The efficacy of gabapentin supplementation for pain control after lumbar laminectomy and discectomy: A meta-analysis study.

BACKGROUND: Gabapentin supplementation may have some potential in pain control after lumbar laminectomy and discectomy, and this meta-analysis aims to explore the impact of gabapentin supplementation on postoperative pain management for lumbar laminectomy and discectomy. METHODS: PubMed, EMbase, Web of science, EBSCO, and Cochrane library databases were systematically searched, and we included randomized controlled trials assessing the effect of gabapentin supplementation on the pain control of lumbar laminectomy and discectomy. RESULTS: Five randomized controlled trials were finally included in the meta-analysis. Overall, compared with control intervention for lumbar laminectomy and discectomy, gabapentin supplementation was associated with significantly lower pain scores at 2 hours (MD = -2.75; 95% CI = -3.09 to -2.41; P < .00001), pain scores at 4 hours (MD = -2.28; 95% CI = -3.36 to -1.20; P < .0001), pain scores at 24 hours (MD = -0.70; 95% CI = -0.86 to -0.55; P < .00001) and anxiety score compared to control intervention (MD = -1.32; 95% CI = -1.53 to -1.11; P < .00001), but showed no obvious impact on pain scores at 12 hours (MD = -0.58; 95% CI = -1.39 to 0.22; P = .16). In addition, gabapentin supplementation could significantly decrease the incidence of vomiting in relative to control intervention (OR = 0.31; 95% CI = 0.12-0.81; P = .02), but they had similar incidence of nausea (OR = 0.51; 95% CI = 0.15-1.73; P = .28). CONCLUSIONS: Gabapentin supplementation benefits to pain control after lumbar laminectomy and discectomy.

Bimetallic Ru/Ru-Catalyzed Asymmetric One-Pot Sequential Hydrogenations for the Stereodivergent Synthesis of Chiral Lactones.

Asymmetric sequential hydrogenations of α-methylene γ- or δ-keto carboxylic acids are established in one-pot using a bimetallic Ru/Ru catalyst system, achieving the stereodivergent synthesis of all four stereoisomers of both chiral γ- and δ-lactones with two non-vicinal carbon stereocenters in high yields (up to 99%) and with excellent stereoselectivities (up to >99% ee and >20:1 dr). The compatibility of the two chiral Ru catalyst systems is investigated in detail, and it is found that the basicity of the reaction system plays a key role in the sequential hydrogenation processes. The protocol can be performed on a gram-scale with a low catalyst loading (up to 11000 S/C) and the resulting products allow for many transformations, particularly for the synthesis of several key intermediates useful for the preparation of chiral drugs and natural products.

Identification and Genome Characterization of a Novel Virus within the Genus Totivirus from Chinese Bayberry (Myrica rubra).

Chinese bayberry (Myrica rubra) is an economically significant fruit tree native to eastern Asia and widely planted in south-central China. However, studies about the viruses infecting M. rubra remain largely lacking. In the present study, we employed the metatranscriptomic method to identify viruses in M. rubra leaves exhibiting yellowing and irregular margin symptoms collected in Fuzhou, a city located in China's Fujian province in the year 2022. As a consequence, a novel member of the genus Totivirus was identified and tentatively named "Myrica rubra associated totivirus 1" (MRaTV1). The genome sequencing of MRaTV1 was determined by overlapping reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The two deduced proteins encoded by MRaTV1 have the highest amino acid (aa) sequence identity to the coat protein (CP) and RNA-dependent RNA polymerase (RdRP) of Panax notoginseng virus A (PNVA), a member of the genus Totivirus within the family Totiviridae, at 49.7% and 61.7%, respectively. According to the results of the phylogenetic tree and the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for the genus Totivirus, MRaTV1 is considered a new member of the genus Totivirus.

Virome Analysis of Aconitum carmichaelii Reveals Infection by Eleven Viruses, including Two Potentially New Species.

Aconitum carmichaelii is a herbaceous herb indigenous to China that has been cultivated for traditional medicine for centuries. Virus-like symptoms of A. carmichaelii plants were observed on leaves in some A. carmichaelii plantations in Zhanyi and Wuding Counties, Yunnan Province, southwest China. High-throughput sequencing (HTS) was performed on 28 symptomatic plants, and the results revealed infection with 11 viruses, including 2 novel viruses and 9 previously described viruses: Aconitum amalgavirus 1 (AcoAV-1), aconite virus A (AcVA), cucumber mosaic virus (CMV), currant latent virus (CuLV), apple stem grooving virus (ASGV), chilli veinal mottle virus (ChiVMV), tomato spotted wilt orthotospovirus (TSWV), tobacco vein distorting virus (TVDV), and potato leafroll virus (PLRV). Two novel viruses tentatively named Aconitum potyvirus 1 and Aconitum betapartitivirus 1, were supported by sequence and phylogenetic analysis results of their genomes. We proposed the names Potyvirus aconiti and Betapartitivirus aconiti. RT-PCR assays of 142 plants revealed the predominance and widespread distribution of CMV, AcVA, and AcoPV-1 in plantations. The detection of isolates of CuLV, ASGV, ChiVMV, TSWV, TVDV, and PLRV infections for the first time in A. carmichaelii expands their known host ranges.

ROS-responsive magnesium-containing microspheres for antioxidative treatment of intervertebral disc degeneration.

Intervertebral disc degeneration (IVDD) is a degenerative disease characterized by lower-back pain, causing disability globally. Antioxidant therapy is currently considered one of the most promising strategies for IVDD treatment, given the crucial role of reactive oxygen species (ROS) in IVDD pathogenesis. Herein, a ROS-responsive magnesium-containing microsphere (Mg@PLPE MS) was constructed for the antioxidative treatment of IVDD. The Mg@PLPE MS has a core-shell structure comprising poly(lactic-co-glycolic acid) (PLGA) and ROS-responsive polymer poly(PBT-co-EGDM) as the shell and a magnesium microparticle as the core. The poly(PBT-co-EGDM) can be destroyed by H2O2 through the H2O2-triggered hydrophobic-to-hydrophilic transition, subsequently promoting an Mg-water reaction to produce H2. Thus, Mg@PLPE MS provides a valuable platform for H2O2 elimination and controlled H2 release. The generated H2 scavenge for ROS by reacting with noxious •OH. Notably, the Mg@PLPE MS exerted significant antioxidative and anti-inflammatory effects in a disc degeneration rat model and alleviated extracellular matrix degradation and disc cells apoptosis, thereby underlining its efficacy in IVDD treatment. The Mg@PLPE MS also exhibited robust biocompatibility and negligible toxicity, presenting the promise for the antioxidative treatment of IVDD in vivo. STATEMENT OF SIGNIFICANCE: Antioxidant therapy is currently considered one of the most promising strategies for intervertebral disc degeneration (IVDD) treatment, given the crucial role of reactive oxygen species (ROS) in IVDD pathogenesis. Here, ROS-responsive magnesium-containing microspheres (Mg@PLPE MSs) were constructed to alleviate IVDD through controlled release of hydrogen gas. The Mg@PLPE MSs can effectively scavenge overproduced ROS by simultaneously reacting with H2O2 and •OH, thus creating a suitable microenvironment for inhibition of ECM degradation. As a result, Mg@PLPE MSs treated IVDD rats exhibit minimal nucleus pulposus decrease, less extracellular matrix degradation, minimal radial fissure of fibrous rings, and higher disc height index. Therefore, the as-prepared Mg@PLPE MSs may shed a new light on clinical treatment of IVDD.

Complete genome sequence of Aconitum amalgavirus 1, a distinct member of the genus Amalgavirus.

A novel virus named Aconitum amalgavirus 1 (AcoAV-1) was identified in Chinese aconite (Aconitum carmichaelii) plants. The complete genome of AcoAV-1 is 3,370 nucleotides long, containing two partially overlapping open reading frames encoding a putative coat protein and a RNA-dependent RNA polymerase, respectively. Its fusion protein shares 34.9%-50.7% amino acid sequence identity with other amalgaviruses. Phylogenetic analysis showed that this virus formed a clade with blueberry latent virus and four other related viruses, suggesting that it belongs to the genus Amalgavirus in the family Amalgaviridae.

Genomic characterization of a new enamovirus infecting common bean.

A novel enamovirus was identified in common bean plants with disease symptoms. Its genome of 5,781 nucleotides (nt) contains five open reading frames. This virus and other members of the genus Enamovirus share 50.4-68.4% nucleotide sequence identity in the complete genome and 19.9-51.9% amino acid sequence identity in the P0 protein, 24.9-52.5% in P1, 33.4-62.9% in P1-P2, 30.6-81.1% in P3, and 32.3-74.2% in P3-P5. Phylogenetic analysis showed that the virus is most closely related to alfalfa enamovirus 1 and pea enation mosaic virus 1 in the genus Enamovirus of the family Solemoviridae. These results suggest that this virus, tentatively named "bean enamovirus 1", should be classified as a member of a new species in the genus Enamovirus.

High-throughput sequencing reveals the presence of novel and known viruses in diseased Paris yunnanensis.

Paris spp. are important medicinal plant and main raw material for many Chinese patent medicines, but viral diseases have became serious problems in cultivation of this group of important medicinal plants in China. In this study, eight viruses were identified in the diseased plants of Paris yunnanensis by high-throughput sequencing (HTS) and RT-PCR. These viruses include three novel viruses (two potyviruses and one nepovirus), Hippeastrum chlorotic ringspot virus (HCRV), Lychnis mottle virus (LycMoV), Paris mosaic necrosis virus (PMNV), Paris virus 1 and pepper mild mottle virus. The three new viruses were tentatively named Paris potyvirus 3 (ParPV-3), Paris potyvirus 4 (ParPV-4), Paris nepovirus 1 (ParNV-1) and their complete genome sequences were determined. Sequence analyses showed ParPV-3 and ParPV-4 shared the highest amino acid (aa) sequence identities of 54.3% to each other and 53.0-57.8% to other known potyviruses. ParNV-1 had aa sequence identities of 28.8-63.7% at protease-polymerase (Pro-Pol) with other nepoviruses. Phylogenetic analyses further support that the three viruses are new members of their corresponding genera. Analyses of the partial sequences of HCRV and LycMoV infecting P. yunnanensis revealed they diverged from existing isolates by aa sequence identities of 97.1% at glycoprotein precursor of HCRV and 93.3% at polyprotein of LycMoV. These two viruses are reported for the first time in Paris spp. A total of 123 field samples collected from P. yunnanensis in four counties of Yunnan, Southwest China were tested by RT-PCR for detecting each of the eight viruses. Results showed that nearly half of the samples were positive for at least one of the eight viruses. Two potyviruses, ParPV-3 (26.8%) and PMNV (24.4%), were predominant and widely distributed in the fields, while other viruses occurred in low rates and/or had limited distribution. This study insights into the virome infecting P. yunnanensis and provides valuable information for diagnosis and control of viral diseases in P. yunnanensis.

Application of traditional Chinese medicine syndrome differentiation in identification of body constitution of hypertensive and diabetic patients.

OBJECTIVE: To investigate the application of traditional Chinese medicine (TCM) syndrome differentiation in identification of body constitution of hypertensive and diabetic patients. METHODS: A total of 110 hypertensive patients with diabetes treated in our hospital were enrolled in this study, and were divided into a study group (SG, n=60) and a control group (CG, n=50) according to different intervention methods. Patients in the CG received conventional western medical intervention for hypertension and diabetes, while patients in the SG received body constitution-identified TCM syndrome differentiation intervention additionally. The changes of blood pressure and plasma glucose during the intervention were compared between the two groups, the clinical effect and quality of life of the two groups were evaluated, and multivariate stepwise Logistic regression analysis on influencing factor of TCM body constitution was conducted. RESULTS: Compared with that before intervention, the proportion of gentleness constitution in the SG showed a significant increase (P<0.05) after intervention. Dynamic analysis during the intervention showed that patients in the SG had lower systolic blood pressure (SBP), diastolic blood pressure (DBP), lower level of fasting plasma glucose (GLU) and 2-h postprandial plasma glucose (2hPG) than the CG from 1 to 12 months after intervention (P<0.05). Patients in the SG scored higher than the CG on all SF-36 dimensions after intervention (P<0.05). Multivariate stepwise Logistic regression analysis showed that dampness-heat constitution, blood-stasis constitution, Yin-deficiency constitution and phlegm-dampness constitution were the main risk factors for hypertension with diabetes (P<0.05). CONCLUSION: Body constitution-identified TCM syndrome differentiation treatment for hypertensive patients with diabetes is effective, which can significantly improve the plasma glucose and blood pressure indices of patients. Dampness-heat constitution, blood-stasis constitution, Yin-deficiency constitution and phlegm-dampness constitution are the risk factors for hypertension with diabetes.

Complete genome sequence of a novel citrus virus with characteristics of members of the family Tymoviridae.

A novel positive-stranded RNA virus provisionally named "citrus virus C" (CVC) was discovered in citrus trees displaying mottling symptoms. Its genome comprises 7,215 nucleotides (nt), excluding the 3' poly(A) tail, and contains two open reading frames (ORFs) that encode a replication-associated polyprotein (RP) and a putative coat protein (CP). The CVC genome contains a 16-nt 'marafibox', which is highly conserved in most viruses belonging to the genus Marafivirus of the same family. Sequence analysis suggested that the virus is most closely related to grapevine Red Globe virus (GRGV), which is yet to be officially classified in the family Tymoviridae. The sequence identities between CVC and GRGV in the whole genome (50.7%, nt) and CP (49.4% for amino acid, and 53.9% for nt) are lower than the thresholds (80% in the genome and 90% in the CP) for species demarcation in the family. Therefore, it is legitimate to propose that CVC is a member of new species in the family Tymoviridae.

A Multiyear Survey and Identification of Pepper- and Tomato-Infecting Viruses in Yunnan Province, China.

During pepper and tomato production seasons in 2013-2017, large-scale virus disease surveys were conducted in different regions of Yunnan Province, China. A total of 1,267 pepper and tomato samples with various virus-like symptoms were collected and analyzed for virus infections through dot enzyme-linked immunosorbent assay (dot-ELISA), polymerase chain reaction (PCR), and reverse-transcription (RT)-PCR. The detection results showed that 19 different viruses were present in about 50.9% of the assayed samples, and among these viruses, seven viruses were found in both pepper and tomato samples. Mixed infections with two to three of the 15 identified mixed infection types were found in the pepper samples and 10 identified mixed infection types were found in the tomato samples. Among the infected samples, Tomato spotted wilt orthotospovirus (TSWV) was the most common virus, with a detection rate of about 20.0% followed by Pepper vein yellows virus (PeVYV, 13.0%). This survey revealed for the first time that pepper is a natural host of Tobacco vein distorting virus (TVDV) worldwide and tomato is a natural host of Potato leafroll virus (PLRV) in China. PeVYV, Tobacco mild green mosaic virus (TMGMV) and Wild tomato mosaic virus (WTMV) were first time found in pepper and Tomato mottle mosaic virus (ToMMV) and Chilli veinal mottle virus (ChiVMV) were first time found in tomato in Yunnan Province. Finally, the virus incidences were higher in Kunming, Yuxi, Chuxiong, and Honghe region than other regions.

A novel DCM-based NIR fluorescent probe for detecting ozone and its bioimaging in live cells.

Nowadays, ozone has been widely applied in industry and medical therapies. However, excessive exposure to ozone can lead to lung dysfunction and many respiratory symptoms. As a member of reactive oxygen species (ROS), ozone was also involved in various physiology and pathology process. Given the fact of this, the effective detection of ozone in the atmosphere and biological system is of vital significance. Herein, we reported a novel dicyanomethylene-4H-pyran (DCM)-based fluorescent probe DCM-O3 with butenyl being the recognition moiety for monitoring ozone. The probe displayed high selectivity towards ozone, and its response towards ozone could be completed within 5 min under the optimal condition. Besides, a good linear correlation was obtained between the ozone concentrations (0-50 µM) and the corresponding fluorescent intensity at 560 nm, and the limit of detection (LOD) was calculated to be 6.2 × 10-7 M. Moreover, the probe DCM-O3 showed low cytotoxicity and was successfully applied to detect ozone in live cells. Given all the merits, the probe DCM-O3 could function as a robust tool for researchers to investigate ozone-related diseases in the complex biological environment.

Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China.

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

The occurrence of Pea enation mosaic virus 1 and Pea enation mosaic virus 2 from disease-affected pea fields in China.

Pea (Pisum sativum L.) is an economically important legume crop that is commonly used as dry beans, fresh peas, pods and shoots (Guo et al. 2009). Pea enation mosaic is an important virus disease of pea caused by two viruses in an obligate symbiosis, pea enation mosaic virus 1 (PEMV-1, Enamovirus, Luteoviridae) and pea enation mosaic virus 2 (PEMV-2, Umbravirus, Tombusviridae) (Hema et al. 2014). In November 2019, foliar yellow mosaic and vein enations symptoms were observed from pea plants in five fields of Honghe autonomous prefecture, Yunnan province, China. Incidence of symptomatic plants ranged from 20 to 40% and was distributed in both small and large fields. Leaves with typical virus-like symptoms were collected from five symptomatic pea plants in two fields and used for total RNA extraction. The five extracts of equimolar quantities were pooled into a sample and subjected to High Throughput Sequencing (HTS) by Illumina HiSeq system. Analyses of raw RNA reads were performed using CLC Genomics Workbench 12 (Qiagen). A total of 60,009,746 RNA reads were obtained from the sample, and de novo assembly of the reads using the CLC Genomics generated 88,105 contigs. BLASTN searches revealed the presence of contigs with high similarities to PEMV-1, PEMV-2, Pea seed-borne mosaic virus, and Bean yellow mosaic virus. To confirm the presence of PEMV-1 and PEMV-2 in the samples, two virus-specific primer pairs were designed based on the contig sequences obtained by HTS in this study. Primer pairs PEMV-1F/PEMV-1R (5'-ATGCCGACTAGATCGAAATC-3'/5'-TCAGAGGGAGGCATTCATTA-3') that flank the cp gene of PEMV-1 and PEMV-2F/PEMV-2R (5'-ATGACGATAATCATTAATG-3'/5'-TCACCCGTAGTGAGAGGCA-3') that target the ORF3 region of PEMV-2 were used to amplify the two viruses in RT-PCR. DNA fragments of the expected sizes (PEMV-1, 570 bp; PEMV-2, 693 bp) were amplified from all five samples. The RT-PCR products were cloned and sequenced. Sequence analysis showed that the 570-bp amplicon (MT481989) shared the highest nucleotide sequence identity of 98.95% with PEMV-1 (Z48507), while the 693-bp fragment (MT481990) had the highest nucleotide sequence identity of 97.4% with PEMV-2 isolate JKI (MK948534). One gram of the symptomatic leaves from each of the five plants was homogenized with 5 mL of 0.01 M phosphate-buffered saline (PBS buffer), pH 7.0. Each of the resulted saps was used to inoculate onto five healthy pea seedlings. A total of 25 healthy pea seedlings were inoculated, and 16 inoculated plants developed yellowing and mottling at 10 days post inoculation (dpi); no symptoms were observed on control plants inoculated only with PBS buffer. The formation of the typical enation was observed along the veins of lower side of the symptomatic leaves of the inoculated plants at 30 dpi. PEMV-1 and PEMV-2 infection were confirmed by RT-PCR assays using the specific primer pairs described above. Although the presence of the pea enation mosaic virus complex was suspected in China based on symptomatology (Brunt et al. 1997), to our knowledge, this is the first molecular confirmation of PEMV-1 and PEMV-2 occurrence in China. The co-infection of PEMV-1 and PEMV-2 usually cause severe yield losses; therefore, integration of detection and control measures is important in pea production regions where the two viruses occurred.

First identification and molecular characterization of a novel cavemovirus infecting Epiphyllum spp.

A new virus with sequence similarities to members of the genus Cavemovirus in the family Caulimoviridae was identified in an Epiphyllum hybrid. The complete genome of the virus, tentatively named "epiphyllum virus 4" (EpV-4), was determined to be 7,296 nucleotides long. Its circular genome organization is typical of cavemoviruses, containing four open reading frames. This virus and the two known cavemoviruses share 67-69% and 72-75% overall nucleotide sequence identity in the replicase gene. Phylogenetic analysis placed EpV-4 in a same cluster with the two recognized cavemoviruses. Thus, EpV-4 should be considered a representative of a third species of the genus Cavemovirus. The virus was transmitted by grafting.

Virome of Camellia japonica: Discovery of and Molecular Characterization of New Viruses of Different Taxa in Camellias.

Many species of the genus Camellia are native to China, and several species such as C. japonica have been cultivated as garden plants for over 1,000 years. Virus-like symptoms have been recorded for years. In this study, C. japonica plants with various leaf symptoms were observed in Jiangxi and Chongqing provinces. The species composition of potential viruses in the symptomatic plants was analyzed by next-generation sequencing of six libraries prepared from total RNAs of specimens from 10 trees. Five new viruses were discovered, and their genome sequences were determined. These viruses were tentatively named Camellia chlorotic ringspot viruses (CaCRSVs), Camellia yellow ringspot virus (CaYRSV), Camellia-associated badnavirus (CaBaV), and Camellia-associated marafivirus (CaMaV) based on comprehensive analyses. Among these viruses, CaYRSV, CaBaV, and CaMaV share similar genome organizations and clear sequence homology with known viruses in databases and could potentially be classified as new species of the genera Badnavirus, Idaeovirus, and Marafivirus, respectively. CaCRSVs comprise two distinct viruses, and each likely contains five genomic RNA segments that were found to be distantly related to viral RNAs of members in the genus Emaravirus (family Fimoviridae). The RNAs of CaCRSVs show conserved terminal sequences that differ markedly from those of emaraviral RNAs. These data, together with the phylogenetic analysis, suggest that the evolutionary status of CaCRSVs may represent a novel genus in the family Fimoviridae. In addition, two known viruses (geminivirus and blunervirus) and a mass of betaflexiviruses existing as heterogeneous mixtures were detected, and their roles in symptom formation were studied. Collectively, the information of the viral species and detection protocols that were developed can serve as a basis for better management of these viruses. Distinguishing the virus-related symptoms from genetic characteristics of C. japonica is also significant for breeding efforts.

First identification and molecular characterization of a new badnavirus infecting camellia.

A new badnavirus was identified in an ornamental camellia tree with yellow mottle symptom. The complete circular double-stranded DNA genome of this virus was found to consist of 8,203 bp. Its genome organization is typical of badnaviruses, containing three open reading frames (ORFs). ORFs 1 and 2 encode putative proteins with unknown functions. ORF3 encodes a large polyprotein that contains almost all of the conserved domains of badnaviruses. The virus shares 55-62% nucleotide sequence identities with other badnaviruses in the RT+RNase H region. Phylogenetic analyses placed it in group I of the genus Badnavirus. Therefore, this virus, which is tentatively named "camellia Lemon Glow virus", should represent a new species of the genus Badnavirus. This virus was found to be present in approximately a quarter of camellia trees tested.

Camellia ringspot-associated virus 4, a proposed new foveavirus from Camellia japonica.

One large contig with high sequence similarity to Asian prunus virus 2 was identified by high-throughput sequencing from a camellia (Camellia japonica) tree with ringspot symptoms. The complete genome of this new virus was determined to be 8829 nucleotides long, excluding the 3' poly(A) tail. Its genome organization resembles that of known foveaviruses but contains an additional open reading frame in the 3'-terminal region. Phylogenetic analysis also places this virus with members of the genus Foveavirus in the family Betaflexiviridae in the same subgroup. The virus, which is provisionally named "camellia ringspot-associated virus 4″, shares 50-56% nucleotide sequence identity with other foveaviruses and should represent a new species in the genus.

Discovery and molecular characterization of a novel trichovirus infecting sweet cherry.

Contigs with the highest sequence similarity (73%) to Apricot pseudo-chlorotic leaf spot virus (genus Trichovirus, family Betaflexiviridae) were identified by high-throughput sequencing from a symptomless sweet cherry accession. The complete genome sequence of this new virus is 7460 nucleotides, excluding the 3' poly(A) tail. Its genome organization is very similar to several trichoviruses infecting fruit trees, with three open reading frames encoding putative replicase, movement protein and coat protein (CP). The virus shares amino acid sequence identities of 60-73% at replicase and 53-76% at CP with other trichoviruses. Phylogenetic analyses group it and other trichoviruses in a cluster. These results support that this virus, which is tentatively named cherry latent virus 1, should be considered a new member in the genus Trichovirus.

Characterization of three new viruses of the family Betaflexiviridae associated with camellia ringspot disease.

Foliar chlorotic and necrotic ringspots of different sizes were observed in many ornamental camellia (Camellia spp.) species and cultivars with or without variegation symptoms. In this study, flexuous, filamentous virions of approximately 680-780 nm long were observed by electron microscopy in sap of camellia trees with chlorotic ringspots. Five large viral contigs were identified by high-throughput sequencing technology, and complete genome sequences of them were determined. Sequence analyses show that these five isolates represent three novel viruses, two in the genus Prunevirus, one in the genus Capillovirus. The genome organization of the two camellia pruneviruses resembles that of pruneviruses but does not contain the nucleic acid-binding protein (NABP) at the 3'-terminal region. They share 66.5-66.8% with each other and 51.9-58.6% with the known pruneviruses at the genome sequence level. The genome of the camellia capillovirus contains an additional NABP at the 3'-terminus when compared to those of Capillovirus. The genomes of the two capillovirus variants are 72.7% identical to each other and 42.1-48.4% to the known capilloviruses. Phylogenetic analyses support these viruses are new members of either Prunevirus or Capillovirus. The two pruneviruses are tentatively named as camellia ringspot associated virus 1 (CRSaV-1) and CRSaV-2, and the capillovirus is named as CRSaV-3. Infections of these viruses were common in camellia species, cultivars and hybrids. The viruses were also detected in seedlings from seeds collected from two camellia trees, indicating that they are seed transmissible.