Genome-wide analysis of UDP-glycosyltransferase family in Citrus sinensis and characterization of a UGT gene encoding flavonoid 1-2 rhamnosyltransferase.

UDP-glycosyltransferases (UGTs) play a crucial role in the glycosylation of secondary metabolites in plants, which is of significant importance for growth and response to biotic or abiotic stress. Despite the wide identification of UGT family members in various species, limited information is available regarding this family in citrus. In this study, we identified 87 UGT genes from the Citrus sinensis genome and classified them into 14 groups. We characterized their gene structures and motif compositions, providing insights into the molecular basis underlying discrepant functions of UGT genes within each evolutionary branch. Tandem duplication events were found to be the main driving force behind UGT gene expansion. Additionally, we identified numerous cis-acting elements in the promoter region of UGT genes, including those responsive to light, growth factors, phytohormones, and stress conditions. Notably, light-responsive elements were found with a frequency of 100 %. We elucidated the expression pattern of UGTs during fruit development in Citrus aurantium using RNA-seq and quantitative real-time PCR (qRT-PCR), revealing that 10 key UGT genes are closely associated with biosynthesis of bitter flavanone neohesperidosides (FNHs). Furthermore, we identified Ca1,2RhaT as a flavonoid 1-2 rhamnosyltransferase (1,2RhaT) involved in FNHs biosynthesis for the first time. Isolation and functional characterization of the gene Ca1,2RhaT from Citrus aurantium in vitro and in vivo indicated that Ca1,2RhaT encoded a citrus 1,2RhaT and possessed rhamnosyl transfer activities. This work provides comprehensive information on the UGT family while offering new insights into understanding molecular mechanisms regulating specific accumulation patterns of FNHs or non-bitter flavanone rutinosides (FRTs) in citrus.

Transcriptome analysis of Citrus Aurantium L. to study synephrine biosynthesis during developmental stages.

Citrus aurantium L., sometimes known as "sour orange," is an important Chinese herb with young, immature fruits, or "zhishi," that are high in synephrine. Synephrine is a commonly utilized natural chemical with promising applications in effectively increasing metabolism, heat expenditure, energy level, oxidative fat, and weight loss. However, little is known about the genes and pathways involved in synephrine production during the critical developmental stages of C. aurantium L., which limits the development of the industry. According to this study, the concentration of synephrine gradually decreased as the fruit developed. Transcriptome sequencing was used to examine the DEGs associated with synephrine connections and served as the foundation for creating synephrine-rich C. aurantium L. Comparisons conducted between different developmental stages to obtain DEGs, and the number of DEGs varied from 690 to 3,019. Tyrosine and tryptophan biosynthesis, glycolysis/gluconeogenesis, pentose phosphate pathway, phenylalanine, and tyrosine metabolism were the main KEGG pathways that were substantially enriched. The results showed that 25 genes among these KEGG pathways may be related to synephrine synthesis. The WGCNA and one-way ANOVA analysis adoption variance across the groups suggested that 11 genes might play a crucial role in synephrine synthesis and should therefore be further analyzed. We also selected six DEGs at random and analyzed their expression levels by RT-qPCR, and high repeatability and reliability were demonstrated by our finished RNA-seq study results. These results may be useful in selecting or modifying genes to increase the quantity of synephrine in sour oranges.

The ß-galactosidase gene AtrBGAL2 regulates Akebia trifoliata fruit cracking.

Cracking of Akebia trifoliata fruit at maturity is problematic for the cultivation of the horticultural crop, shortening shelf-life quality and compromising commercial value. However, the molecular mechanisms underlying this feature of A. trifoliata are not known. Genes involved in cell wall metabolism were identified by genome and transcriptome sequencing, which may play important roles in fruit cracking. One of the galactose metabolism related genes, ß-galactosidase (AtrBGAL2), was identified in A. trifoliata, and overexpression (OE) of AtrBGAL2 resulted in early fruit cracking, higher water-soluble pectin contents, and lower acid-soluble pectin, cellulose, and hemicellulose content compared to the wild type. Whereas silencing of AtrBGAL2 in trifoliata by virus induced gene silencing showed opposite trends. The levels of AtrBGAL2 transcripts were 24.6 and 66.0-fold higher in OE A. trifoliata and tomato fruits, respectively, and the cell wall-related genes were also gradually greater than in control plants during fruit ripening. Whereas the expression levels of AtrBGAL2 was significantly down-regulated by 54.1 % and 73.7 % in gene silenced A. trifoliata and CRISPR/Cas9 tomato mutant plants, respectively, and cell wall-related genes were also significantly reduced. These results demonstrate that AtrBGAL2 plays important roles in regulating fruit cracking during fruit ripening.

Genomic variation, environmental adaptation, and feralization in ramie, an ancient fiber crop.

Feralization is an important evolutionary process, but the mechanisms behind it remain poorly understood. Here, we use the ancient fiber crop ramie (Boehmeria nivea (L.) Gaudich.) as a model to investigate genomic changes associated with both domestication and feralization. We first produced a chromosome-scale de novo genome assembly of feral ramie and investigated structural variations between feral and domesticated ramie genomes. Next, we gathered 915 accessions from 23 countries, comprising cultivars, major landraces, feral populations, and the wild progenitor. Based on whole-genome resequencing of these accessions, we constructed the most comprehensive ramie genomic variation map to date. Phylogenetic, demographic, and admixture signal detection analyses indicated that feral ramie is of exoferal or exo-endo origin, i.e., descended from hybridization between domesticated ramie and the wild progenitor or ancient landraces. Feral ramie has higher genetic diversity than wild or domesticated ramie, and genomic regions affected by natural selection during feralization differ from those under selection during domestication. Ecological analyses showed that feral and domesticated ramie have similar ecological niches that differ substantially from the niche of the wild progenitor, and three environmental variables are associated with habitat-specific adaptation in feral ramie. These findings advance our understanding of feralization, providing a scientific basis for the excavation of new crop germplasm resources and offering novel insights into the evolution of feralization in nature.

Influence of Nitrogen Supply on Growth, Antioxidant Capacity and Cadmium Absorption of Kenaf (Hibiscus cannabinus L.) Seedlings.

Kenaf (Hibiscus cannabinus L.) is considered suitable for the remediation of cadmium (Cd)-contaminated farmlands, because of its large biomass and resistance to Cd stress. The addition of nitrogen (N) fertilizer is an important measure used to increase crop yields, and it may also affect Cd accumulation in plants. To clarify the effects of different forms and concentrations of N on plant growth and Cd absorption in kenaf, a hydroponic experiment was conducted using three N forms (NH4+-N, NO3--N and urea-N) at four concentrations (0, 2, 4 and 8 mM, 0 mM as control) under Cd stress (30 µM). The plant growth, the antioxidant enzyme activity and the Cd contents of various parts of the kenaf seedlings were measured. The results showed that the N form had the greatest impact on the growth of the kenaf and the absorption and transport of the Cd, followed by the interaction effect between the N type and the concentration. Compared to the control, the addition of N fertilizer promoted the growth of kenaf to varying degrees. Among all the treatments, the use of 2 mM of NO3--N enhanced the biomass and Cd accumulation to the greatest extent compared to CK from 2.02 g to 4.35 g and 341.30 µg to 809.22 µg per plant, respectively. The NH4+-N significantly reduced the Cd contents of different parts but enhanced the translocation factors of Cd stem to root (TF S/R) and leaf to stem (TF L/S) by 34.29~78.57% and 45.10~72.55%, respectively. The peroxidase (POD), superoxide dismutase (SOD) and catalase (CAT) enzyme activities of the kenaf increased with the N treatments, especially with NH4+-N. Overall, applying low concentrations of NO3--N can better promote the extraction of Cd by kenaf.

Transcriptome Analysis and VIGS Identification of Key Genes Regulating Citric Acid Metabolism in Citrus.

Citrus (Citrus reticulata) is one of the world's most widely planted and highest-yielding fruit trees. Citrus fruits are rich in a variety of nutrients. The content of citric acid plays a decisive role in the flavor quality of the fruit. There is a high organic acid content in early-maturing and extra-precocious citrus varieties. Reducing the amount of organic acid after fruit ripening is significant to the citrus industry. In this study, we selected a low-acid variety, "DF4", and a high-acid variety, "WZ", as research materials. Through WGCNA analysis, two differentially expressed genes, citrate synthase (CS) and ATP citrate-pro-S-lyase (ACL), were screened out, which related to the changing citric acid. The two differentially expressed genes were preliminarily verified by constructing a virus-induced gene-silencing (VIGS) vector. The VIGS results showed that the citric acid content was negatively correlated with CS expression and positively correlated with ACL expression, while CS and ACL oppositely control citric acid and inversely regulate each other. These results provide a theoretical basis for promoting the breeding of early-maturing and low-acid citrus varieties.

Single-Molecule Real-Time Sequencing of Full-Length Transcriptome and Identification of Genes Related to Male Development in Cannabis sativa.

Female Cannabis sativa plants have important therapeutic properties. The sex ratio of the dioecious cannabis is approximately 1:1. Cultivating homozygous female plants by inducing female plants to produce male flowers is of great practical significance. However, the mechanism underlying cannabis male development remains unclear. In this study, single-molecule real-time (SMRT) sequencing was performed using a mixed sample of female and induced male flowers from the ZYZM1 cannabis variety. A total of 15,241 consensus reads were identified, and 13,657 transcripts were annotated across seven public databases. A total of 48 lncRNAs with an average length of 986.54 bp were identified. In total, 8202 transcripts were annotated as transcription factors, the most common of which were bHLH transcription factors. Moreover, tissue-specific expression pattern analysis showed that 13 MADS transcription factors were highly expressed in male flowers. Furthermore, 232 reads of novel genes were predicted and enriched in lipid metabolism, and qRT-PCR results showed that CER1 may be involved in the development of cannabis male flowers. In addition, 1170 AS events were detected, and two AS events were further validated. Taken together, these results may improve our understanding of the complexity of full-length cannabis transcripts and provide a basis for understanding the molecular mechanism of cannabis male development.

Functional study of CYP90A1 and ALDH3F1 gene obtained by transcriptome sequencing analysis of Brassica napus seedlings treated with brassinolide.

Sclerotinia disease and weeds of Brassica napus greatly reduce crop yields. However, brassinolides can improve the resistance of plants to sclerotinia diseases and herbicides. In this study, we investigated the effects of brassinolide on the occurrence, physiological indices, yield, and gene expression of Fanming No. 1 seeds under sclerotinia and glufosinate stress. The results showed that soaking of the seeds in 0.015% brassinolide for 6 h reduced the incidence of sclerotinia by 10%. Additionally, in response to glufosinate stress at the seedling stage, the enzyme activities of catalase and superoxide dismutase increased by 9.6 and 19.0 U/gFW/min, respectively, and the soluble sugar content increased by 9.4 mg/g, increasing the stress resistance of plants and yield by 2.4%. LHCB1, fabF, psbW, CYP90A1, ALDH3F1, ACOX1, petF, and ACSL were screened by transcriptome analysis. ALDH3F1 and CYP90A1 were identified as key genes. Following glufosinate treatment, transgenic plants overexpressing ALDH3F1 and CYP90A1 were found to be resistant to glufosinate, and the expression levels of the ALDH3F1 and CYP90A1 were 1.03-2.37-fold as high as those in the control. The expression level of ATG3, which is an antibacterial gene related to sclerotinia disease, in transgenic plants was 2.40-2.37-fold as high as that in the control. Our results indicate that these two key genes promote plant resistance to sclerotinia and glufosinate. Our study provides a foundation for further studies on the molecular mechanisms of rapeseed resistance breeding and selection of new resistant varieties.

Salt Stress Induces Changes in Physiological Characteristics, Bioactive Constituents, and Antioxidants in Kenaf (Hibiscus cannabinus L.).

Salinity stress is a major environmental threat in agricultural systems. Kenaf is a promising crop for the future for cultivation in salinity-affected soils because of its high phytoremediation potential. The current study aimed to investigate the effects of salt stress using six different sodium chloride (NaCl) concentrations (0, 50, 100, 150, 200, and 250 mM) on the plant growth, physiological characteristics, bioactive constituents, and antioxidant capacity of H. cannabinus. The results indicated that the NaCl stress induced significant reductions in plant height and in the dry and fresh weights of the leaf tissue. In addition, the K, Ca, Mg, and P concentrations in this tissue also decreased under NaCl stress treatment conditions. In contrast, the NaCl stress led to the accumulation of hydrogen peroxide (H2O2), superoxide anion (O2•-), malondialdehyde (MDA), proline, total soluble sugar, and total soluble protein. Under NaCl stress, the levels of antioxidants, including phenolics and flavonoids, also increased. The gas chromatography-mass spectrometry (GC-MS) results showed that the volatile compounds, including heptacosane, 1-octadecanesulphonyl chloride, and tetratetracontane, were induced under the NaCl stress treatment. Furthermore, the salt stress significantly improved the antioxidant capacity of the leaf extracts. These findings may provide insight into how H. cannabinus plants respond to salt stress and may help improve its medicinal value under salt stress.

Transcriptome Analysis and HPLC Profiling of Flavonoid Biosynthesis in Citrus aurantium L. during Its Key Developmental Stages.

Citrus aurantium L. (sour orange) is a significant Chinese medicinal and fruit crop rich in flavonoids. However, the pathways and genes involved in flavonoid biosynthesis at the key developmental stages of Citrus aurantium L. are not fully understood. This study found that the total flavonoid concentration gradually decreased as the fruit developed. Additionally, it showed that neohesperidin was the main flavonoid in the early stages of sour orange fruit development. However, as the development stage progressed, naringin content increased rapidly and emerged as the main flavonoid component. From 27 cDNA libraries, RNA sequencing yielded 16.64 billion clean bases, including 8989 differentially expressed genes. We identified 74 flavonoid related unigenes mapped to the phenylalanine, tyrosine, and phenylpropanoid biosynthesis pathways. A total of 152 UDP-glucuronosyltransferase genes (UGTs) were identified from C. aurantium L. transcriptome database, in which 22 key flavonoid-correlated UGTs were divided into five main AtGT groups: E, G, I, L, M. We observed that the ethylene responsive factors (ERF) and myeloblastosis (MYB) family mainly regulated the key genes involved in flavonoid biosynthesis. Overall, our study generated extensive and detailed transcriptome data on the development of C. aurantium L. and characterized the flavonoid biosynthesis pattern during its fruit developmental stages. These results will benefit genetic modification or selection to increase the flavonoid content in sour oranges.

Transcriptome Analysis and GC-MS Profiling of Key Fatty Acid Biosynthesis Genes in Akebia trifoliata (Thunb.) Koidz Seeds.

Akebia trifoliata (Thunb.) Koidz is an important Chinese medicinal and economic crop. Its seeds, which are rich in fatty acids, are usually discarded. As of now, A. trifoliata lipid biosynthesis pathways and genes have not been clearly described. In this work, we found that seed and fruit development of A. trifoliata were not synchronized, and that when the fruit was ripe, seed oil content was not at its highest. As seeds developed, linoleic and oleic acid content was found to decrease and increase, respectively. RNA sequencing yielded 108.45 GB of clean reads from 15 cDNA libraries, containing 8756 differentially expressed genes. We identified 65 unigenes associated with lipid biosynthesis, including fatty acid and triacylglycerol biosynthesis. The 65 unigenes were mapped to the A. trifoliata lipid synthesis pathway. There were 20 AtrFAD family members in A. trifoliata, which could be divided into four sub-groups with the highest number of AtrSADs. Our study revealed the dynamic changes in A. trifoliata seed oil content and composition during its growth period and provides large-scale and comprehensive transcriptome data of A. trifoliata seeds. These findings provide a basis for the improvement of A. trifoliata seed oil yield and quality.

Genome-Wide Analysis of Alternative Splicing and Non-Coding RNAs Reveal Complicated Transcriptional Regulation in Cannabis sativa L.

It is of significance to mine the structural genes related to the biosynthetic pathway of fatty acid (FA) and cellulose as well as explore the regulatory mechanism of alternative splicing (AS), microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) in the biosynthesis of cannabinoids, FA and cellulose, which would enhance the knowledge of gene expression and regulation at post-transcriptional level in Cannabis sativa L. In this study, transcriptome, small RNA and degradome libraries of hemp 'Yunma No.1' were established, and comprehensive analysis was performed. As a result, a total of 154, 32 and 331 transcripts encoding key enzymes involved in the biosynthesis of cannabinoids, FA and cellulose were predicted, respectively, among which AS occurred in 368 transcripts. Moreover, 183 conserved miRNAs, 380 C. sativa-specific miRNAs and 7783 lncRNAs were predicted. Among them, 70 miRNAs and 17 lncRNAs potentially targeted 13 and 17 transcripts, respectively, encoding key enzymes or transporters involved in the biosynthesis of cannabinoids, cellulose or FA. Finally, the crosstalk between AS and miRNAs or lncRNAs involved in cannabinoids and cellulose was also predicted. In summary, all these results provided insights into the complicated network of gene expression and regulation in C. sativa.

Physicochemical properties, content, composition and partial least squares models of A. trifoliata seeds oil.

Physicochemical properties, oil content, and fatty acids (FAs) composition are key for determining the value of oil crops. The aim of this study was to illustrate the potential of exploiting A. trifoliata as an edible oil crop, and establish a rapid measurement model for the A. trifoliata seeds oil (ASO) content and composition. In 130 A. trifoliata germplasms, the highest content of ASO was 51.27%, and unsaturated fatty acids (UFAs) mainly accounted for 74-78% of ASO. The partial least squares (PLS) model based on GC-MS and near-infrared spectroscopy was well-suited for the determination of ASO and UFA content; however, the PLS model for oleic acid (OA) and linoleic acid (LA) was not effective. The acid values and peroxide values for ASO also conformed to the Chinese food safety standards. Our findings will provide new insights and guidance for the use of A. trifoliata as oil crops..

Genetic Diversity of a Natural Population of Akebia trifoliata (Thunb.) Koidz and Extraction of a Core Collection Using Simple Sequence Repeat Markers.

Understand genetic diversity and genetic structure of germplasm is premise of germplasm conservation and utilization. And core collection can reduce the cost and difficulty of germplasm conservation. Akebia trifoliata (Thunb.) Koidz is an important medicinal, fruit and oil crop, particularly in China. In this study, 28 simple sequence repeat (SSR) markers were used to assess the genetic diversity and genetic structure of 955 A. trifoliata germplasms, determine their molecular identity and extract a core collection. The genetic diversity of the 955 germplasms was moderately polymorphic. The average number of alleles (Na), observed heterozygosity (H O ), expected heterozygosity (H E ), Shannon's information index (I∗), and polymorphic information content (PIC) were 3.71, 0.24, 0.46, 0.81, and 0.41, respectively. Four subpopulations were identified, indicating a weak genetic structure. A 955 germplasms could be completely distinguished by the characters of s28, s25, s74, s89, s68, s30, s13, s100, s72, s77, and s3. And each germplasm's molecular identity was made up of eleven characters. The core collection was composed of 164 germplasms (17.2% of 955 total germplasms in the population) and diversity parameters differed significantly from those of a random core collection. These results have implications for germplasm conservation. At the same time, based on the results, the 955 germplasm could be better used and managed.

Comparative Analysis of Akebia trifoliata Fruit Softening at Different Flesh Ripening Stages Using Tandem Mass Tag Technology.

Owing to its medicinal and high nutritional values, Akebia trifoliata can be considered as a new type of medicinal and edible homologous resources, and it has begun to be widely cultivated in many areas of China. Over-softening of fruit would affect the sensorial quality, utilization rate, and consumer acceptance of the fruit postharvest. However, fruit softening has not been characterized and the molecular mechanism underlying A. trifoliata fruit softening during ripening remains unclear. A comparative proteomic analysis was performed on the fruit at three developmental stages using tandem mass tag technology. In total, 2,839 proteins and 302 differentially abundant proteins (DAPs) were identified. Bioinformatics analysis indicated that most DAPs were implicated in oxidoreductase activity, protein domain-specific binding and pyruvate metabolism. Moreover, 29 DAPs associated with cell wall metabolism, plant hormone, and stress and defense response pathways were validated using quantitative PCR. Notably, pectinesterase, pectate lyase, and ß-galactosidase, which are involved in cell wall degradation, as well as gibberellin regulated protein, cysteine protease, thaumatin-like protein and heat shock proteins which is involved in plant hormone, and stress and defense response, were significantly up-regulated in softening fruit compared with the levels in non-softening fruit. This indicated that they might play key roles in A. trifoliata fruit softening. Our findings will provide new insights into potential genes influencing fruit softening traits of A. trifoliata, which will help to develop strategies to improve fruit quality and reduce softening-related losses.

Rapid and Visual Detection of Meloidogyne hapla Using Recombinase Polymerase Amplification Combined with a Lateral Flow Dipstick Assay.

The northern root-knot nematode, Meloidogyne hapla, is a biotrophic parasite that infects many crops and causes severe economic losses worldwide. Rapid and accurate detection of M. hapla is crucial for disease forecasting and control. We developed a recombinase polymerase amplification combined with a lateral flow dipstick (RPA-LFD) assay for rapid detection of M. hapla. The primers and probe were designed based on the effector gene 16D10 sequence and were highly specific to M. hapla. The RPA reaction was performed at a wide range of temperatures from 25 to 45°C within 5 to 25 min, and the amplicon was visualized directly on the LFD within 5 min. The detection limits of the RPA-LFD assay were 10-3 females and 10-2 second-stage juveniles/0.5 g of soil, which was 10 times more sensitive than the conventional PCR assay. In addition, the RPA-LFD assay can detect M. hapla from infested plant roots and soil samples, and the entire detection process can be completed within 1.5 h. These results indicate that the RPA-LFD assay is a simple, rapid, specific, sensitive, and visual method that can be used for rapid detection of M. hapla in the field and in resource-limited conditions.

Integrative transcriptome and proteome analyses provide new insights into different stages of Akebia trifoliata fruit cracking during ripening.

BACKGROUND: Akebia trifoliata (Thunb.) Koidz may have applications as a new potential source of biofuels owing to its high seed count, seed oil content, and in-field yields. However, the pericarp of A. trifoliata cracks longitudinally during fruit ripening, which increases the incidence of pests and diseases and can lead to fruit decay and deterioration, resulting in significant losses in yield. Few studies have evaluated the mechanisms underlying A. trifoliata fruit cracking. RESULTS: In this study, by observing the cell wall structure of the pericarp, we found that the cell wall became thinner and looser and showed substantial breakdown in the pericarp of cracking fruit compared with that in non-cracking fruit. Moreover, integrative analyses of transcriptome and proteome profiles at different stages of fruit ripening demonstrated changes in the expression of various genes and proteins after cracking. Furthermore, the mRNA levels of 20 differentially expressed genes were analyzed, and parallel reaction monitoring analysis of 20 differentially expressed proteins involved in cell wall metabolism was conducted. Among the molecular targets, pectate lyases and pectinesterase, which are involved in pentose and glucuronate interconversion, and ß-galactosidase 2, which is involved in galactose metabolism, were significantly upregulated in cracking fruits than in non-cracking fruits. This suggested that they might play crucial roles in A. trifoliata fruit cracking. CONCLUSIONS: Our findings provided new insights into potential genes influencing the fruit cracking trait in A. trifoliata and established a basis for further research on the breeding of cracking-resistant varieties to increase seed yields for biorefineries.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

Development of SSR markers via de novo transcriptome assembly in Akebia trifoliata (Thunb.) Koidz.

Owing to its high nutritive, economic, and medicinal values, Akebia trifoliata has received increased attention, making worthy of being used as a new fruit crop for further domestication and commercialization in China. However, molecular research of A. trifoliata has lagged as investigations of its genomic resources and molecular markers are rare. In this study, a cDNA library of A. trifoliata leaves was sequenced using the Illumina NovaSeq. 6000 sequencing system. In total, 101 417 transcripts, 63 757 unigenes, and 9494 simple sequence repeats were assembled and identified from the transcriptome datasets. The majority of the SSRs were di- and trinucleotide repeats. Length and number of SSR motifs ranged from 15 to 66, and 5 to 48 bp, respectively. Of which, the A/T mononucleotide motif and AG/TC and CT/GA dinucleotide motifs were the most abundant. Furthermore, 100 SSR primers were randomly selected to validate amplification and polymorphism, and 88 A. trifoliata accessions were definitively distinguished by 49 primers. With the Qinling mountains and Huaihe River line as the boundaries, the northern and southern accessions were clustered into different groups, but no clear geographical patterns (city or origin) were observed in the southern accessions. These newly identified molecular markers may provide a foundation for the genetic identification and diversity analysis and marker-assisted selection breeding in species of Akebia.

Comparative transcriptomics reveals the selection patterns of domesticated ramie.

Although domestication has dramatically altered the phenotype, physiology, and life history of ramie (Boehmeria nivea) plants, few studies have investigated the effects of domestication on the structure and expression pattern of genes in this fiber crop. To investigate the selective pattern and genetic relationships among a cultivated variety of ramie (BNZ: B. nivea, ZZ1) and four wild species, BNT (B. nivea var. tenacissima), BNN (B. nivea var. nipononivea), BNW (B. nivea var. nivea), and BAN (B. nivea var. viridula), in the section Tilocnide, we performed an RNA sequencing analysis of these ramie species. The de novo assembly of the "all-ramie" transcriptome yielded 119,114 unigenes with an average length of 633 bp, and a total of 7,084 orthologous gene pairs were identified. The phylogenetic tree showed that the cultivar BNZ clustered with BAN in one group, BNW was closely related to BNT, and BNN formed a separate group. Introgression analysis indicated that gene flow occurred from BNZ to BNN and BAN, and between BAN and BNN. Among these orthologs, 2,425 and 269 genes underwent significant purifying and positive selection, respectively. For these positively selected genes, oxidation-reduction process (GO:0055114) and stress response pathways (GO:0006950) were enriched, indicating that modulation of the cellular redox status was important during both ramie fiber evolution and improvement. Two genes related to the suppression of flowering and one gene annotated as a flowering-promoting factor were subjected to positive selection, probably caused by human manipulation. Additionally, five genes were homologs of those involved in abiotic stress tolerance and disease resistance, with higher expression levels in the cultivar BNZ than in the wild species. Collectively, the results of this study indicated that domestication has resulted in the upregulation of many genes involved in the abiotic and biotic stress responses, fiber yield, and plant growth of ramie.