Predicting Antimicrobial Resistance Using Partial Genome Alignments.

Antimicrobial resistance (AMR) is an important global health threat that impacts millions of people worldwide each year. Developing methods that can detect and predict AMR phenotypes can help to mitigate the spread of AMR by informing clinical decision making and appropriate mitigation strategies. Many bioinformatic methods have been developed for predicting AMR phenotypes from whole-genome sequences and AMR genes, but recent studies have indicated that predictions can be made from incomplete genome sequence data. In order to more systematically understand this, we built random forest-based machine learning classifiers for predicting susceptible and resistant phenotypes for Klebsiella pneumoniae (1,640 strains), Mycobacterium tuberculosis (2,497 strains), and Salmonella enterica (1,981 strains). We started by building models from alignments that were based on a reference chromosome for each species. We then subsampled each chromosomal alignment and built models for the resulting subalignments, finding that very small regions, representing approximately 0.1 to 0.2% of the chromosome, are predictive. In K. pneumoniae, M. tuberculosis, and S. enterica, the subalignments are able to predict multiple AMR phenotypes with at least 70% accuracy, even though most do not encode an AMR-related function. We used these models to identify regions of the chromosome with high and low predictive signals. Finally, subalignments that retain high accuracy across larger phylogenetic distances were examined in greater detail, revealing genes and intergenic regions with potential links to AMR, virulence, transport, and survival under stress conditions. IMPORTANCE Antimicrobial resistance causes thousands of deaths annually worldwide. Understanding the regions of the genome that are involved in antimicrobial resistance is important for developing mitigation strategies and preventing transmission. Machine learning models are capable of predicting antimicrobial resistance phenotypes from bacterial genome sequence data by identifying resistance genes, mutations, and other correlated features. They are also capable of implicating regions of the genome that have not been previously characterized as being involved in resistance. In this study, we generated global chromosomal alignments for Klebsiella pneumoniae, Mycobacterium tuberculosis, and Salmonella enterica and systematically searched them for small conserved regions of the genome that enable the prediction of antimicrobial resistance phenotypes. In addition to known antimicrobial resistance genes, this analysis identified genes involved in virulence and transport functions, as well as many genes with no previous implication in antimicrobial resistance.

Prediction of Acquired Antimicrobial Resistance for Multiple Bacterial Species Using Neural Networks.

Machine learning has proven to be a powerful method to predict antimicrobial resistance (AMR) without using prior knowledge for selected bacterial species-antimicrobial combinations. To date, only species-specific machine learning models have been developed, and to the best of our knowledge, the inclusion of information from multiple species has not been attempted. The aim of this study was to determine the feasibility of including information from multiple bacterial species to predict AMR for an individual species, since this may make it easier to train and update resistance predictions for multiple species and may lead to improved predictions. Whole-genome sequence data and susceptibility profiles from 3,528 Mycobacterium tuberculosis, 1,694 Escherichia coli, 658 Salmonella enterica, and 1,236 Staphylococcus aureus isolates were included. We developed machine learning models trained by the features of the PointFinder and ResFinder programs detected to predict binary (susceptible/resistant) AMR profiles. We tested four feature representation methods to determine the most efficient way for introducing features into the models. When training the model only on the Mycobacterium tuberculosis isolates, high prediction performances were obtained for the six AMR profiles included. By adding information on ciprofloxacin from the additional 3,588 isolates, there was no reduction in performance for the other antimicrobials but an increased performance for ciprofloxacin AMR profile prediction for Mycobacterium tuberculosis and Escherichia coli In conclusion, the species-independent models can predict multi-AMR profiles for multiple species without losing any robustness.IMPORTANCE Machine learning is a proven method to predict AMR; however, the performance of any machine learning model depends on the quality of the input data. Therefore, we evaluated different methods of representing information about mutations as well as mobilizable genes, so that the information can serve as input for a robust model. We combined data from multiple bacterial species in order to develop species-independent machine learning models that can predict resistance profiles for multiple antimicrobials and species with high performance.

Specific PCR-based detection of Phomopsis vexans the cause of leaf blight and fruit rot pathogen of Solanum melongena L.

Leaf blight and fruit rot disease caused by Phomopsis vexans is a devastating disease of brinjal. The detection of P. vexans in plant parts and seeds of brinjal can be complicated, mainly when the inoculum is present at low levels and/or overgrown by fast-growing saprophytic fungi or other seed-borne fungi. A PCR-based diagnostic method was developed with specific primers designed based on sequence data of a region consisting of the 5·8S RNA gene and internal transcribed spacers, ITS 1 and ITS 2 of nuclear ribosomal RNA gene (rDNA) repeats of P. vexans. The efficiency and specificity of primer pairs PvexF/PvexR designed were established by PCR analysis of DNA from P. vexans strains isolated from India and fungal isolates of other genera. A single amplification product of 323-bp was detected from DNA of P. vexans isolates. No cross-reaction was observed with any of the other isolates tested. The specific primers designed and employed in PCR detected P. vexans up to 10 pg from DNA isolated from pure culture. This is the first report on the development of species-specific PCR assay for identification and detection of P. vexans. Thus, PCR-based assay developed is very specific, rapid, confirmatory and sensitive tool for the detection of pathogen P. vexans at early stages. SIGNIFICANCE AND IMPACT OF THE STUDY: Phomopsis vexans is an important seed-borne pathogenic fungus responsible for leaf blight and fruit rot in brinjal. Current detection methods, based on culture and morphological identification is time consuming, laborious and are not always reliable. A PCR-based diagnostic method was developed with species-specific primers designed based on sequence data of a region consisting of the 5·8S RNA gene and internal transcribed spacers, ITS 1 and ITS 2 of nuclear ribosomal RNA gene (rDNA) repeats of P. vexans.

Contaminating viral sequences in high-throughput sequencing viromics: a linkage study of 700 sequencing libraries.

OBJECTIVES: Sample preparation for high-throughput sequencing (HTS) includes treatment with various laboratory components, potentially carrying viral nucleic acids, the extent of which has not been thoroughly investigated. Our aim was to systematically examine a diverse repertoire of laboratory components used to prepare samples for HTS in order to identify contaminating viral sequences. METHODS: A total of 322 samples of mainly human origin were analysed using eight protocols, applying a wide variety of laboratory components. Several samples (60% of human specimens) were processed using different protocols. In total, 712 sequencing libraries were investigated for viral sequence contamination. RESULTS: Among sequences showing similarity to viruses, 493 were significantly associated with the use of laboratory components. Each of these viral sequences had sporadic appearance, only being identified in a subset of the samples treated with the linked laboratory component, and some were not identified in the non-template control samples. Remarkably, more than 65% of all viral sequences identified were within viral clusters linked to the use of laboratory components. CONCLUSIONS: We show that high prevalence of contaminating viral sequences can be expected in HTS-based virome data and provide an extensive list of novel contaminating viral sequences that can be used for evaluation of viral findings in future virome and metagenome studies. Moreover, we show that detection can be problematic due to stochastic appearance and limited non-template controls. Although the exact origin of these viral sequences requires further research, our results support laboratory-component-linked viral sequence contamination of both biological and synthetic origin.

The idiopathic normal-pressure hydrocephalus Radscale: a radiological scale for structured evaluation.

BACKGROUND AND PURPOSE: Despite the important role of imaging in diagnosing idiopathic normal-pressure hydrocephalus (iNPH), a structured overall assessment of radiological signs is still lacking. The purpose of this study was to construct a radiological scale, composed of morphological signs of iNPH, and compare it with clinical symptoms. METHODS: In this prospective, population-based study of iNPH, 168 individuals (93 females) [mean age 75 (range 66-92) years] underwent computed tomography of the brain and a neurological examination with assessment of clinical symptoms according to Hellström's iNPH scale. Two radiologists, blinded to clinical data, independently evaluated and measured eight radiological parameters, i.e. Evans' index, callosal angle, size of temporal horns, narrow high-convexity sulci, dilated Sylvian fissures, focally dilated sulci, peri-ventricular hypodensities and bulging of the lateral ventricular roof. RESULTS: In a linear regression model, all parameters except ventricular roof bulging were significantly associated with clinical iNPH symptoms. The seven remaining parameters were summarized into a total iNPH Radscale score ranging from 0 to 12. There was a significant correlation (r = 0.55, P < 0.001) between the total iNPH Radscale score and clinical symptoms. The inter-rater agreement for the included radiological parameters was high (intraclass correlation, 0.74-0.97). CONCLUSION: The iNPH Radscale may become a valuable diagnostic screening tool, allowing a structured radiological assessment. A high iNPH Radscale score together with clinical symptoms should raise suspicion of iNPH, motivating further evaluation for shunt surgery.

Evaluating next-generation sequencing for direct clinical diagnostics in diarrhoeal disease.

The accurate microbiological diagnosis of diarrhoea involves numerous laboratory tests and, often, the pathogen is not identified in time to guide clinical management. With next-generation sequencing (NGS) becoming cheaper, it has huge potential in routine diagnostics. The aim of this study was to evaluate the potential of NGS-based diagnostics through direct sequencing of faecal samples. Fifty-eight clinical faecal samples were obtained from patients with diarrhoea as part of the routine diagnostics at Hvidovre University Hospital, Denmark. Ten samples from healthy individuals were also included. DNA was extracted from faecal samples and sequenced on the Illumina MiSeq system. Species distribution was determined with MGmapper and NGS-based diagnostic prediction was performed based on the relative abundance of pathogenic bacteria and Giardia and detection of pathogen-specific virulence genes. NGS-based diagnostic results were compared to conventional findings for 55 of the diarrhoeal samples; 38 conventionally positive for bacterial pathogens, two positive for Giardia, four positive for virus and 11 conventionally negative. The NGS-based approach enabled detection of the same bacterial pathogens as the classical approach in 34 of the 38 conventionally positive bacterial samples and predicted the responsible pathogens in five of the 11 conventionally negative samples. Overall, the NGS-based approach enabled pathogen detection comparable to conventional diagnostics and the approach has potential to be extended for the detection of all pathogens. At present, however, this approach is too expensive and time-consuming for routine diagnostics.

Norwegian patients and retail chicken meat share cephalosporin-resistant Escherichia coli and IncK/blaCMY-2 resistance plasmids.

OBJECTIVES: In 2012 and 2014 the Norwegian monitoring programme for antimicrobial resistance in the veterinary and food production sectors (NORM-VET) showed that 124 of a total of 406 samples (31%) of Norwegian retail chicken meat were contaminated with extended-spectrum cephalosporin-resistant Escherichia coli. The aim of this study was to compare selected cephalosporin-resistant E. coli from humans and poultry to determine their genetic relatedness based on whole genome sequencing (WGS). METHODS: Escherichia coli representing three prevalent cephalosporin-resistant multi-locus sequence types (STs) isolated from poultry (n=17) were selected from the NORM-VET strain collections. All strains carried an IncK plasmid with a blaCMY-2 gene. Clinical E. coli isolates (n=284) with AmpC-mediated resistance were collected at Norwegian microbiology laboratories from 2010 to 2014. PCR screening showed that 29 of the clinical isolates harboured both IncK and blaCMY-2. All IncK/blaCMY-2-positive isolates were analysed with WGS-based bioinformatics tools. RESULTS: Analysis of single nucleotide polymorphisms (SNP) in 2.5 Mbp of shared genome sequences showed close relationship, with fewer than 15 SNP differences between five clinical isolates from urinary tract infections (UTIs) and the ST38 isolates from poultry. Furthermore, all of the 29 clinical isolates harboured IncK/blaCMY-2 plasmid variants highly similar to the IncK/blaCMY-2 plasmid present in the poultry isolates. CONCLUSIONS: Our results provide support for the hypothesis that clonal transfer of cephalosporin-resistant E. coli from chicken meat to humans may occur, and may cause difficult-to-treat infections. Furthermore, these E. coli can be a source of AmpC-resistance plasmids for opportunistic pathogens in the human microbiota.

Biochemical and molecular tools reveal two diverse Xanthomonas groups in bananas.

Xanthomonas campestris pv. musacearum (Xcm) causing the banana Xanthomonas wilt (BXW) disease has been the main xanthomonad associated with bananas in East and Central Africa based on phenotypic and biochemical characteristics. However, biochemical methods cannot effectively distinguish between pathogenic and non-pathogenic xanthomonads. In this study, gram-negative and yellow-pigmented mucoid bacteria were isolated from BXW symptomatic and symptomless bananas collected from different parts of Uganda. Biolog, Xcm-specific (GspDm), Xanthomonas vasicola species-specific (NZ085) and Xanthomonas genus-specific (X1623) primers in PCR, and sequencing of ITS region were used to identify and characterize the isolates. Biolog tests revealed several isolates as xanthomonads. The GspDm and NZ085 primers accurately identified three isolates from diseased bananas as Xcm and these were pathogenic when re-inoculated into bananas. DNA from more isolates than those amplified by GspDm and NZ085 primers were amplified by the X1623 primers implying they are xanthomonads, these were however non-pathogenic on bananas. In the 16-23 ITS sequence based phylogeny, the pathogenic bacteria clustered together with the Xcm reference strain, while the non-pathogenic xanthomonads isolated from both BXW symptomatic and symptomless bananas clustered with group I xanthomonads. The findings reveal dynamic Xanthomonas populations in bananas, which can easily be misrepresented by only using phenotyping and biochemical tests. A combination of tools provides the most accurate identity and characterization of these plant associated bacteria. The interactions between the pathogenic and non-pathogenic xanthomonads in bananas may pave way to understanding effect of microbial interactions on BXW disease development and offer clues to biocontrol of Xcm.

Evaluation of peptide selection approaches for epitope-based vaccine design.

A major challenge in epitope-based vaccine (EV) design stems from the vast genomic variation of pathogens and the diversity of the host cellular immune system. Several computational approaches have been published to assist the selection of potential T cell epitopes for EV design. So far, no thorough comparison between the current methods has been realized. Using human immunodeficiency virus as test case, different EV selection algorithms were evaluated with respect to their ability to select small peptides sets with broad coverage of allelic and pathogenic diversity. The methods were compared in terms of in silico measurements simulating important vaccine properties like the ability of inducing protection against a multivariant pathogen in a population; the predicted immunogenicity; pathogen, allele, and population coverage; as well as the conservation of selected epitopes. Additionally, we evaluate the use of human leukocyte antigen (HLA) supertypes with regards to their applicability for population-spanning vaccine design. The results showed that in terms of induced protection methods that simultaneously aim to optimize pathogen and HLA coverage significantly outperform methods focusing on pathogen coverage alone. Moreover, supertype-based approaches for coverage of HLA diversity were showed to yield only satisfying results in populations in which the supertype representatives are prevalent.

Identification of a novel UTY-encoded minor histocompatibility antigen.

Minor histocompatibility antigens (mHags) encoded by the Y-chromosome (H-Y-mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H-Y-mHag, YYNAFHWAI (UTY(139-147)), encoded by the UTY gene and presented by HLA-A*24:02. Briefly, short peptide stretches encompassing multiple putative H-Y-mHags were designed using a bioinformatics predictor of peptide-HLA binding, NetMHCpan. These peptides were used to screen for peptide-specific HLA-restricted T cell responses in peripheral blood mononuclear cells obtained post-HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA-restriction element. Using peptide/HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA-A*24:02-restricted and directed against the male UTY(139-147) peptide. Functional analysis of these T cells demonstrated male UTY(139-147) peptide-specific cytokine secretion (IFNγ, TNFα and MIP-1ß) and cytotoxic degranulation (CD107a). In contrast, no responses were seen when the T cells were stimulated with patient tumour cells alone. CD8+ T cells specific for this new H-Y-mHag were found in three of five HLA-A*24:02-positive male recipients of female donor HCT grafts available for this study.

Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania.

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 µl of sterile distilled water and 50 µl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5'GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5'CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Detection of Tobacco mosaic virus and Tomato mosaic virus in pepper and tomato by multiplex RT-PCR.

AIMS: To develop a highly sensitive and rapid protocol for simultaneous detection and differentiation of Tobacco mosaic virus (TMV) and Tomato mosaic virus (ToMV) in pepper and tomato. In this study, we use the multiplex PCR technique to detect dual infection of these two viruses. METHODS AND RESULTS: A multiplex RT-PCR method consisting of one-tube reaction with two primer pairs targeted to replicase genes was developed to simultaneously detect TMV and ToMV in seed samples of pepper and tomato. Specific primers were designed from conserved regions of each of the virus genomes, and their specificity was confirmed by sequencing PCR products. RT-PCR detected up to 10(-6) dilution of total RNA extracted from infected leaves. Multiplex RT-PCR revealed the presence of both TMV and ToMV in three of 18 seed samples of tomato and one of 18 seed samples of pepper. CONCLUSIONS: The multiplex PCR assay was a cost effective, quick diagnostic technique, which was helpful in differentiating TMV and ToMV accurately. SIGNIFICANCE AND IMPACT OF THE STUDY: The multiplex PCR assay described in this study is a valuable tool for plant pathology and basic research studies. This method may facilitate better recognition and distinction of TMV and ToMV in both pepper and tomato.

First Report of Bean common mosaic virus Infecting Lablab purpureus in India.

Lablab bean (Lablab purpureus L. Sweet) is a widely cultivated, highly drought tolerant legume vegetable crop grown in diverse environmental conditions worldwide. In India and elsewhere, the young pods are consumed as a fresh vegetable and mature dry seeds are important in the diet of people preferring vegetarian food (2). Small-holding farmers use their own saved seeds for sowing. During October 2008, L. purpureus exhibiting symptoms of stunting, mosaic, vein-banding, vein-clearing, mottling, and blisters suggestive of a viral infection were observed in and around the Mysore District of Karnataka State, India. Incidence of the disease ranged from 1 to 10% in different fields. Symptomatic leaves were collected from fields of Daripura Village, Mysore District, Karnataka. Viruses that were tested by indirect ELISA included Cucumber mosaic virus, Tobacco mosaic virus, Cowpea aphid-borne mosaic virus, Cowpea mosaic virus, Cowpea mottle virus, Southern bean mosaic virus, and Bean common mosaic virus (BCMV). Results of the ELISA tests indicated that all 28 samples collected from different fields were infected with BCMV. Examination of tissue sap from symptomatic plants by electron microscopy revealed flexuous rod-shaped particles (~750 nm long). An immunocapture-reverse transcription (IC-RT)-PCR assay employing degenerate primers for amplifying partial coat protein (CP) and 3'-UTR of potyviruses (1) yielded a ~700-bp product that was cloned and sequenced (GenBank Accession No. HM776637). Sequence identity at the nucleotide level was 96% with BCMV strain NL-7n (GenBank Accession No. GQ456169) infecting common bean from Himachal Pradesh, India. RTPCR was performed with a virus-specific primer pair (FW3-5'-GCAGTAGCACAGATGAAGGCA-3': Rv3-5'-GGTTCTTCCGGCTTACTCATAAACAT-3') designed to amplify 340 bp, the partial coat protein gene of BCMV. All symptomatic L. purpureus field samples and screenhouse-grown seedlings manually inoculated with infected sap were positive for BCMV infection in RT-PCR assay employing specific primers with amplification of a 340-bp product. To our knowledge, this is the first report of BCMV infecting L. purpureus in India. BCMV has also been reported in L. purpureus in Uganda (4) and Nigeria (3). Plants that were confirmed by ELISA to be infected were tagged, and from these plants, seeds were collected and pooled. Four hundred seeds were germinated and a rate of 6.5% seed transmission was determined based on symptoms, ELISA, and PCR. From December 2008 to December 2010, different L. purpureus plantings were monitored for BCMV incidence. Plants infected at different growth stages were tagged and pods were harvested from infected and healthy plants. Data from at least 100 BCMV-infected L. purpureus plants from each of 12 different fields were recorded for yield loss analysis. In terms of number of pods per plant, number of seeds per pod, and seed weight, an average as much as 40% yield loss was recorded from 12 different fields. Because seeds collected from these plants are used for subsequent plantings, these plants may act as virus reservoirs or foci of infection. References: (1) A. S. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) M. N. Maruthi et al. Ann. Appl. Biol. 149:187, 2006. (3) O. O. Odedara et al. J. Gen. Virol. 74:322, 2008. (4) T. N. Sengooba et al. Plant Pathol. 46:95, 1997.

High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4+ T cell responses more than 30 years post-vaccinia virus vaccination.

Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human leucocyte antigen (HLA) class I binders (K(D)

MHC-I-restricted epitopes conserved among variola and other related orthopoxviruses are recognized by T cells 30 years after vaccination.

It is many years since the general population has been vaccinated against smallpox virus. Here, we report that human leukocyte antigen (HLA) class I restricted T cell epitopes can be recognized more than 30 years after vaccination. Using bioinformatic methods, we predicted 177 potential cytotoxic T lymphocyte epitopes. Eight epitopes were confirmed to stimulate IFN-gamma release by T cells in smallpox-vaccinated subjects. The epitopes were restricted by five supertypes (HLA-A1, -A2, -A24 -A26 and -B44). Significant T cell responses were detected against 8 of 45 peptides with an HLA class I affinity of K(D) less than or equal to 5 nM, whereas no T cell responses were detected against 60 peptides with an HLA affinity of K(D) more than 5 nM. All epitopes were fully conserved in seven variola, vaccinia and cowpox strains. Knowledge of the long-term response to smallpox vaccination may lead to a better understanding of poxvirus immunity and may aid in the development of new improved vaccines and diagnostic tools.

Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules.

Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the distinct non-nodulating phenotype of nin mutants in P. sativum, Lotus japonicus, and Medicago truncatula. The vector based on Pea early browning virus (PEBV) was engineered to carry one of three nonoverlapping fragments (PsNinA, PsNinB, and PsNinC) derived from the PsNin cDNA. Vector inoculation was mediated by agroinfiltration and, 2 weeks later, a Rhizobium leguminosarum bv. viceae culture was added in order to induce root nodulation. At this time point, it was estimated that systemic silencing was established because leaves of reference plants inoculated with PEBV carrying a fragment of Phytoene desaturase displayed photo bleaching. Three weeks after Rhizobium spp. application, plants inoculated with a control vector nodulated normally, whereas nodulation was almost eliminated in plants inoculated with a vector carrying PsNinA and PsNinC. For plants inoculated with a vector carrying PsNinB, nodulation was reduced by at least 45%. Down-regulation of PsNin transcripts in plants inoculated with vectors carrying PsNin cDNA fragments was confirmed and these plants displayed a relative increase in the root/shoot ratio, as expected if nitrogen fixation had been impaired.

The same allele of translation initiation factor 4E mediates resistance against two Potyvirus spp. in Pisum sativum.

Pathogenicity of two sequenced isolates of Bean yellow mosaic virus (BYMV) was established on genotypes of Pisum sativum L. reported to carry resistance genes to BYMV and other potyviruses. Resistance to the white lupin strain of BYMV (BYMV-W) is inherited as a recessive gene named wlv that maps to linkage group VI together with other Potyvirus resistances. One of these, sbm1, confers resistance to strains of Pea seedborne mosaic virus and previously has been identified as a mutant allele of the eukaryotic translation initiation factor 4E gene (eIF4E). Sequence comparison of eIF4E from BYMV-W-susceptible and -resistant P. sativum genotypes revealed a polymorphism correlating with the resistance profile. Expression of eIF4E from susceptible plants in resistant plants facilitated BYMV-W infection in inoculated leaves. When cDNA of BYMV-W was agroinoculated, resistance mediated by the wlv gene frequently was overcome, and virus from these plants had a codon change causing an Arg to His change at position 116 of the predicted viral genome-linked protein (VPg). Accordingly, plants carrying the wlv resistance gene were infected upon inoculation with BYMV-W derived from cDNA with a His codon at position 116 of the VPg coding region. These results suggested that VPg determined pathogenicity on plants carrying the wlv resistance gene and that wlv corresponded to the sbm1 allele of eIF4E.

SARS CTL vaccine candidates; HLA supertype-, genome-wide scanning and biochemical validation.

An effective Severe Acute Respiratory Syndrome (SARS) vaccine is likely to include components that can induce specific cytotoxic T-lymphocyte (CTL) responses. The specificities of such responses are governed by human leukocyte antigen (HLA)-restricted presentation of SARS-derived peptide epitopes. Exact knowledge of how the immune system handles protein antigens would allow for the identification of such linear sequences directly from genomic/proteomic sequence information (Lauemoller et al., Rev Immunogenet 2001: 2: 477-91). The latter was recently established when a causative coronavirus (SARS-CoV) was isolated and full-length sequenced (Marra et al., Science 2003: 300: 1399-404). Here, we have combined advanced bioinformatics and high-throughput immunology to perform an HLA supertype-, genome-wide scan for SARS-specific CTL epitopes. The scan includes all nine human HLA supertypes in total covering >99% of all individuals of all major human populations (Sette & Sidney, Immunogenetics 1999: 50: 201-12). For each HLA supertype, we have selected the 15 top candidates for test in biochemical binding assays. At this time (approximately 6 months after the genome was established), we have tested the majority of the HLA supertypes and identified almost 100 potential vaccine candidates. These should be further validated in SARS survivors and used for vaccine formulation. We suggest that immunobioinformatics may become a fast and valuable tool in rational vaccine design.

On-pump versus off-pump coronary artery bypass: independent risk factors and off-pump graft patency.

OBJECTIVE: Current knowledge on off-pump coronary artery bypass (OPCAB) generally stems from single surgeons' experience or from series where OPCABs constituted a minor fraction of coronary operations. The present center decided to venture as far into OPCAB as possible during 1999. The present series thus represents the average surgeon's experience. METHODS: During 1999, 533 patients underwent coronary artery bypass grafting using cardiopulmonary bypass (CPB) in 368 and OPCAB in 165 including the circumflex artery (CX) area in 91. Coronary arteriography was performed before discharge in the first 103 OPCAB patients. RESULTS: The CPB and OPCAB groups differed as regards left ventricular ejection fraction (53+/-13 versus 57+/-11, P < 0.0001) and frequency of triple-vessel or left main stem disease (84 versus 32%, P < 0.0001) but were comparable as regards diabetes (12%), prior myocardial infarct (57%), unstable angina (21%), and previous heart surgery (3%). Using multivariate analyses, 30-day mortality (1.3%), P-creatine kinase myocardial band (CKMB) > 80 microg/l (11.1%), re-sternotomy for bleeding (4.5%) or dehiscense (1.7%), transitory cerebral ischemia and stroke (1.7%), supraventricular tachycardia (27.4%), and hospital stay (mean 8 days) were unrelated to off- versus on-pump surgery as well as to OPCAB in triple-vessel disease. CX branches < or = 1mm, > or = 5 distal anastomoses, prior heart surgery, right coronary artery (RCA) branches < or = 1.5mm, 8-21 days old myocardial infarct, female gender, and preoperative acute arrhythmia (among others) were identified as independent risk factors for mortality or increased CKMB in all 533 patients. The latter five risk factors were reproduced in the OPCAB group isolated. The patency in the 103 OPCABs was 95.3, 91.8, and 85.3% in the left anterior descending artery (LAD), CX, and RCA, respectively. Patency was inversely related to diameter of the grafted vessel in the LAD and CX areas, unlike the RCA area. CONCLUSIONS: The results after beating heart surgery were good also in patients with triple-vessel disease, but specific gains relative to on-pump surgery could not be shown. The independent risk factors in the OPCAB group may indicate relative contraindications for OPCAB grafting.