RESUMEN
Objective To analyze the control status and influencing factors of glycosylated hemoglobin (HbA1c) in children with type 1 diabetes mellitus (T1DM) in Tianjin from 2020 to 2021, and to provide a theoretical basis for controlling blood glucose in children with type 1 diabetes mellitus. Methods A total of 538 children with type 1 diabetes, including 275 males and 263 females, were selected from our hospital from January 2020 to June 2021. All the children were determined according to the level of HbA1c and divided into well-controlled group (HbA1c<7.0%, n=469) and poorly controlled group (HbA1c≥7.0%, n=69), 3ml fasting elbow venous blood was extracted from the two groups, and the levels of HbA1c, FPG, 2hPG, TC and LDL-C were compared between the two groups. Clinical data of the children were collected from the medical record system. The factors affecting the control of HbA1c in children with type 1 diabetes were analyzed by univariate analysis and logistic regression. Results The comparison of general data between the two groups showed no significant difference in age, sex and course of type 1 diabetes mellitus (P<0.05). The levels of HbA1c, FPG, 2hPG, TC and LDL-C in poorly controlled group were significantly higher than those in well controlled group (P<0.05). The blood glucose monitoring <60 times/month (OR=3.017), uncontrolled diet (OR=2.871), obesity (OR=2.623) were independent risk factors for poor control of HbA1c in children with type 1 diabetes (P<0.05). Conclusions Children with type 1 diabetes mellitus have a greater risk of poor control of HbA1c. It is necessary to strengthen publicity and education for parents of children with diabetes, regularly monitor blood glucose and control diet to effectively improve blood glucose control in children.
RESUMEN
Objective:To explore the current status of surgery for portal hypertension to grasp current status and future development of surgery in China.Methods:This study is jointly sponsored by China Hepatobiliary & Pancreatic Specialist Alliance & Portal Hypertension Alliance in China (CHESS).Comprehensive surveying is conducted for basic domestic situations of surgery for portal hypertension, including case load, surgical approaches, management of postoperative complications, primary effects, existing confusion and obstacles, liver transplantation(LT), laparoscopic procedures and transjugular intrahepatic portosystemic shunt(TIPS), etc.Results:A total of 8 512 cases of portal hypertension surgery are performed at 378 hospitals nationwide in 2021.Splenectomy plus devascularization predominated(53.0%)and laparoscopy accounted for 76.1%.Primary goal is preventing rebleeding(67.0%) and 72.8% of hospitals used preventive anticoagulants after conventional surgery.And 80.7% of teams believe that the formation of postoperative portal vein thrombosis is a surgical dilemma and 65.3% of hospitals practiced both laparoscopy and TIPS.The major reasons for patients with portal hypertension not receiving LT are due to a lack of qualifications for LT(69.3%)and economic factors(69.0%).Conclusions:Surgery is an integral part of management of portal hypertension in China.However, it is imperative to further standardize the grasp of surgical indications, the handling of surgical operation and the management of postoperative complications.Moreover, prospective, multi-center randomized controlled clinical studies should be performed.
RESUMEN
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
RESUMEN
Dermatomyositis with malignancy is a subtype of dermatomyositis, and the concurrence of malignancy is a major factor for poor prognosis of dermatomyositis. Malignancy usually occurs within 1 year before or after the diagnosis of dermatomyositis. Compared with classic dermatomyositis, dermatomyositis with malignancy mostly occurs in patients aged>50 years, and is typically characterized by the heliotrope sign, skin necrosis and presence of myositis-specific antibodies such as anti-transcriptional intermediary factor-1γ and anti-nuclear matrix protein-2 antibodies, etc. Thorough screening for malignancy or close monitoring and follow-up are necessary in patients with dermatomyositis.
RESUMEN
OBJECTIVE@#To assess the clinical effectiveness of acupoint application (AP) of Guan Xin Su He Pill (, GXSHP) for patients with chronic stable angina pectoris (CSAP).@*METHODS@#This study was carried out in 3 local hospitals in Chengdu, China. After baseline evaluation, eligible patients were randomly assigned to the placebo application for acupoints (PAA) group or the herbal application for acupoints (HAA) group. Patients in the HAA group underwent AP with herbal powder, which was mainly GXSHP, and patients in the PAA group underwent AP with sham drugs. For each treatment session, unilateral acupoints including Neiguan (PC 6), Danzhong (RN 17), Xinshu (BL 15) and Jueyinshu (BL 14), were stimulated for both groups. AP was performed 3 times a week with a 2-day interval for 4 weeks. The primary outcome was the frequency of angina pectoris attacks per week, while the secondary outcomes included angina pain intensity measured by the Visual Analogue Scale (VAS), dose of rescue oral drugs (nitroglycerin), scores on the Seattle Angina Questionnaire (SAQ), Self-Rating Anxiety Scale scores (SAS) and Self-Rating Depression Scale scores (SDS). Clinical outcomes were measured at week 0, 4 and 8. The safety of AP of GXSHP treatment for CSAP were assessed.@*RESULTS@#A total of 121 patients were enrolled. Baseline characteristics were comparable across the 2 groups. After treatment, the angina attack numbers in the HAA group were significantly reduced from 11.00 to 4.81 (P<0.05). While, for PAA group, the angina frequency was not significantly improved (baseline 10.55; post-treatment 11.05). The HAA group had significantly fewer angina attacks than the PAA group (P<0.05). Pain intensity measured by VAS in HAA group was significantly reduced from 4.06 to 3.02 (P<0.05). While, for PAA group, the VAS was significantly increased (baseline 3.62; post-treatment 3.96; P<0.05). Clinical outcomes showed better improvement after treatment in the HAA group than in the PAA group in terms of oral administration of rescue drugs, SAS, SDS and SAQ scores (P<0.05). The adverse events were also reported.@*CONCLUSION@#AP of GXSHP is a safe and effective treatment for CSAP patients (Registration No. NCT02029118).
Asunto(s)
Femenino , Humanos , Masculino , Puntos de Acupuntura , Angina Estable/tratamiento farmacológico , China , Medicamentos Herbarios Chinos/efectos adversos , Resultado del TratamientoRESUMEN
OBJECTIVE@#To explore the genetic basis for a child with 46,XY disorders of sex development (DSD) and explore its genotype-phenotype correlation.@*METHODS@#The child was subjected to whole exome sequencing (WES), and exons 1 to 7 of NR5A1 were subjected to multiplex ligation-dependent probe amplification (MLPA) analysis.@*RESULTS@#The patient presented with rudimentary vulva of a female with Tanner stage 1. B-mode ultrasonography has detected ovary and uterus. The child was found to have a chromosome karyotype of 46,XY. WES revealed that the patient has harbored heterozygous deletion of exon 5 of the NR5A1 gene, which was a novel pathogenic variant inherited from the mother. No abnormality was found in the father.@*CONCLUSION@#The main symptoms of 46,XY DSD children are insufficient external genitalia masculinization, for which variants of the NR5A1 gene are an important cause. WES has improved the detection rate of genetic variants and provided a solid basis for genetic counseling of the affected families.
Asunto(s)
Niño , Femenino , Humanos , Trastorno del Desarrollo Sexual 46,XY/genética , Trastornos del Desarrollo Sexual/genética , Exones/genética , Pruebas Genéticas , Heterocigoto , Mutación , Factor Esteroidogénico 1/genéticaRESUMEN
OBJECTIVE@#To explore the correlation between the genotypes and metabolic markers and microstructure of bones in children with Gitelman syndrome (GS).@*METHODS@#For 15 children with GS and 10 healthy individuals, baseline data and bone metabolic markers including parathyroid hormone, alkaline phosphatase, osteocalcin, N-terminal propeptide of type I procollagen, beta isomer of the C-terminal telopeptide of type I collagen and 25-hydroxyvitamin D, high-resolution peripheral quantitative computed tomography indicators (volumetric bone mineral density, bone microstructure indicators) were collected. Genetic testing was carried out to determine their genotypes.@*RESULTS@#The volumetric bone mineral density, bone geometry and bone microstructure parameters of the GS group were better than those of the healthy controls (P<0.05). Variants of the SLC12A3 gene were identified in 9 of the 15 patients but none of the 10 healthy controls.@*CONCLUSION@#The phenotype of GS children is influenced by the interaction of genetic variants, though the phenotype associated with high frequency mutations showed no specificity. There is also a correlation between their genotype and the bone microstructure.
Asunto(s)
Niño , Humanos , Biomarcadores , Huesos , Colágeno Tipo I/genética , Genotipo , Síndrome de Gitelman , Osteocalcina/genética , Fragmentos de Péptidos , Miembro 3 de la Familia de Transportadores de Soluto 12RESUMEN
Objective:To investigate the effects of curdione on the proliferation, apoptosis and cell cycle of triple negative breast cancer cell line MDA-MB-231. Method:MDA-MB-231 cells were cultured<italic> in vitro</italic> with capecitabine (positive control) and curdione at different concentrations (125, 250, 500, 1 000, and 2 000 μmol·L<sup>-1</sup>), respectively, for detecting their viability using the cell counting kit-8 (CCK-8) at 24 and 48 h. Three effective inhibitory concentrations (250, 500, and 1 000 μmol·L<sup>-1</sup>) against cell proliferation were selected for subsequent experiments. The effect of curdione on cell cycle was determined by flow cytometry combined with propidium iodide (PI) staining. After the set-up of high-concentration (2 000 μmol·L<sup>-1</sup>) group, the effect of curdione on cell mitochondrial membrane potential was measured by JC-1(5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbocyanine iodide) staining, followed by the detection of cell apoptosis by flow cytometry combined with Annexin V-FITC/PI double staining. The changes in cell cycle status and apoptosis-related protein expression following curdione intervention were assayed by Western blot. Result:Compared with the blank control, curdione at 250, 500, 1 000, and 2 000 μmol·L<sup>-1 </sup>significantly inhibited the proliferation of MDA-MB-231 cells (<italic>P</italic><0.01), exhibiting a concentration- and time-response relationship. The half maximal inhibitory concentration (IC<sub>50</sub>) values at 24 and 48 h were 1 607 and 1 401 μmol·L<sup>-1</sup>, respectively. Curdione at 250, 500, and 1 000 μmol·L<sup>-1</sup> arrested cells in G<sub>1</sub> phase. Curdione at 250 μmol·L<sup>-1 </sup>had no effect on cell mitochondrial membrane potential, which, however, declined significantly in the 500, 1 000, and 2 000 μmol·L<sup>-1 </sup>groups (<italic>P</italic><0.05, <italic>P</italic><0.01). Curdione at 250, 500, and 1 000 μmol·L<sup>-1 </sup>obviously increased the proportion of apoptotic cells (<italic>P</italic><0.05, <italic>P</italic><0.01). Curdione at each concentration elevated the Bcl-2-associated X protein (Bax)/B-cell lymphoma 2 (Bcl-2) ratio (<italic>P</italic><0.05, <italic>P</italic><0.01), but did not change the cysteinyl aspartate-specific protease-3 (Caspase-3) expression. The protein expression levels of Caspase-9, cleaved Caspase-9, cleaved Caspase-3, p53, and p21 were up-regulated (<italic>P</italic><0.05). Conclusion:A certain concentration of curdione inhibits the proliferation of MDA-MB-231 cells, which may be related to its efficacy in arresting cell cycle and inducing apoptosis.
RESUMEN
Intrahepatic cholangiocarcinoma (ICC) is an important liver malignancy next only to hepatocellular carcinoma, accounting for 15%-20% of primary liver cancer. In recent years, the incidence rate of ICC tends to increase globally; however, due to its insidious onset, high degree of malignancy, and strong invasive ability, most patients are in the advanced stage when attending the hospital and thus miss the most appropriate timing for surgery. With the continuous development of next-generation sequencing, the treatment of ICC gradually develops towards the direction of individualization and precision. This article introduces the basic research advances in the pathogenesis, molecular typing, and early diagnosis of ICC and reviews the clinical translational research of ICC in recent years, so as to provide new ideas for the treatment and clinical research of ICC.
RESUMEN
Objective:To analyze clinical, laboratory and imaging characteristics of different subtypes of linear morphea (LM) , and to propose an appropriate approach to the diagnosis and severity assessment of LM.Methods:Clinical data were collected from patients with clinically and/or pathologically confirmed LM in Department of Dermatology, West China Hospital, Sichuan University from January 2018 to December 2019, and retrospectively analyzed.Results:A total of 107 patients with LM were enrolled into this study, including 63 with LM of the limbs/trunk, 22 with morphea en coup de sabre, 11 with progressive hemifacial atrophy and 11 with eosinophilic fasciitis. Disease severity was evaluated by using the modified localized scleroderma skin severity index (mLoSSI) and localized scleroderma skin damage index (LoSDI) scores in 88 patients, with the mLoSSI scores ranging from 0 to 51 points, and the LoSDI scores ranging from 0 to 40 points. Routine blood examination of 10 patients with eosinophilic fasciitis showed increased eosinophil counts in 4 patients. Thirteen (14.8%) of 88 patients with LM were positive for antinuclear antibody, with titers of ≥ 1∶320. Magnetic resonance imaging (MRI) examination showed ipsilateral cerebral hemisphere atrophy and contralateral white matter hyperintensity on T2-weighted images in 2 out of 4 patients with progressive hemifacial atrophy, myofascial thickening in 26 out of 28 patients with LM of the limbs/trunk (92.9%) , subcutaneous septal and myofascial thickening in all 11 patients with eosinophilic fasciitis.Conclusions:The preliminary assessment of disease activity, severity and prognosis of LM can be made by mLoSSI and LoSDI. MRI examination is recommended for patients with clinical signs of involvement of subcutaneous structures.
RESUMEN
Objective:To explore the characteristics of eye tracking movement on circumscribed interests in preschool children with autism spectrum disorder (ASD), providing some reference for behavior correction and rehabilitation training.Methods:Fifty ASD children and fifty-two age-matched typically developing children(TDC) were investigated by the childhood autism rating scale(CARS), the autism diagnostic observation schedule(ADOS), the autism diagnostic interview-revised (ADI-R) and Gesell Developmental Schedule, (GDS). Eye movement during the visual search task was captured by the Tobii Pro X3-120 eye tracker.All data were analyzed by the IBM SPSS Statistics 20.0.Eye movement patterns were compared between TDC and ASD children using the independent-sample t test, and the correlations were then analyzed between abnormal eye movement characteristics and their core syndrome. Results:The total scores of CARS, ADOS and ADI-R in ASD group were 34.13±4.59, 14.44±2.59 and 39.91±12.11 respectively.During passive viewing of complex non-social picture arrays, ASD and TDC group explored total number of images were 9.28±2.72 and 12.67±2.45.The fixation time per image explored in ASD and TDC group were (0.67±0.37)ms and (0.54±0.15)ms.Moreover, the number of discrete fixations per image explored in ASD and TDC group was 2.80±1.00 and 2.48±0.48.Compared with the TDC group, ASD children demonstrated circumscribed attention ( t=6.610, P<0.01) with more perseveration ( t=-2.363, P=0.021) and detail-orientation ( t=-2.360, P=0.021). Exploration was negatively correlated with the total score of ADOS ( r=-0.480, P<0.01), CARS ( r=-0.487, P<0.01), communication score of ADOS( r=-0.290, P=0.041), social score of ADOS( r=-0.491, P<0.01), game score of ADOS( r=-0.397, P=0.004)and communication score of ADI-R( r=-0.331, P=0.025)in the ASD group. Conclusion:Compared with TDC, the eye movement pattern shows the circumscribed interests of ASD children, who not only explore fewer objects but also demonstrate circumscribed attention with more perseveration and detail-orientation.Moreover, the more severe the symptoms of ASD children, the fewer objects the children explore and the more stereotyped the circumscribed interest.
RESUMEN
Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.
RESUMEN
Heme oxygenase (HO)-1 and its enzymolysis products can mitigate hepatic ischemia-reperfusion injury (HIRI) by alleviating the damage of reactive oxygen free radicals, mitigating cell apoptosis, inhibiting inflammatory reaction and maintaining microcirculation stability. Autophagy is a process in which the cells utilize lysosomes to degrade their damaged organelles and macromolecular substances. It is considered as an adaptive response to alleviate cell damage under stress, which can effectively reduce cell death. In recent years, more and more studies have demonstrated that autophagy is also significantly correlated with HIRI. This article reviewed recent research progresses at home and abroad on HO-1 and HIRI, autophagy and HIRI, the interaction and mechanism between HO-1 and autophagy in HIRI.
RESUMEN
Objective To explore the effect and mechanism of Yes-associated protein (YAP) in hepatic ischemia-reperfusion injury (IRI) of mice. Methods Forty male C57BL/6 mice were randomly divided into the sham operation group (Sham group), lysophosphatidic acid (LPA) + Sham group, IRI group and LPA+IRI group, 10 mice in each group. Liver tissue and serum samples were collected at 6 h after ischemia-reperfusion. The levels of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected. Histopathological changes and macrophage infiltration of liver tissues were detected by hematoxylin-eosin (HE) staining and immunohistochemical staining. The protein expression level of YAP was detected by Western blot. The messenger ribonucleic acid (mRNA) expression levels of inflammatory cytokines including tumor necrosis factor (TNF)-α, inducible nitric oxide synthase (iNOS), interleukin (IL)-1 and IL-6 were quantitatively measured by reverse transcription polymerase chain reaction (RT-PCR). Results Western blot results demonstrated that the protein expression level of YAP in the LPA+IRI group was significantly up-regulated than that in the IRI group. Compared with the Sham group, the ALT and AST were significantly higher in the IRI group (both P < 0.05). The serum levels of ALT and AST in the LPA+IRI group were significantly lower than those in the IRI group (both P < 0.05). HE staining revealed that the morphology of hepatocytes was normal in the Sham group and LPA + Sham group. Pathological changes, such as liver congestion, liver cell swelling and structural abnormalities of hepatic lobule, occurred in the LPA+IRI group and IRI group. Compared with the IRI group, pathological changes were alleviated in the LPA+IRI group. RT-PCR indicated that the mRNA expression levels of TNF-α, iNOS, IL-1 and IL-6 in the LPA+IRI group were lower than those in the IRI group (all P < 0.05). Immunohistochemical demonstrated that LPA partially inhibited macrophage infiltration in ischemic tissues after IRI. Conclusions YAP can significantly mitigate hepatic IRI. The mechanism is associated with the regulation of macrophage recruitment and activation.
RESUMEN
The induction of immune tolerance is an essential component and the utmost goal in the field of organ transplantation immunity, which depends upon the recognition and presentation of transplantation antigens, the activation and response of the immune system and other immune essence. However, before successfully inducing immune tolerance, how to carry out individualized induction of immune tolerance in organ transplant recipients to optimize the combination of immunosuppressive agents and individualized treatment and achieve the ideal state of optimal prevention and treatment of immune rejection and minimal adverse reactions, remains to be further resolved by the organ transplantation practitioners. Based on the reports of international core journals, the individualized induction strategy of immune tolerance and the future prospects were reviewed in this article from the following aspects including the mechanism underlying induction of immune tolerance, realization of operational immune tolerance, novel strategy of individualized induction of immune tolerance and application of regulatory T cell in individualized immune tolerance in combination with clinical and laboratory research results of regulatory T cell in our center.
RESUMEN
Objective: To investigate effect of curdione on the migration and invasion of human breast cancer HCC1937 cells and its mechanism.Method: HCC1937 cells were cultured in vitro and treated with curdione at various doses (0, 12.5, 25, 50, 100, 200, 400 μmol·L-1) for 24, 48 h, the cell viability was detected by cell counting kit-8 method. curdione groups (12.5, 25, 50 μmol·L-1) and blank group were established. The effect of curdione on the adhesion of HCC1937 cells was detected by the cell adhesion assay. The effect of curdione on migration of HCC1937 cells was detected by wound healing assay. The effect of curdione on the migration and invasion of HCC1937 cells were detected by transwell chamber assay. The effect of curdione on regulation of mitogen-activated protein kinase(MAPK)and protein kinase B(Akt)signaling pathways and the protein expressions of matrix metalloproteinases-2 (MMP-2) and matrix metalloproteinases-9 (MMP-9) of HCC1937 cells were detected by the Western blot analysis. Effect of curdione on mRNA expressions of MMP-2 and MMP-9 of HCC1937 cells were detected by Real-time PCR.Result: Compared with the blank group, curdione (12.5, 25, 50 μmol·L-1) groups had no significant effect on cell viability, but a remarkable effect on cell viability HCC1937 cells, and cell viability was gradually decreased with the increase of the concentration of curdione (PP-1) had a significant effect on cell adhesion rate, migration rate and invasion rate of HCC1937 cells (PP-1) could down-regulate phosphorylation levels of key proteins extracellular regulated protein kinases(ERK), c-Jun N-terminal kinase(JNK), Akt on MAPK and Akt signaling pathways (PConclusion: curdione can inhibit the migration and invasion of human breast cancer HCC1937 cells, and the mechanism may be related to down-regulation of phosphorylation levels of key proteins ERK, JNK, Akt on MAPK and Akt signaling pathways, so as to reduce the expressions of MMP2 and MMP-9.
RESUMEN
Objective To investigate the spectrum of CYP21A2 gene mutation and the correlation between genotype and phenotype in patients with 21-hydroxylase deficiency in Tianjin and surrounding areas.Methods Genomic DNA was extracted from the peripheral blood samples of the proband.Locus-specific PCR,direct sequencing of PCR amplification products,and multiplex ligation-dependent probe amplification were applied to detect pathogenic gene CYP21A2 and the relationship between genotypes and phenotypes was analyzed.Results (1) Of 35 patients with 21-hydroxylase deficiency,25 were classified as salt-wasting phenotype and 10 were simple virilizing phenotype.(2) 69 mutant alleles were detected in a total of 70 alleles in 35 patients.Only one mutant allele was detected in one patient.Two mutant alleles were detected in all other patients,with the mutation detection rate 98.6%.(3) A total of 6 types of mutations were detected,of which c.293-13C/A>G (I2G) was the most common,accounting for 57.1% (40/70),followed by 18.6% (13/70) for large gene deletion or conversion,and 14.3% (10/70) for p.I173N.In addition,a novel mutation,c.949C>T (p.R317X),which has not been reported previously,was detected as a pathogenic mutation.(4) Correlation analysis of genotype and phenotype in 35 children showed that the phenotype predicted by genotype was consistent with the actual salt-wasting phenotype in 31 children,and those in three children were inconsistent with the actual clinical phenotype.Conclusion The mutation characteristics of CYP21A2 gene in patients with 21-hydroxylase deficiency in Tianjin and surrounding areas are slightly different from those reported in other regions in China.A mutation c.949C>T has not been reported,which enriches the mutation spectrum of CYP21A2 gene and provide the foundation for genetic counseling and prenatal diagnosis.
RESUMEN
Objective@#To investigate the role of short-term starvation (STS) in alleviating hepatic ischemia-reperfusion injury in mice and possible mechanism of action.@*Methods@#Wild-type male C57BL/6 mice aged 8 weeks were randomly divided into 75% hepatic ischemia-reperfusion injury group (IR group), STS+75% hepatic ischemia-reperfusion injury group (STS group), and sirtinol+STS+75% hepatic ischemia-reperfusion injury group (SIR group), using a random number table, and sham-operation groups (IR-Sham group, STS-Sham group, and SIR-Sham group) were also established. The serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured, and the histomorphological changes of the liver were observed, as well as the expression of Sirt1, LC3B, and P62 proteins in liver tissue and the results of LC3B fluorescence staining. An analysis of variance was used for comparison of data between multiple groups, and the t-test was used for comparison of data between two groups.@*Results@#Compared with the IR group, the STS group had significant reductions in the serum levels of ALT (3 152.7 ± 735.6 U/L vs 8 414.2 ± 1 052.2 U/L, P < 0.01) and AST (3 577.0 ± 714.0 U/L vs 10 845.8 ± 1 145.7 U/L, P < 0.01) and significant alleviation of liver pathological injury (Suzuki score: 1.50±0.55 vs 3.50±0.55, P < 0.01). Compared with the STS group, the SIR group had significant increases in the serum levels of ALT (7 002.7 ± 1 485.2 U/L vs 3 152.7 ± 735.6 U/L, P < 0.01) and AST (8 980.7 ± 1 739.1 U/L vs 3 577.0 ± 714.0 U/L, P < 0.01) and significant exacerbation of liver pathological injury (Suzuki score: 3.33 ± 0.52 vs 1.50 ± 0.55, P < 0.01). Compared with the IR group and the IR-Sham group, the STS group and the STS-Sham group had significant increases in the mRNA and protein expression of Sirt1 and the protein expression of LC3B and a significant reduction in the protein expression of P62, as well as a significant increase in the percentage of LC3B-positive cells in liver tissue (22.83% ± 5.19% / 22.17% ± 4.83% vs 10.16% ± 3.06% / 10.83% ± 1.94%, both P < 0.01). Compared with the STS group and the STS-Sham group, the SIR group and the SIR-Sham group had significant reductions in the expression of Sirt1 and LC3B proteins and a significant increase in the expression of P62 protein, as well as a significant reduction in the percentage of LC3B-positive cells in liver tissue (11.83% ± 9.24% / 14.67% ± 4.68% vs 22.83% ± 5.19% / 22.17% ± 4.83%, both P < 0.01).@*Conclusion@#STS can effectively alleviate hepatic ischemia-reperfusion injury, and its protective effect may be associated with increasing the expression of Sirt1, inducing and promoting hepatocyte autophagy, and reducing hepatocyte death.
RESUMEN
Chronic heart failure (CHF), a clinical syndrome resulting from the consequences of various cardiovascular diseases (CVDs), is increasingly becoming a global cause of morbidity and mortality. We had earlier demonstrated that a 4-day forest bathing trip can provide an adjunctive therapeutic influence on patients with CHF. To further investigate the duration of the impact and the optimal frequency of forest bathing trips in patients with CHF, we recruited those subjects who had experienced the first forest bathing trip again after 4 weeks and randomly categorized them into two groups, namely, the urban control group (city) and the forest bathing group (forest). After a second 4-day forest bathing trip, we observed a steady decline in the brain natriuretic peptide levels, a biomarker of heart failure, and an attenuated inflammatory response as well as oxidative stress. Thus, this exploratory study demonstrated the additive benefits of twice forest bathing trips in elderly patients with CHF, which could further pave the way for analyzing the effects of such interventions in CVDs.
Asunto(s)
Anciano , Humanos , Enfermedad Crónica , Terapias Complementarias , Métodos , Bosques , Insuficiencia Cardíaca , Sangre , Quimioterapia , Terapéutica , Pruebas de Función Cardíaca , Interleucina-6 , Sangre , Péptido Natriurético Encefálico , Sangre , Estrés Oxidativo , Recreación , Resultado del Tratamiento , Factor de Necrosis Tumoral alfa , SangreRESUMEN
Objective To discuss key points of prevention and treatment of perioperative pulmonary hypertensive crisis in patients with serious pulmonary arterial hypertension associated with ventricular septal defect. Methods Retrospectively analyzed the nursing experience of perioperative pulmonary hypertensive crisis on 31 patients with serious pulmonary arterial hypertension associated with ventricular septal defect from March to December during 2016.Among these patients,7 patients occurred pulmonary hypertensive crisis.The prevention contained avoiding oxygen lack,keeping pH alkaloid in the body, application of pulmonary vasodilator, deep sedation. Results A total of 30 cases survived the perioperative period, and were discharged from the hospital, one died. Conclusions The patients with serious pulmonary arterial hypertension had more risks during the perioperative period,the main cause of death was pulmonary hypertensive crisis during this time.So prevention of pulmonary hypertension crisis is the key point of postoperative nursing.