[Cytopathological characteristics of SMARCA4-deficient thoracic undifferentiated tumors in serous effusion].

Objective: To investigate the clinicopathological characteristics of SMARCA4-deficient thoracic undifferentiated tumors, and the diagnostic value of the cells in serous effusion. Methods: Eleven cases of SMARCA4-deficient tumor were collected from the Affiliated Hospital of Hebei University, China from January 2018 to July 2023, which were diagnosed using cell block of serous effusion. The clinical, histopathological, immunohistochemical and molecular genetic features were reviewed, along with related literature. Results: All the 11 patients were males with ages ranging from 54 to 77 years (median 64 years). Nine patients were smokers and two had an unknown smoking history. Most of them complained of cough and dyspnea with pleural effusion. The primary tumor sites included lung (9 cases), thoracic wall (1 case), and mediastinum (1 case), while 3 patients had a history of lung surgery. Histologically, tumor cells were large and pleomorphic, with increased nuclear-cytoplasmic ratio. They also showed round nuclei, conspicuous nucleoli, and basophilic cytoplasm in serous effusion. Immunohistochemically, tumor cells in all cases were negative for SMARCA4/BRG1, CKpan and CK7, but positive for SMARCB1/INI1. Some of the cases were positive for CD34 (7/11), synaptophysin (4/11) and SALL4 (2/11). Histologically, monotonous tumor cells formed solid sheets or anastomosing islands with poor cell adhesion and rhabdoid morphology. Brisk mitotic figures were accompanied by large areas of necrosis. Some cases focally exhibited syncytia, and some had bright cytoplasm and vesicular chromatin. The immunohistochemical profiles in the tumor tissues were consistent with those of cytology. Six cases were negative for PD-L1 (22c3). Among the 6 cases analyzed by targeted next generation sequencing, concurrent SMARCA4 and TP53 mutations were detected in all 6 cases. Some of the 6 tumors showed mutations of STK11, CDKN2A, and MET, and amplification of ERBB2, exon deletion of BRCA2, etc. Follow-up information was available in all cases and ranged from 2 to 24 months. The patients showed metastases to various sites, including lymph node, liver, kidney, adrenal gland, brain, bone and other sites. Four patients died of the tumor. The survival time of 4 patients who underwent radical resection or radiofrequency ablation was more than 13 months. Conclusions: SMARCA4-deficient thoracic sarcoma is a rare but highly aggressive tumor with dismal prognosis and rhabdomyoid features. It is difficult to diagnose this disease using only serous effusion samples. This tumor thus warrants careful consideration. Accurate diagnosis can greatly improve early diagnosis and treatment of these tumors.

Diversity of Sporocadaceae (pestalotioid fungi) from Rosa in China.

Rosa (Rosaceae) is an important ornamental and medicinal plant genus worldwide, with several species being cultivated in China. Members of Sporocadaceae (pestalotioid fungi) are globally distributed and include endophytes, saprobes but also plant pathogens, infecting a broad range of host plants on which they can cause important plant diseases. Although several Sporocadaceae species were recorded to inhabit Rosa spp., the taxa occurring on Rosa remain largely unresolved. In this study, a total of 295 diseased samples were collected from branches, fruits, leaves and spines of eight Rosa species (R. chinensis, R. helenae, R. laevigata, R. multiflora, R. omeiensis, R. rugosa, R. spinosissima and R. xanthina) in Gansu, Henan, Hunan, Qinghai, Shaanxi Provinces and the Ningxia Autonomous Region of China. Subsequently 126 strains were obtained and identified based on comparisons of DNA sequence data. Based on these results 15 species residing in six genera of Sporocadaceae were delineated, including four known species (Pestalotiopsis chamaeropis, Pes. rhodomyrtus, Sporocadus sorbi and Spo. trimorphus) and 11 new species described here as Monochaetia rosarum, Neopestalotiopsis concentrica, N. subepidermalis, Pestalotiopsis tumida, Seimatosporium centrale, Seim. gracile, Seim. nonappendiculatum, Seim. parvum, Seiridium rosae, Sporocadus brevis, and Spo. spiniger. This study also represents the first report of Pes. chamaeropis, Pes. rhodomyrtus and Spo. sorbi on Rosa. The overall data revealed that Pestalotiopsis was the most prevalent genus, followed by Seimatosporium, while Pes. chamaeropis and Pes. rhodomyrtus were the two most prevalent species. Analysis of Sporocadaceae abundance on Rosa species and plant organs revealed that spines of R. chinensis had the highest species diversity. Citation: Peng C, Crous PW, Jiang N, et al. 2022. Diversity of Sporocadaceae (pestalotioid fungi) from Rosa in China. Persoonia 49: 201-260. https://doi.org/10.3767/persoonia.2022.49.07.

[Effect of endothelial cell-targeted soluble Notch ligand hD1R protein on the proliferation of acute myeloid leukemia cells].

Objective: To evaluate the effects of endothelial cell-targeted soluble Notch ligand hD1R protein on the proliferation of acute myeloid leukemia (AML) cells. Methods: The expression levels of Notch1, Notch2, Notch3, Notch4, Hes1 in bone marrow CD34(+) cells from 24 cases of untreated AML (AML group) and 9 healthy controls (control group) were determined by real time quantitative polymerase chain reaction (PCR) . Recombinant hD1R protein was first induced and purified. Bone marrow CD34(+) cells were co-cultured on human umbilical vein endothelial cells (HUVEC) supplemented with a cocktail containing 5 types of human cytokines (5GF) and soluble hD1R. The cultured cells were tested under different culture conditions including PBS group (PBS replaces HUVEC) , hD1R group, 5GF group, GSI group (hD1R plus GSI) . Proliferation and apoptosis of cultured cells were also analyzed. Real time quantitative PCR was used to test the expression levels of Hes1 and Bcl-2 in cultured cells. Results: The expression levels of Notch1 and Hes1 in primary AML patients were significantly lower, and Notch4 expression was higher compared to the control group (P<0.05) . Cell counting showed a remarkable decrease of AML cells number in the culture with hD1R compared with that in the PBS group[ (0.74±0.13) ×10(5) vs (2.16±0.21) ×10(5), P<0.01]. FACS analysis showed that the percentage of AML cells was (18.48±2.51) % in apoptosis, which was higher than that of control cells (3.19±0.58) % after co-culture with hD1R. AML cells in the hD1R group underwent significantly increased apoptosis compared with those in the PBS one (P<0.05) . Moreover, apoptosis of AML cells in the GSI group was lower than that in the hD1R one (P<0.05) . Apoptosis in the PBS group also decreased compared with that in the 5GF one (P<0.05) . Finally, hD1R up-regulated Hes1 expression and inhibited Bcl-2 one in the AML cells. Conclusion: hD1R effectively activated Notch signaling and down-regulated Bcl-2 mRNA in AML cells, which lead to cell apoptosis.

Glucagon-like peptide-1 receptor agonists and fracture risk: a network meta-analysis of randomized clinical trials.

Our network meta-analysis analyzed the effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs) on fracture risk. By combining data from randomized controlled trials, we found that GLP-1 RAs were associated with a decreased bone fracture risk, and exenatide is the best option agent with regard to the risk of fracture. This study is registered with PROSPERO (CRD42018094433). INTRODUCTION: Data on the effects of GLP-1 RAs on fracture risk are conflicted. This study aimed to analyze the available evidence on the effects of GLP-1 RAs on fracture risk in type 2 diabetes mellitus patients. METHODS: Electronic databases were searched for relevant published articles, and unpublished studies presented at ClinicalTrials.gov were searched for relevant clinical data. All analyses were performed with STATA 12.0 and R software (Version 3.4.4). We estimated the risk ratio (RR) and 95% confidence interval (CI) by combining RRs for fracture effects of included trials. RESULTS: There were 54 eligible random control trials (RCTs) with 49,602 participants, including 28,353 patients treated with GLP-1 RAs. Relative to placebo, exenatide (RR, 0.17; 95% CI 0.03-0.67) was associated with lowest risk of fracture among other GLP-1 RAs. Exenatide had the highest probability to be the safest option with regard to the risk of fracture (0.07 ‰), followed by dulaglutide (1.04%), liraglutide (1.39%), albiglutide (5.61%), lixisenatide (8.07%), and semaglutide (18.72%). A statistically significant inconsistency was observed in some comparisons. CONCLUSION: The Bayesian network meta-analysis suggests that GLP-1 RAs were associated with a decreased bone fracture risk compared to users of placebo or other anti-hyperglycemic drugs in type 2 diabetes mellitus patients, and exenatide is the best option agent with regard to the risk of fracture.

Scalable and cost-effective Ag nanowires flexible transparent electrodes.

Flexible transparent electrodes (TEs) are important for new electronic devices. This paper reports a scalable, cost effective Ag nanowires (AgNWs) TE, which is made of a SnO2·xH2O and AgNWs composite layer and a flexible polyethylene terephthalate (PET) bottom layer by a solution method at room temperature. The AgNWs/SnO2·xH2O composite TEs reveal a significant reduction of four orders in magnitude of sheet resistance, from 90 kΩ sq-1 to 12 Ω sq-1, while retaining transmittance of about 92% at 550 nm. This could be owing to the significant reduction of contact resistance for the weld-like junction of bound AgNWs. Compared with others, this method is characterized by filling gaps of the silver nanowire network with SnO2·xH2O. In addition, the adhesive forces between the AgNWs and the substrate are improved. This could be attributed to strong adhesion of SnO2·xH2O with the substrate. Moreover, this foldable transparent electrode is applicable for any non-planar surfaces and ultimately for future wearable optoelectronic devices.

A combination of STI571 and BCR-ABL1 siRNA with overexpressed p15INK4B induced enhanced proliferation inhibition and apoptosis in chronic myeloid leukemia

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

A combination of STI571 and BCR-ABL1 siRNA with overexpressed p15INK4B induced enhanced proliferation inhibition and apoptosis in chronic myeloid leukemia.

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

Platelet factor 4 protects bone marrow mesenchymal stem cells from acute radiation injury.

OBJECTIVE: The aim of this study was to find a new radiation protector, platelet factor 4 (PF4) and to identify its effect on haemopoietic microenvironment in vitro and in vivo. METHODS: Radiation damage on bone marrow mesenchymal stem cells ex and in vitro was set up as models. Growth curve analysis, clonogenic survival assay, FACSCalibur™ (BD Immunocytometry Systems, San Jose, CA), 5-ethynyl-2'-deoxyuridine immunofluorescence staining and quantitative reverse transcription-polymerase chain reaction were employed to assess the characterization of bone marrow mesenchymal stem cells (BMSCs), proliferation, apoptosis, cell cycle and gene expression. RESULTS: A dose- and time-dependent enhancement of cell viability and survival was observed for PF4 treatment along with 500 cGy γ-radiation in vitro. The same phenomena were noted in vivo, including enhancement of adherence and proliferation ability while inhibition of cell apoptosis, which were associated with a short-term decrease in the G0/G1 ratio owing to S phase arrest. These were accompanied with enhanced Bcl-2 expression and p53/p21 loss. CONCLUSION: These results uncover that PF4 might be a novel therapeutic approach, which could reduce DNA damage and increase survival of BMSCs, in part, by inhibiting p53/p21 axis and facilitating DNA damage repair. ADVANCES IN KNOWLEDGE: This study explores the feasibility of a new radioprotector and hence may be clinically important.

Activated hypoxia-inducible factor-1α pathway modulates early events in stretch-induced skin neovascularization via stromal cell-derived factor-1 and vascular endothelial growth factor.

BACKGROUND: Tissue expansion promotes skin regeneration. These responses occur only early after mechanical load and are then replaced by apoptosis-related events during stress relaxation. The mechanism modulating this transient process remains unknown. OBJECTIVE: To elucidate key phenomena that drive early regenerative events after tissue expansion. METHODS: Intraoperative tissue expansion was performed on 25 patients undergoing facial reconstruction. Paired skin biopsies were obtained from an expanded and unexpanded site from each patient. Differentially expressed genes were inspected by microarray and bioinformatic analysis, and dissected by quantitative polymerase chain reaction, Western blot and immunostaining. Paired biopsies from another nine patients undergoing cyclical expansion for 3 months were also investigated. RESULTS: A total of 124 upregulated and 282 downregulated genes were identified. Among them, the biological terms of extracellular matrix organization and blood vessel growth were most significantly enriched, as shown by Gene Ontology analysis. GeneMANIA dissection demonstrated an interactive network highlighted by the canonical hypoxia-inducible factor-1α (HIF-1α) pathway with stromal cell-derived factor-1 (SDF-1) and vascular endothelial growth factor (VEGFA) being the hub genes. Levels of the HIF-1α protein and its targets SDF-1 and VEGFA were elevated in expanded skin, and CD31 and Ki67 expression increased, indicating augmented vascularity and cell proliferation. Trafficking of CD34(+) CD133(+) endothelial progenitor cells was enhanced in skin undergoing long-time cyclical expansion, a phenomenon that was usually modulated by the HIF-1α pathway. CONCLUSIONS: The HIF-1α pathway is quickly activated and modulates early events in stretch-induced skin neovascularization. The effect may be augmented through enhanced endothelial progenitor cells recruitment into the expanded skin.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 µm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 µm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 µl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Biochemical characterization of the cell-biomaterial interface by quantitative proteomics.

Surface topography and texture of cell culture substrata can affect the differentiation and growth of adherent cells. The biochemical basis of the transduction of the physical and mechanical signals to cellular responses is not well understood. The lack of a systematic characterization of cell-biomaterial interaction is the major bottleneck. This study demonstrated the use of a novel subcellular fractionation method combined with quantitative MS-based proteomics to enable the robust and high-throughput analysis of proteins at the adherence interface of Madin-Darby canine kidney cells. This method revealed the enrichment of extracellular matrix proteins and membrane and stress fibers proteins at the adherence surface, whereas it shows depletion of extracellular matrix belonging to the cytoplasmic, nucleus, and lateral and apical membranes. The asymmetric distribution of proteins between apical and adherence sides was also profiled. Apart from classical proteins with clear involvement in cell-material interactions, proteins previously not known to be involved in cell attachment were also discovered.

Multiple primary primitive neuroectodermal tumours within the spinal epidural space with non-concurrent onset.

A case of multiple primary primitive neuroectodermal tumours (PNETs), which occurred at different levels of the spinal epidural space successively over a period of 8 months, is reported. A 24-year-old male, presenting with rapidly progressive paralysis, hyperthesia and a posterior epidural mass extending from T8 to T10 revealed by magnetic resonance imaging (MRI), exhibited a good recovery after initial emergency surgery. Lower back pain, chest pain and paralysis were subsequently reported. Spinal MRI in month 7 revealed a mass extending from T12 to L1 and another mass extending from T4 to T5 was detected epidurally in month 8. Additional operations were performed and radiotherapy was given. Pathological findings were consistent with PNETs and symptoms improved with treatment, particularly following each surgical excision.

Reduction of blood pressure with calcium and potassium supplementation in children with salt sensitivity: a 2-year double-blinded placebo-controlled trial.

An investigation of the reductive effect of blood pressure and increment of urinary sodium excretion with calcium and potassium supplementation in children with sodium sensitivity is conducted. In total of 261 school children who had completed a 2-year double-blinded, placebo-controlled trial with calcium and potassium supplementation salt sensitivity, with a salt volume expansion and contraction protocol, was determined. The results showed that in children with salt sensitivity, the increase in blood pressure in the supplementary group was lower by 4.3/4.8 mmHg than that in the placebo group (P<0.05), while no significant change was found between the supplementary group and placebo group in children with nonsalt sensitivity. With calcium and potassium supplementation, the night urinary sodium excretion in children with salt sensitivity was significantly increased (P<0.01), and it is negatively correlated with the increase in blood pressure. It was suggested that a moderate increase of calcium and potassium intake in children with salt sensitivity, through interaction with sodium, can promote urinary sodium excretion and may play contribute to the prevention of hypertension.

Effects of intravascular perfusion of cooled crystalloid solution on cold-induced brain injury using an extracorporeal cooling-filtration system.

BACKGROUND: We evaluated cerebral metabolic change during brain hypothermia with intravascular perfusion of cooled crystalloid solution using an extracorporeal cooling-filtration system and cerebroprotective effects of this hypothermia on brain injury in an animal model. METHOD: Microdialysis probes were implanted into the bilateral parietal cortices. A cold-induced brain injury was produced behind the microdialysis probe on the right parietal cortex. Immediately after injury in the cooled group (n=9), Ringer's solution cooled to 5 degrees C was infused into the right vertebral artery after occlusion of the bilateral common carotid and the left vertebral arteries. Excessive fluid was ultrafiltrated by a dialyzer. Brain temperature was maintained at about 20 degrees C for 60 minutes. In 7 dogs, three neck arteries were occluded for 60 minutes after injury without cooled fluid infusion. The extracellular concentrations of glutamate, lactate, and pyruvate were measured serially for 180 minutes after injury. FINDINGS: Extracellular glutamate concentrations in the cooled group did not increase, while there was a significant increase in the injured hemisphere as compared to the uninjured hemisphere in the non-cooled group ( P<0.05). Extracellular lactate concentrations increased slightly after occlusion in both groups. The depth of cortical injury was limited in the cooled group, but extended into the white matter in the non-cooled group up to 240 minutes after injury. INTERPRETATION: Occlusion of three main arteries induced ischaemia under critical threshold in canine brains. Under this condition, intravascular cooling with crystalloid solution suppressed accumulation of extracellular glutamate and reduced tissue damage in the early phase after cold-induced brain injury, as cerebroprotective effects. This information suggests that a method employing brain hypothermia via intra-arterial cooling with an extracorporeal cooling-filtration system has potential to achieve successful, safe, selective brain cooling.

The structure dependent electrochemical-response of novel 1-(4-mercaptobutyl)-4-(2-ferrocenylvinyl)pyridinium bromide SAMs on an au electrode.

The 1-(4-mercaptobutyl)-4-(2-ferrocenylvinyl)pyridinium bromide (1-HS(CH2)(4)-4-[(E)-FcCH=CH]C5H4N)+Br- and its hydrogenated product [1-HS(CH2)(4)-4-(-FcCH2CH2)C5H4N]+Br- were synthesized and assembled on an Au electrode to form self-assembled monolayers which showed a structure-dependent electrochemical-response in phosphate buffer aqueous solutions (pH = 7).

Purification, characterization and activation of fish muscle prokallikrein.

Fish prokallikrein was isolated and characterized from skeletal muscle of the black sea bass, Centropristis striata. The prokallikrein was purified to apparent homogeneity by anion exchange perfusion chromatography and reversed phase high performance liquid chromatography. Initial identification was by its weak immunoreactivity with human tissue kallikrein antiserum. Two-dimensional gel electrophoresis and immunoblotting identified the protein as 36 kDa with a pI of 4.95-5.15. The prokallikrein was trypsin-activated to produce an approximately 36 kDa active enzyme as identified on an SDS-polyacrylamide gel overlayed with a membrane impregnated with the fluorogenic tripeptidyl substrate D-Val-Leu-Arg-7-amino-4-trifluoromethyl-coumarin. A potential dimer at 72 kDa was also enzymatically active. Bass kallikrein cleaved low molecular weight dog kininogen to release kinin peptide as determined by radioimmunoassay. The enzyme's amidolytic activity, with a pH optimum at 9.0, was inhibited by aprotinin, benzamidine, and phenylmethanesulphonyl fluoride, but not by elastatinal, soybean trypsin inhibitor, or limabean trypsin inhibitor. Polyclonal antiserum raised against the purified bass muscle prokallikrein recognized 36 kDa and 72 kDa proteins in bass heart, skeletal muscle, spleen, swimbladder, gill, and kidney by Western blot analyses. The wide distribution of immunoreactive proteins in the tissues suggests a potential physiological role for fish kallikreins in muscle contraction and/or relaxation, the regulation of local blood flow, and in osmoregulation. The detection of fish prokallikrein and its activation leads the way for an evaluation of the impact of kallikreins in fish health and disease processes and for studying the evolution of kallikreins and related serine proteinases.

Kallistatin is a potent new vasodilator.

Kallistatin is a serine proteinase inhibitor which binds to tissue kallikrein and inhibits its activity. The aim of this study is to evaluate if kallistatin has a direct effect on the vasculature and on blood pressure homeostasis. We found that an intravenous bolus injection of human kallistatin caused a rapid, potent, and transient reduction of mean arterial blood pressure in anesthetized rats. Infusion of purified kallistatin (0.07-1.42 nmol/kg) into cannulated rat jugular vein produced a 20-85 mmHg reduction of blood pressure in a dose-dependent manner. Hoe 140, a bradykinin B2-receptor antagonist, had no effect on the hypotensive effect of kallistatin yet it abolished the blood pressure-lowering effect of kinin and kallikrein. Relaxation of isolated aortic rings by kallistatin was observed in the presence (ED50 of 3.4 x 10(-9) M) and in the absence of endothelium (ED50 of 10(-9) M). Rat kallikrein-binding protein, but not kinin or kallikrein, induced vascular relaxation of aortic rings. Neither Hoe 140 nor Nomega-nitro--arginine methyl ester, a nitric oxide synthase inhibitor, affected vasorelaxation induced by kallistatin. Kallistatin also caused dose-dependent vasodilation of the renal vasculature in the isolated, perfused rat kidney. Specific kallistatin-binding sites were identified in rat aorta by Scatchard plot analysis with a Kd of 0.25+/-0.07 nM and maximal binding capacity of 47.9+/-10.4 fmol/mg protein (mean+/-SEM, n = 3). These results indicate that kallistatin is a potent vasodilator which may function directly through a vascular smooth muscle mechanism independent of an endothelial bradykinin receptor. This study introduces the potential significance of kallistatin in directly regulating blood pressure to reduce hypertension.

Tissue kallikrein-binding protein reduces blood pressure in transgenic mice.

The kallikrein-kinin system participates in blood pressure regulation. One of the kallikrein-kinin system components, kallikrein-binding protein, binds to tissue kallikrein and inhibits its activity in vitro. To investigate potential roles of rat kallikrein-binding protein (RKBP) in vivo, we have developed transgenic mice that express an RKBP gene under the control of the mouse metallothionein metal-responsive promoter. Expression of the transgene, RKBP, was detected in the liver, kidney, lung, heart, pancreas, salivary glands, spleen, brain, testis, and adrenal gland at the mRNA and protein levels. Systolic blood pressures of homozygous transgenic mice were 88.5 +/- 0.8 mm Hg (mean +/- S.E., n = 19, P < 0.001) for one line and 88.8 +/- 1.6 mm Hg (mean +/- S.E., n = 19, P < 0.001) for another, as compared with 100.5 +/- 0.8 mm Hg (mean +/- S.E., n = 18) for control mice. Direct blood pressure measurements of these transgenic mice through an arterial cannula showed similar reductions of blood pressure. Intravenous injection of purified RKBP into mice via a catheter produced a dose-dependent reduction of the mean arterial blood pressure. Our findings suggest that RKBP may function as a vasodilator in vivo, independent of regulating the activity of tissue kallikrein.

Biomass dynamics and water use efficiencies of five plant communities in the shortgrass steppe.

Standing crop biomass and water-use efficiency were estimated for five plant communities of the Central Plains Experimental Range in north central Colorado. Aboveground biomass by functional groups, surface litter amounts, and standing dead biomass were compared, as were vertical and size-class distributions of belowground biomass. Greater production and water-use efficiency values were found: (1) at coarse-textured sites, indicating the importance of the inverse texture effect, and (2) wherever site characteristics favored the establishment of lifeforms other than grasses, e.g., succulents, and shrubs. Seasonal aboveground biomass and water-use efficiencies for the grass component were similar among sites, even though the mixes of C3 and C4 grass species were different. Similar grass biomass values in very different communities suggested that high biomass and high water-use efficiencies were related less to grass types than to the abundance of non-grass life-forms.