Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 16 de 16
Filtrar
Más filtros










Base de datos
Intervalo de año de publicación
1.
Atherosclerosis ; 391: 117478, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38417185

RESUMEN

BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.


Asunto(s)
Aterosclerosis , Placa Aterosclerótica , Ratones , Animales , FN-kappa B/metabolismo , Factor 88 de Diferenciación Mieloide/metabolismo , Factor 88 de Diferenciación Mieloide/farmacología , Receptor Toll-Like 4/metabolismo , Aterosclerosis/tratamiento farmacológico , Aterosclerosis/prevención & control , Aterosclerosis/genética , Placa Aterosclerótica/metabolismo , Transducción de Señal , Macrófagos/metabolismo , Lípidos
2.
Artículo en Inglés | MEDLINE | ID: mdl-38311916

RESUMEN

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

3.
Int J Biol Macromol ; 261(Pt 2): 129793, 2024 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-38290627

RESUMEN

A water-soluble glycopeptide (named GL-PWQ3) with a molecular weight (Mw) of 2.40 × 104 g/mol was isolated from Ganoderma lucidum fruiting body by hot water extraction, membrane ultrafiltration, and gel column chromatography, which mainly consisted of glucose and galactose. Based on the methylation, FT-IR, 1D, and 2D NMR analysis, the polysaccharide portion of GL-PWQ3 was identified as a glucogalactan, which was comprised of unsubstituted (1,6-α-Galp, 1,6-ß-Glcp, 1,4-ß-Glcp) and monosubstituted (1,2,6-α-Galp and 1,3,6-ß-Glcp) in the backbone and possible branches that at the O-3 position of 1,3-Glcp and T-Glcp, and the O-2 position of T-Fucp, T-Manp or T-Glcp. The chain conformational study by SEC-MALLS-RI and AFM revealed that GL-PWQ3 was identified as a highly branched polysaccharide with a polydispersity index of 1.25, and might have compact sphere structures caused by stacked multiple chains. Moreover, the GL-PWQ3 shows strong anti-oxidative activity in NRK-52E cells. This study provides a theoretical basis for further elucidating the structure-functionality relationships of GL-PWQ3 and its potential application as a natural antioxidant in pharmacotherapy as well as functional food additives.


Asunto(s)
Reishi , Reishi/química , Espectroscopía Infrarroja por Transformada de Fourier , Polisacáridos/química , Glucosa/análisis , Peso Molecular , Agua
4.
Stem Cell Res Ther ; 15(1): 14, 2024 01 08.
Artículo en Inglés | MEDLINE | ID: mdl-38191526

RESUMEN

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.


Asunto(s)
Células Madre Mesenquimatosas , Ovario , Femenino , Animales , Macaca mulatta , Peróxido de Hidrógeno , Envejecimiento
5.
Mol Biotechnol ; 65(7): 1076-1084, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-36436163

RESUMEN

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.


Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón Umbilical
6.
Acta Pharmacol Sin ; 41(6): 782-790, 2020 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-31911637

RESUMEN

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) retards PKD renal cyst development. In the present study we identified the effective ingredient of GT in suppression of kidney cyst development. Using an in vitro MDCK cystogenesis model, we identified ganoderic acid A (GA-A) as the most promising candidate among the 12 ganoderic acid (GA) monomers. We further showed that GA-A (6.25-100 µM) significantly inhibited cyst growth in MDCK cyst model and embryonic kidney cyst model in vitro, and the inhibitory effect was reversible. In kidney-specific Pkd1 knockout (kPKD) mice displaying severe cystic kidney disease, administration of GA-A (50 mg· kg-1 ·d-1, sc) significantly attenuated renal cyst development. In both MDCK cells and kidney of kPKD mice, we revealed that GA-A dose-dependently downregulated the Ras/MAPK signaling pathway. The expression of proliferating cell nuclear antigen (PCNA) was also suppressed, suggesting a possible effect of GA-A on cell proliferation. These experimental data suggest that GA-A may be the main ingredient of GT as a potential therapeutic reagent for treating ADPKD.


Asunto(s)
Ganoderma/química , Ácidos Heptanoicos/farmacología , Lanosterol/análogos & derivados , Enfermedades Renales Poliquísticas/tratamiento farmacológico , Animales , Proliferación Celular/efectos de los fármacos , Células Cultivadas , Modelos Animales de Enfermedad , Perros , Relación Dosis-Respuesta a Droga , Ácidos Heptanoicos/administración & dosificación , Ácidos Heptanoicos/aislamiento & purificación , Inyecciones Subcutáneas , Lanosterol/administración & dosificación , Lanosterol/aislamiento & purificación , Lanosterol/farmacología , Células de Riñón Canino Madin Darby/efectos de los fármacos , Ratones , Ratones Endogámicos C57BL , Ratones Endogámicos ICR , Enfermedades Renales Poliquísticas/patología
7.
Acta Pharmacol Sin ; 41(5): 670-677, 2020 May.
Artículo en Inglés | MEDLINE | ID: mdl-31804606

RESUMEN

Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety of pharmacological activities. In this study we investigated whether GA exerted antirenal fibrosis effect in a unilateral ureteral obstruction (UUO) mouse model. After UUO surgery, the mice were treated with GA (3.125, 12.5, and 50 mg· kg-1 ·d-1, ip) for 7 or 14 days. Then the mice were sacrificed for collecting blood and kidneys. We showed that GA treatment dose-dependently attenuated UUO-induced tubular injury and renal fibrosis; GA (50 mg· kg-1 ·d-1) significantly ameliorated renal disfunction during fibrosis progression. We further revealed that GA treatment inhibited the extracellular matrix (ECM) deposition in the kidney by suppressing the expression of fibronectin, mainly through hindering the over activation of TGF-ß/Smad signaling. On the other hand, GA treatment significantly decreased the expression of mesenchymal cell markers alpha-smooth muscle actin (α-SMA) and vimentin, and upregulated E-cadherin expression in the kidney, suggesting the suppression of tubular epithelial-mesenchymal transition (EMT) partially via inhibiting both TGF-ß/Smad and MAPK (ERK, JNK, p38) signaling pathways. The inhibitory effects of GA on TGF-ß/Smad and MAPK signaling pathways were confirmed in TGF-ß1-stimulated HK-2 cell model. GA-A, a GA monomer, was identified as a potent inhibitor on renal fibrosis in vitro. These data demonstrate that GA or GA-A might be developed as a potential therapeutic agent in the treatment of renal fibrosis.


Asunto(s)
Proteínas Smad/antagonistas & inhibidores , Factor de Crecimiento Transformador beta/antagonistas & inhibidores , Triterpenos/farmacología , Obstrucción Ureteral/tratamiento farmacológico , Animales , Células Cultivadas , Modelos Animales de Enfermedad , Relación Dosis-Respuesta a Droga , Humanos , Inyecciones Intraperitoneales , Sistema de Señalización de MAP Quinasas/efectos de los fármacos , Masculino , Ratones , Ratones Endogámicos C57BL , Transducción de Señal/efectos de los fármacos , Proteínas Smad/metabolismo , Factor de Crecimiento Transformador beta/metabolismo , Triterpenos/administración & dosificación , Obstrucción Ureteral/metabolismo , Obstrucción Ureteral/cirugía
8.
J Inorg Biochem ; 182: 184-193, 2018 05.
Artículo en Inglés | MEDLINE | ID: mdl-29501979

RESUMEN

Autophagy and apoptosis are two different biological processes that determine cell fates. We previously reported that autophagy inhibition and apoptosis induction are involved in lead(II)-induced cytotoxicity in primary rat proximal tubular (rPT) cells, but the interplay between them remains to be elucidated. Firstly, data showed that lead(II)-induced elevation of LC3-II protein levels can be significantly modulated by 3-methyladenine or rapamycin; moreover, protein levels of Autophagy-related protein 5 (Atg5) and Beclin-1 were markedly up-regulated by lead(II) treatment, demonstrating that lead(II) could promote the autophagosomes formation in rPT cells. Next, we applied three pharmacological agents and genetic method targeting the early stage of autophagy to validate that enhancement of autophagosomes formation can inhibit lead(II)-induced apoptotic cell death in rPT cells. Simultaneously, lead(II) inhibited the autophagic degradation of rPT cells, while the addition of autophagic degradation inhibitor bafilomycin A1 aggravated lead(II)-induced apoptotic death in rPT cells. Collectively, this study provided us a good model to know about the dynamic process of lead(II)-induced autophagy in rPT cells, and the interplay between autophagy and apoptosis highlights a new sight into the mechanism of lead(II)-induced nephrotoxicity.


Asunto(s)
Apoptosis/efectos de los fármacos , Autofagia/efectos de los fármacos , Túbulos Renales Proximales/citología , Plomo/toxicidad , Adenina/análogos & derivados , Adenina/farmacología , Animales , Proteína 5 Relacionada con la Autofagia/metabolismo , Beclina-1/metabolismo , Células Cultivadas , Proteínas Asociadas a Microtúbulos/metabolismo , Ratas , Sirolimus/farmacología
9.
Vaccine ; 34(1): 83-9, 2016 Jan 02.
Artículo en Inglés | MEDLINE | ID: mdl-26611202

RESUMEN

The virulent isolate SDZB0808 of QX-type infectious bronchitis virus (IBV) was continuously passaged in chicken embryos for 110 generations. The safety and immune efficacy of the 110th generation of IBVs (P110) were evaluated. Damage was not found in the appearance of the 3-day-old specific-pathogen-free (SPF) chicks immunized with 10(4.5) EID50 (median embryo infective dose) of P110 by intranasal and ocular administration. At 14 d after the vaccination with 10(4.5) EID50 of P110, all the 3-day-old SPF chicks were immune from the attack of the homologous virulent strain SDZB0808 and the heterologous virulent strain SDIB821/2012. The whole genome sequencing of SDZB0808 of different generations (P1-P110) indicated that the replicase 1a sequences of P60-P110 all lost a length of 30bp in the same region. Specific primers were designed according to the differences in the genomes of P1-P110. SYBR Green I real-time quantitative PCR was adopted to analyze the proportion of the viruses with 30bp deletion in P60, P100, and P110. Results showed that with the passage in chicken embryos, the proportion of the viruses with 30bp deletion gradually increased. Almost 100% of the viruses in the P110 had 30bp deletion in the replicase 1a sequence. Therefore, the attenuation of IBV's virulence may be the outcome of directional screening in the chicken embryos. This work confirmed the high safety and immune efficacy of P110 in SPF chickens. Thus, P110 can serve as an attenuated IBV vaccine candidate.


Asunto(s)
Infecciones por Coronavirus/veterinaria , Genotipo , Virus de la Bronquitis Infecciosa/patogenicidad , Mutación , Enfermedades de las Aves de Corral/prevención & control , Pase Seriado , Vacunas Virales/inmunología , Administración Intranasal , Administración Oftálmica , Animales , Embrión de Pollo , Pollos , Infecciones por Coronavirus/prevención & control , Efectos Colaterales y Reacciones Adversas Relacionados con Medicamentos , Genoma Viral , Virus de la Bronquitis Infecciosa/genética , ARN Polimerasa Dependiente del ARN/genética , Análisis de Secuencia de ADN , Eliminación de Secuencia , Vacunas Atenuadas/administración & dosificación , Vacunas Atenuadas/efectos adversos , Vacunas Atenuadas/inmunología , Vacunas Atenuadas/aislamiento & purificación , Vacunas Virales/administración & dosificación , Vacunas Virales/efectos adversos , Vacunas Virales/aislamiento & purificación , Virulencia
10.
Biomed Environ Sci ; 26(4): 258-67, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-23534466

RESUMEN

OBJECTIVE: To investigate the protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular (rPT) cells. METHODS: Primary cultures of rPT cells undergoing exponential growth were incubated with 1.0 µg/mL quercetin and/or cadmium (2.5, 5.0 µmol/L), in a serum-free medium at 37 °C at different time intervals. Commercial kits were used and flow cytometric analyses were performed on rPT cell cultures to assay apoptosis and oxidative stress. RESULTS: Exposure of rPT cells to cadmium acetate (2.5, 5.0 µmol/L) induced a decrease in cell viability, caused an increase in apoptotic rate and apoptotic morphological changes. Simultaneously, elevation of intracellular reactive oxygen species, malondialdehyde and calcium levels, depletion of mitochondrial membrane potential and intracellular glutathione, and inhibition of Na+, K+-ATPase, Ca2+-ATPase, glutathione peroxidase (GSH-Px), catalase (CAT), and superoxide dismutase (SOD) activities were revealed during the cadmium exposure of rPT cells. However, simultaneous supplementation with 1 µg/mL quercetin protected rPT cells against cadmium-induced cytotoxicity through inhibiting apoptosis, attenuating lipid peroxidation, renewing mitochondrial function and elevating the intracellular antioxidants (non-enzymatic and enzymic) levels. CONCLUSION: The present study has suggested that quercetin, as a widely distributed dietary antioxidant, contributes potentially to prevent cadmium-induced cytotoxicity in rPT cells.


Asunto(s)
Antioxidantes/uso terapéutico , Intoxicación por Cadmio/prevención & control , Cadmio/toxicidad , Túbulos Renales Proximales/efectos de los fármacos , Quercetina/uso terapéutico , Animales , Antioxidantes/farmacología , Apoptosis/efectos de los fármacos , Calcio/metabolismo , ATPasas Transportadoras de Calcio/metabolismo , Células Cultivadas , Túbulos Renales Proximales/metabolismo , Malondialdehído/metabolismo , Potencial de la Membrana Mitocondrial/efectos de los fármacos , Quercetina/farmacología , Ratas , Especies Reactivas de Oxígeno/metabolismo , ATPasa Intercambiadora de Sodio-Potasio/metabolismo
11.
Beijing Da Xue Xue Bao Yi Xue Ban ; 39(6): 653-6, 2007 Dec 18.
Artículo en Chino | MEDLINE | ID: mdl-18087562

RESUMEN

OBJECTIVE: To find out the effects of Ganoderma lucidum polysaccharides peptide (Gl-PP) on the invasion of the human lung carcinoma cell (PG cell). METHODS: PG cells were pretreated with different concentration Gl-PP in vitro, using cell proliferation assay, cell migration assay, adhesion assay, zymography and RT-PCR, then the effects of Gl-PP on proliferation, motility, adhesion and MMP-9 activity and mRNA expression of PG cells were investigated in vitro. RESULTS: Gl-PP did not directly inhibit PG cell proliferation in vitro. However, pretreated with Gl-PP, PG cells motility was inhibited significantly. PG cells adhesion was also inhibited. The activity of MMP-9 was inhibited in a dose-dependent manner, and the inhibited ratio was 41.53% at a dose of 100 mg/L Gl-PP. The mRNA expression of MMP-9 of pretreated PG cells was inhibited. CONCLUSION: Gl-PP could suppress invasion of human lung carcinoma cells in vitro.


Asunto(s)
Movimiento Celular/efectos de los fármacos , Proteoglicanos/farmacología , Reishi , Adhesión Celular/efectos de los fármacos , Línea Celular Tumoral , Proliferación Celular/efectos de los fármacos , Humanos , Neoplasias Pulmonares/metabolismo , Neoplasias Pulmonares/patología , Metaloproteinasa 9 de la Matriz/metabolismo , Invasividad Neoplásica
12.
Pharmacol Biochem Behav ; 86(4): 693-8, 2007 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-17383716

RESUMEN

Ganoderma lucidum has been used for the treatment of a variety of diseases. For the first time here we report a detailed study on the mechanisms and effects of G. lucidum aqueous extract (GLE) on sleep and its sedative activity. GLE showed no effects on sleep architecture in normal rats at doses of 80 and 120 mg/kg. However, GLE significantly decreased sleep latency, increased sleeping time, non-REM sleep time and light sleep time in pentobarbital-treated rats. Suppression of locomotor activity in normal mice induced by GLE was also observed. Flumazenil, a benzodiazepine receptor antagonist, at a dose of 3.5 mg/kg showed a significant antagonistic effect on the shortening in sleep latency, increase in sleeping time, non-REM sleep time or light sleep time in pentobarbital-treated rat induced by GLE. Significant effect was also observed with GLE on delta activity during non-REM sleep and flumazenil did not block this effect. In conclusion, GLE may be a herb having benzodiazepine-like hypnotic activity at least in part.


Asunto(s)
Medicamentos Herbarios Chinos/administración & dosificación , Pentobarbital/administración & dosificación , Reishi/química , Sueño/efectos de los fármacos , Sueño/fisiología , Ácido gamma-Aminobutírico/fisiología , Animales , Sinergismo Farmacológico , Flumazenil/administración & dosificación , Moduladores del GABA/administración & dosificación , Antagonistas de Receptores de GABA-A , Hipnóticos y Sedantes/administración & dosificación , Masculino , Ratones , Ratones Endogámicos ICR , Actividad Motora/efectos de los fármacos , Ratas , Ratas Sprague-Dawley , Sueño REM/efectos de los fármacos
13.
Yao Xue Xue Bao ; 42(10): 1058-61, 2007 Oct.
Artículo en Chino | MEDLINE | ID: mdl-18229612

RESUMEN

GL-PP-3A, an active polysaccharide peptide, was isolated and purified from Ganoderma lucidum, and then its structure was analyzed. Crude polysaccharide peptides were extracted from Ganoderma lucidum with hot water, precipitated with ethanol and then dialyzed from Ganoderma lucidum. Subsequently GL-PP-3A was isolated and purified from the crude polysaccharide peptides by fractional precipitation and chromatography of Bio-Gel P-10 column. The repetitive unit of GL-PP-3A was analyzed by high performance gel permeation chromatography (HPGPC), monosaccharide composition and methylation analysis, 1H NMR and 13C NMR. GL-PP-3A is a heteropolysaccharide which is composed mainly of glucose (Glc), and also contains saccharide residues such as rhamnose (Rha), xylose (Xyl), mannose (Man) and galactose (Gal) and 17 kinds of amino acids. Its weight-average molecular weight (Mw) and number-average molecular weight (Mn) were 1.7 x 10(4) and 1.1 x 10(4), respectively, with the ratio of Mw/Mn ( molecular weight distribution) being of 1.49. Its backbone chain is composed of 1,6-linked beta-D-Glcp and 1,3-liked beta-D-Glcp at a ratio of 2:1. Some of 1,6-linked glucose residuals of the backbone chain are substituted at 2-0 or 3-0, and there are 1 to 3 1,6-linked beta-D-Galp or 1,3-linked alpha-D-Manp in the branched chains, the nonreducing ends of which consist mainly of beta-D-Glcp and a few Rha.


Asunto(s)
Polisacáridos/química , Polisacáridos/aislamiento & purificación , Proteoglicanos/química , Proteoglicanos/aislamiento & purificación , Reishi/química , Aminoácidos/análisis , Cromatografía Líquida de Alta Presión , Glucosa/análisis , Espectroscopía de Resonancia Magnética , Peso Molecular , Plantas Medicinales/química , Ramnosa/análisis , Espectrofotometría Ultravioleta
14.
Appl Microbiol Biotechnol ; 72(3): 537-43, 2006 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-16411085

RESUMEN

Genetic marker technology designed to detect naturally occurring polymorphisms at the DNA level had become an invaluable and revolutionizing tool for both applied and basic studies of fungi. To eliminate the confusion on the taxonomy of Ganoderma strains, in this study, a collection of 31 accessions representative of morphotypes and some unclassified types was used for analyzing molecular diversity using a novel molecular marker sequence-related amplified polymorphism (SRAP). This collection included commercial cultivars and wild varieties that represented the great diversification of types from different countries and regions. The experimental results showed that 50 out of 95 combinations of primers turned out to be polymorphic, and 85 polymorphism bands were obtained using six combinations. Based on the appearances of markers, the genetic similarity coefficients were calculated, and genetic variations were observed (0 approximately 1) among the 31 different Ganoderma strains. The group of Ganoderma lucidum showed significant differences from the group of Ganoderma sinense. Moreover, G. lucidum in China was also different from G. lucidum in Yugoslavia. At the same time, cluster analysis successfully categorized these 31 Ganoderma strains into five groups. These results revealed the genetic diversity of Ganoderma strains and their correlation with geographic environments. It also suggested SRAP marker could be used in the taxonomic analysis of fungi. To our knowledge, this is the first application of SRAP marker on the systematics of Ganoderma strains within basidiomycetes.


Asunto(s)
Ganoderma/clasificación , Ganoderma/genética , Variación Genética , Reacción en Cadena de la Polimerasa/métodos , Marcadores Genéticos , Filogenia , Polimorfismo Genético
15.
Beijing Da Xue Xue Bao Yi Xue Ban ; 37(6): 569-74, 2005 Dec 18.
Artículo en Chino | MEDLINE | ID: mdl-16378103

RESUMEN

OBJECTIVE: To compare the immunomodulatory effects of spore polysaccharides (Gl-SP) and broken spore polysaccharides (Gl-BSP) isolated from Ganoderma lucidum(Leyss et Fr.) Karst. on murine splenic lymphocytes and peritoneal macrophages in vitro. METHODS: Mixed lymphocyte culture reaction (MLR), lymphocyte proliferation in the presence or absence of mitogen, and the cytotoxic activity of splenic natural killer (NK) cells were detected with MTT assay in vitro. The percentage of phagocytosis of neutral red (NR) by mouse peritoneal macrophages was detected by colorimetric assay. Splenic T-lymphocyte subpopulations were measured with flow cytometry(FCM). IL-2, IFN-gamma and TNF-alpha in the culture supernatants were detected by ELISA and biological assay. Nitric oxide (NO) production was examined by Griess reaction. RESULTS: At the concentration range of 0.2-12.8 mg/L, Gl-SP and Gl-BSP were shown to increase lymphocyte proliferation in the presence or absence of mitogen, enhance NK cytotoxic activity, augment the production of TNF-alpha and NO in Gl-SP- or Gl-BSP-activated macrophages, as well the percentage of phagocytosis of NR by macrophages in vitro. Both Gl-SP and Gl-BSP could promote MLR, however, at the dose of 12.8 mg/L, Gl-BSP showed higher activity than Gl-SP in the proliferation of lymphocytes. These two kinds of polysaccharide could significantly increase the secretion of IL-2 and IFN-gamma in doublejway MLR at the concentrations of 0.2-12.8 mg/L, but Gl-BSP had stronger effects than Gl-SP at the same concentrations. Both Gl-SP and Gl-BSP could increase the ratio of T-lymphocyte subpopulations in double-way MLR. At the concentrations of 0.2-12.8 mg/L or 3.2-12.8 mg/L, Gl-BSP demonstrated more significant activity in increasing the percentage of the CD4(+) or CD8(+) subset than Gl-SP. At the concentrations of 0.2-0.8 mg/L, the ratio of the CD4(+) and CD8(+) subset in the Gl-BSP treated group was higher than that of the Gl-SP treated group. CONCLUSION: Gl-SP and Gl-BSP have similar immunomodulatory effects in vitro, as though the immunomodulatory effects of Gl-BSP are stronger than that of Gl-SP.


Asunto(s)
Adyuvantes Inmunológicos/farmacología , Linfocitos/efectos de los fármacos , Macrófagos Peritoneales/efectos de los fármacos , Polisacáridos/farmacología , Reishi/química , Animales , Supervivencia Celular/efectos de los fármacos , Supervivencia Celular/inmunología , Ensayo de Inmunoadsorción Enzimática , Femenino , Citometría de Flujo , Interferón gamma/análisis , Interleucina-2/análisis , Linfocitos/inmunología , Linfocitos/metabolismo , Macrófagos Peritoneales/inmunología , Macrófagos Peritoneales/metabolismo , Masculino , Ratones , Ratones Endogámicos BALB C , Ratones Endogámicos C57BL , Polisacáridos/aislamiento & purificación , Bazo/citología , Esporas Fúngicas/química , Linfocitos T Citotóxicos/efectos de los fármacos , Linfocitos T Citotóxicos/inmunología , Factor de Necrosis Tumoral alfa/análisis
16.
J Pharmacol Sci ; 95(2): 294-8, 2004 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-15215656

RESUMEN

The effect of polysaccharide extract isolated from Ganoderma lucidum (Gl-PS) on rat cortical neuronal cultures exposed to hypoxia/reoxygenation (H/R) was studied in vitro. Gl-PS (1, 10, 100 microg/ml) increased neuron viability following H/R as measured by the inhibition of MTT reduction. Gl-PS also significantly reduced malondialdehyde content and reactive oxygen species production and increased the manganese superoxide dismutase (Mn-SOD) activity; furthermore, the translocation of nuclear factor-kappa B induced by H/R was blocked. These findings suggest that Gl-PS might be useful in treating H/R-induced oxidative stress and Mn-SOD might play a critical role in the neuroprotective effect of Gl-PS against H/R injury.


Asunto(s)
Corteza Cerebral/patología , Hipoxia Encefálica/patología , Hipoxia Encefálica/prevención & control , Fármacos Neuroprotectores , Polisacáridos/farmacología , Reishi/química , Animales , Supervivencia Celular/efectos de los fármacos , Células Cultivadas , Corteza Cerebral/efectos de los fármacos , Técnica del Anticuerpo Fluorescente , Malondialdehído/metabolismo , Microscopía Confocal , FN-kappa B , Estrés Oxidativo/efectos de los fármacos , Oxígeno/farmacología , Polisacáridos/aislamiento & purificación , Ratas , Ratas Sprague-Dawley , Superóxido Dismutasa/metabolismo , Sales de Tetrazolio , Tiazoles
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA