) cations at a constant concentration of K(+) causes a sharp decline in T(M) followed by a leveling off at ∼200 mM Cs(+) or TMA(+). At 51 °C and 600 µM K(+), an increase in Cs(+) concentration from 0 to 800 mM leads to a complete unfolding of the G-quadruplex. These observations are consistent with the picture in which more counterions accumulate in the vicinity of the unfolded state of MYC22-G14T/G23T (nonspecific ion binding) than in that of the G-quadruplex state. We estimate that the unfolded state condenses one extra counterion compared to the G-quadruplex state. Taken together with our earlier results, our data suggest that sodium or potassium cations sequestered inside the central cavity stabilize the G-quadruplex conformation acting as specifically bound ligands. Nonspecifically bound (condensed) counterions may slightly stabilize, exert no influence (human telomeric G-quadruplexes), or strongly destabilize (MYC22-G14T/G23T) the G-quadruplex conformation. We offer a structural rationalization for the enhanced thermal stability of the MYC22-G14T/G23T G-quadruplex.

Polyelectrolyte effects in G-quadruplexes.

The role of counterion condensation as a dominant force governing the stability of DNA duplexes and triplexes is well established. In contrast, the effect of counterion condensation on the stability of G-quadrupex conformations is poorly understood. Unlike other ordered nucleic acid structures, G-quadruplexes exhibit a specific binding of counterions (typically, Na(+) or K(+)) which are buried inside the central cavity and coordinated to the O6 carbonyls of the guanines forming the G-quartets. While it has been known that the G-quadruplex-to-coil transition temperature, TM, increases with an increase in the concentration of the stabilizing ion, the contributions of the specific (coordination in the central cavity) and nonspecific (condensation) ion binding have not been resolved. In this work, we separate the two contributions by studying the change in TM of preformed G-quadruplexes following the addition of nonstabilizing ions Li(+), Cs(+), and TMA(+) (tetramethylammonium). In our studies, we used two G-quadruplexes formed by the human telomeric sequences which are distinct with respect to the folding topology and the identity and the number of sequestered stabilizing ions. Our data suggest that the predominant ionic contribution to G-quadruplex stability comes from the specifically bound Na(+) or K(+) ions and not from counterion condensation. We offer molecular rationalizations to the observed insensitivity of G-quadruplex stability to counterion condensation and emphasize the need to expand such studies to assess the generality of our findings.