SARS-CoV-2 Antibodies in Human Milk After mRNA and Adenovector-Based Vaccination: A Systematic Review and Meta-Analysis.

BACKGROUND: SARS-CoV-2 specific antibodies exist in human milk expressed by lactating parents after vaccination. In the existing research, the effects of vaccine types on human milk are inconsistent. RESEARCH AIM: This study aims to perform a systematic review and meta-analysis of the existing observational studies to compare the positive rates of SARS-CoV-2 specific antibodies in human milk according to mRNA and adenovector-based vaccination. METHODS: PubMed, Web of Science, Elsevier Science Direct and Cochrane Library databases were systematically searched for relevant articles published from December 30, 2019 to February 15, 2023. Observational studies were considered eligible provided they reported data on SARS-CoV-2 specific antibodies in human milk. The risk of bias in non-randomized studies of interventions (ROBINS-I) tool, the Newcastle-Ottawa Scale (NOS), and the Agency for Healthcare Research and Quality (AHRQ) were used to assess risk of bias. Seven studies, including 511 lactating participants, were included in this review and meta-analysis. RESULTS: The positive rate of SARS-CoV-2 IgA is higher in mRNA vaccine groups than in adenovector-based vaccine groups (OR = 4.80, 95% CI [3.04, 7.58], p < 0.001). The positive rate of SARS-CoV-2 IgG was higher in mRNA vaccines than in adenovector-based vaccines. CONCLUSIONS: Compared to adenovector-based vaccines, mRNA vaccines present a higher positivity rate of IgA and IgG in human milk after vaccination. In other words, mRNA vaccinations may offer breastfed children a higher level of protection than adenovector-based vaccinations. Further high-quality data is still required to substantiate these findings.

Small molecule drug discovery targeting the JAK-STAT pathway.

The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway functions as a central hub for transmitting signals from more than 50 cytokines, playing a pivotal role in maintaining hematopoiesis, immune balance, and tissue homeostasis. Dysregulation of this pathway has been implicated in various diseases, including immunodeficiency, autoimmune conditions, hematological disorders, and certain cancers. Proteins within this pathway have emerged as effective therapeutic targets for managing these conditions, with various approaches developed to modulate key nodes in the signaling process, spanning from receptor engagement to transcription factor activation. Following the success of JAK inhibitors such as tofacitinib for RA treatment and ruxolitinib for managing primary myelofibrosis, the pharmaceutical industry has obtained approvals for over 10 small molecule drugs targeting the JAK-STAT pathway and many more are at various stages of clinical trials. In this review, we consolidate key strategies employed in drug discovery efforts targeting this pathway, with the aim of contributing to the collective understanding of small molecule interventions in the context of JAK-STAT signaling. We aspire that our endeavors will contribute to advancing the development of innovative and efficacious treatments for a range of diseases linked to this pathway dysregulation.

The New Challenge of Obesity - Obesity-Associated Nephropathy.

In recent years, obesity has become one of the major diseases that affect human health and consume human health resources, especially when it causes comorbidities such as hypertension, diabetes, cardiovascular disease and kidney disease. Many studies have demonstrated that obesity is associated with the development of chronic kidney disease and can exacerbate the progression of end-stage renal disease. This review described the mechanisms associated with the development of obesity-associated nephropathy and the current relevant therapeutic modalities, with the aim of finding new therapeutic targets for obesity-associated nephropathy. The mechanisms of obesity-induced renal injury include, in addition to the traditional alterations in renal hemodynamics, the involvement of various mechanisms such as macrophage infiltration in adipose tissue, alterations in adipokines (leptin and adiponectin), and ectopic deposition of lipids. At present, there is no "point-to-point" treatment for obesity-induced kidney injury. The renin-angiotensin-aldosterone system (RAAS) inhibitors, sodium-dependent glucose transporter 2 (SGLT-2) inhibitors and bariatric surgery described in this review can reduce urinary protein to varying degrees and delay the progression of kidney disease. In addition, recent studies on the therapeutic effects of intestinal flora on obesity may reduce the incidence of obesity-related kidney disease from the perspective of primary prevention. Both of these interventions have their own advantages and disadvantages, so the continuous search for the mechanism of obesity-induced related kidney disease will be extremely helpful for the future treatment of obesity-related kidney disease.

Acevaltrate promotes apoptosis and inhibits proliferation by suppressing HIF-1α accumulation in cancer cells.

Acevaltrate is a natural product isolated from the roots of Valeriana glechomifolia F.G.Mey. (Valerianaceae) and has been shown to exhibit anti-cancer activity. However, the mechanism by which acevaltrate inhibits tumor growth is not fully understood. We here demonstrated the effect of acevaltrate on hypoxia-inducible factor-1α (HIF-1α) expression. Acevaltrate showed a potent inhibitory activity against HIF-1α induced by hypoxia in various cancer cells. This compound markedly decreased the hypoxia-induced accumulation of HIF-1α protein dose-dependently. Further analysis revealed that acevaltrate inhibited HIF-1α protein synthesis and promoted degradation of HIF-1α protein, without affecting the expression level of HIF-1α mRNA. Moreover, the phosphorylation levels of mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase (p70S6K), and eIF4E binding protein-1 (4E-BP1) were significantly suppressed by acevaltrate. In addition, acevaltrate promoted apoptosis and inhibited proliferation, which was potentially mediated by suppression of HIF-1α. We also found that acevaltrate administration inhibited tumor growth in mouse xenograft model. Taken together, these results suggested that acevaltrate was a potent inhibitor of HIF-1α and provided a new insight into the mechanisms of acevaltrate against cancers.

Astaxanthin reduces inflammation and promotes a chondrogenic phenotype by upregulating SIRT1 in osteoarthritis.

OBJECTIVE: To investigate the effects of astaxanthin (AST) on mouse osteoarthritis (OA) and lipopolysaccharide (LPS)-induced ATDC5 cell damage and to explore whether SIRT1 protein plays a role. METHODS: In this study, some mouse OA models were constructed by anterior cruciate ligament transection (ACLT). Imaging, molecular biology and histopathology methods were used to study the effect of AST administration on traumatic OA in mice. In addition, LPS was used to stimulate ATDC5 cells to mimic the inflammatory response of OA. The effects of AST on the cell activity, inflammatory cytokines, matrix metalloproteinases and collagen type II levels were studied by CCK8 activity assay, reverse transcription polymerase chain reaction and protein imprinting. The role of SIRT1 protein was also detected. RESULTS: In the mouse OA model, the articular surface collapsed, the articular cartilage thickness and cartilage matrix protein abundance were significantly decreased, while the expression of inflammatory cytokines and matrix metalloproteinases was increased; but AST treatment reversed these effects. Meanwhile, AST pretreatment could partially reverse LPS-induced ATDC5 cell damage and upregulate SIRT1 expression, but this protective effect of AST was attenuated by concurrent administration of the SIRT1 inhibitor Ex527. CONCLUSION: AST can protect against the early stages of OA by affecting SIRT1 signalling, suggesting that AST might be a potential therapeutic agent for OA treatment.

Design, synthesis and evaluation of C-5 substituted pyrrolopyridine derivatives as potent Janus Kinase 1 inhibitors with excellent selectivity.

The development of highly selective Janus Kinase 1 (JAK1) inhibitors is crucial for improving efficacy and minimizing adverse effects in the clinical treatment of autoimmune diseases. In a prior study, we designed a series of C-5 4-pyrazol substituted pyrrolopyridine derivatives that demonstrated significant potency against JAK1, with a 10 âˆ¼ 20-fold selectivity over Janus Kinase 2 (JAK2). Building on this foundation, we adopted orthogonal strategy by modifying the C-5 position with 3-pyrazol/4-pyrazol/3-pyrrol groups and tail with substituted benzyl groups on the pyrrolopyridine head to enhance both potency and selectivity. In this endeavor, we have identified several compounds that exhibit excellent potency and selectivity for JAK1. Notably, compounds 12b and 12e, which combined 4-pyrazol group at C-5 site and meta-substituted benzyl tails, displayed IC50 value with 2.4/2.2 nM and high 352-/253-fold selectivity for JAK1 over JAK2 in enzyme assays. Additionally, both compounds showed good JAK1-selective in Ba/F3-TEL-JAK1/2 cell-based assays. These findings mark a substantial improvement, as these compounds are 10-fold more potent and over 10-fold more selective than the best compound identified in our previous study. The noteworthy potency and selectivity properties of compounds 12b and 12e suggest their potential utility in furthering the development of drugs for autoimmune diseases.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].

Cytokines: The links between bone and the immune system.

Osteoporosis results from an imbalance in a highly balanced physiological process called bone remodeling, in which osteoclast-mediated bone resorption and osteoblast-mediated bone formation play important roles. Osteoimmunology is a newly discovered interdisciplinary research field that focuses on the relationship between bone and the immune system. Specifically, bone and the immune system interact through cytokines, immune cells secrete cytokines, and cytokines finely regulate bone metabolism by mediating the differentiation and activity of osteoclasts and osteoblasts. Therefore, understanding the influence of cytokines on bone metabolism is conducive for the development of novel targeted drugs against immune-related bone diseases. This review summarizes the pathophysiological functions of various common cytokines in bone and discusses the potential clinical value of multiple cytokines in immune-mediated bone diseases.

Effect and Mode of Different Concentrations of Citrus Peel Extract Treatment on Browning of Fresh-Cut Sweetpotato.

Browning is one of the main phenomena limiting the production of fresh-cut sweetpotatoes. This study investigated the anti-browning effect of citrus peel extracts and the key components and modes of action associated with browning in fresh-cut sweetpotatoes. Five different concentrations of citrus peel extract (1, 1.5, 2, 2.5 and 3 g/L) were selected to ensure storage quality; and the physical and chemical properties of fresh-cut sweetpotato slices were analysed. A concentration of 2 g/L of citrus peel extract significantly inhibited the browning of fresh-cut sweetpotatoes. The results showed that the browning index and textural characteristics of fresh-cut sweetpotatoes improved significantly after treatment with citrus peel extract; all the citrus peel extract solutions inhibited browning to some extent compared to the control. In addition; LC-IMS-QTOFMS analysis revealed a total of 1366 components in citrus peel extract; the evaluation of citrus peel extract monomeric components that prevent browning in fresh-cut sweetpotato indicated that the components with better anti-browning effects were citrulloside, hesperidin, sage secondary glycosides, isorhamnetin and quercetin. The molecular docking results suggest that citrullosides play a key role in the browning of fresh-cut sweetpotatoes. In this study, the optimum amount of citrus peel extract concentration was found to be 2 g/L.

Design and Synthesis of Pyrimidine Amine Containing Isothiazole Coumarins for Fungal Control.

Developing new fungicides is always crucial to protecting crops. A series of 4-(3,4-dichloroisothiazol-5-yl)-7-(2-((5-(5-pyrimidin-4-yl)amino)ethoxy)-8-methyl) coumarin derivatives were designed and synthesized by Williamson ether condensation and substitution reactions. Structure determinations were clarified by 1H NMR, 13C NMR, and HRMS, and compound 4h crystallized by the fusion method for further structural confirmation. The in vitro bioassay results showed that the target compounds displayed good fungicidal activity against Alternaria solani, Botrytis cinerea, Cercospora arachidicola, Fusarium graminearum, Physalospora piricola, Rhizoctonia solani, and Sclerotinia sclerotiorum. Among them, compounds 4b and 4d showed higher inhibitory activity against R. solani, with EC50 values of 11.3 and 13.7 µg/mL, respectively, and they were more active than the positive control diflumetorim with an EC50 value of 19.8 µg/mL. Molecular docking suggested that compound 4b and diflumetorim may have similar interactions with complex I NADH oxidoreductase. Density functional theory calculation and pesticide-likeness analysis studies gave a rational explanation of their fungicidal activity. These results indicated that compounds 4b and 4d deserved further optimization according to the principle of pesticide-likeness.

Design, Synthesis and Fungicidal Activity of Ester Derivatives of 4-(3,4-Dichloroisothiazole) 7-Hydroxy Coumarin.

The development of new fungicides is vital for safeguarding crops and ensuring sustainable agriculture. Building on our previous finding that 4-(3,4-dichloroisothiazole)-7-hydroxy coumarins can be used as fungicidal leads, 44 novel coumarin ester derivatives were designed and synthesized to evaluate whether esterification could enhance their fungicidal activity. In vitro fungicidal bioassays indicated that compound 2ai displayed good activity against Alternaria solani, Botrytis cinereal, Cercospora arachidicola, Physalospora piricola and Sclerotinia sclerotiorum, with an EC50 value ranging from 2.90 to 5.56 µg/mL, comparable to the lead compound 1a, with its EC50 value ranging from 1.92 to 9.37 µg/mL. In vivo bioassays demonstrated that compounds 1a, 2ar and 2bg showed comparable, excellent efficacy against Pseudoperonospora cubensis at a dose of 25 µg/mL. Our research shows that the esterification of 4-(3,4-dichloroisothiazole) 7-hydroxycoumarins results in a fungicidal activity equivalent to that of its lead compounds. Furthermore, our density functional theory (DFT) calculations and 3D-QSAR modeling provide a rational explanation of the structure-activity relationship and offer valuable insights to guide further molecular design.

Discovery of C-5 Pyrazole-Substituted Pyrrolopyridine Derivatives as Potent and Selective Inhibitors for Janus Kinase 1.

Developing selective inhibitors for Janus kinase 1 (JAK1) is a significant focus for improving the efficacy and alleviating the adverse effects in treating immune-inflammatory diseases. Herein, we report the discovery of a series of C-5 pyrazole-modified pyrrolopyrimidine derivatives as JAK1-selective inhibitors. The potential hydrogen bond between the pyrazole group and E966 in JAK1 is the key point that enhances JAK1 selectivity. These compounds exhibit 10- to 20-fold JAK1 selectivity over JAK2 in enzyme assays. Compound 12b also exhibits excellent JAK1 selectivity in Ba/F3-TEL-JAK cellular assays. Metabolism studies and the results of the hair growth model in mice indicate that compound 12b may be a viable lead compound for the development of highly JAK1-selective inhibitors for immune and inflammatory diseases.

CUL4A-mediated ZEB1/microRNA-340-5p/HMGB1 axis promotes the development of osteoporosis.

Understanding the molecular mechanisms underlying osteoclast differentiation provides insights into bone loss and even osteoporosis. The specific mechanistic actions of cullin 4A (CUL4A) in osteoclast differentiation and resultant osteoporosis is poorly explored. We developed a mouse model of osteoporosis using bilateral ovariectomy (OVX) and examined CUL4A expression. It was noted that CUL4A expression was increased in the bone marrow of OVX mice. Overexpression of CUL4A promoted osteoclast differentiation, and knockdown of CUL4A alleviated osteoporosis symptoms of OVX mice. Bioinformatic analyses were applied to identify the downstream target genes of microRNA-340-5p (miR-340-5p), followed by interaction analysis. The bone marrow macrophages (BMMs) were isolated from femur of OVX mice, which were transfected with different plasmids to alter the expression of CUL4A, Zinc finer E-box binding homeobox 1 (ZEB1), miR-340-5p, and Toll-like receptor 4 (TLR4). ChIP assay was performed to detect enrichment of ZEB1 promoter by H3K4me3 antibody in BMMs. ZEB1 was overexpressed in the bone marrow of OVX mice. Overexpression of CUL4A mediated H3K4me3 methylation to increase ZEB1 expression, thus promoting osteoclast differentiation. Meanwhile, ZEB1 could inhibit miR-340-5p expression and upregulate HMGB1 to induce osteoclast differentiation. Overexpressed ZEB1 activated the TLR4 pathway by regulating the miR-340-5p/HMGB1 axis to induce osteoclast differentiation, thus promoting the development of osteoporosis. Overall, E3 ubiquitin ligase CUL4A can upregulate ZEB1 to repress miR-340-5p expression, leading to HMGB1 upregulation and the TLR4 pathway activation, which promotes osteoclast differentiation and the development of osteoporosis.

Improvement in the Thermal Conductivity of Silver Epoxy Adhesive by Treating with Water Vapor.

With the miniaturization of electronic devices, electronic packaging has become increasingly precise and complex, which presents a significant challenge in terms of heat dissipation. Electrically conductive adhesives (ECAs), particularly silver epoxy adhesives, have emerged as a new type of electronic packaging material, thanks to their high conductivity and stable contact resistance. However, while there has been extensive research on silver epoxy adhesives, little attention has been paid to improving their thermal conductivity, which is a critical requirement in the ECA industry. In this paper, we propose a straightforward method for treating silver epoxy adhesive with water vapor, resulting in a remarkable improvement in thermal conductivity to 9.1 W/(m·K), three times higher than the sample cured using traditional methods (2.7 W/(m·K)). Through research and analysis, the study demonstrates that the introduction of H2O into the gaps and holes of the silver epoxy adhesive increases the path of electron conduction, thereby improving thermal conductivity. Furthermore, this method has the potential to significantly improve the performance of packaging materials and meet the needs of high-performance ECAs.

Induced transformation of antimony trioxide by Mn(II) oxidation and their co-transformed mechanism.

Antimony (Sb) is a toxic and carcinogenic element that often enters soil in the form of antimony trioxide (Sb2O3) and coexists with manganese (Mn) in weakly alkaline conditions. Mn oxides such as birnessite have been found to promote the oxidative dissolution of Sb2O3, but few researches concerned the co-transformations of Sb2O3 and Mn(II) in environment. This study investigated the mutual effect of abiotic oxidation of Mn(II) and the coupled oxidative dissolution of Sb2O3. The influencing factors, such as Mn(II) concentrations, pH and oxygen were also discussed. Furthermore, their co-transformed mechanism was also explored based on the analysis of Mn(II) oxidation products with or without Sb2O3 using XRD, SEM and XPS. The results showed that the oxidative dissolution of Sb2O3 was enhanced under higher pH and higher Mn(II) loadings. With a lower Mn(II) concentration such as 0.01 mmol/L Mn(II) at pH 9.0, the improved dissolution of Sb2O3 was attributed to the generation of dissolved intermediate Mn(III) species with strong oxidation capacity. However, under higher Mn(II) concentrations, both amorphous Mn(III) oxides and intermediate Mn(III) species were responsible for promoting the oxidative dissolution of Sb2O3. Most released Sb (∼72%) was immobilized by Mn oxides and Sb(V) was dominant in the adsorbed and dissolved total Sb. Meanwhile, the presence of Sb2O3 not only inhibited the removal of Mn(II) by reducing Mn(III) to Mn(II) but also affected the final products of Mn oxides. For example, amorphous Mn oxides were formed instead of crystalline Mn(III) oxides, such as MnOOH. Furthermore, rhodochrosite (MnCO3) was formed with the high Mn(II)/Sb2O3 ratio, but without being observed in the low Mn(II)/Sb2O3 ratio. The results of study could help provide more understanding about the fate of Sb in the environment and the redox transformation of Mn.

Association between heavy metal mercury in body fluids and tissues and diabetes mellitus: a systematic review and meta-analysis.

Background: Recent studies have shown that the relationship between mercury exposure and diabetes is controversial. The aim of this study is to determine the relationship between mercury exposure and diabetes using a systematic review and meta-analysis approach. Methods: We systematically searched PubMed, Web of Science, Cochrane, and Embase databases for cross-sectional, case-control, or cohort studies assessing the correlation between mercury exposure and diabetes in any population. Details of each included study were extracted using a pre-designed Excel spreadsheet. Quality assessment of cohort and case-control studies used the Newcastle-Ottawa Scale (NOS), whereas cross-sectional studies were assessed by the Agency for Healthcare Research and Quality (AHRQ) scale. Meta-analyses were performed using random-effects models to calculate the pooled odds ratio (OR), standardized mean difference (SMD), and their 95% confidence intervals (CIs). Subgroup and sensitivity analyses were employed to assess heterogeneity sources. Begg's and Egger's tests were used to evaluate publication bias. Results: Our meta-analysis included 8 eligible articles, comprising a total of 40,891 subjects, reporting mercury OR and/or concentrations. Among the included studies, one was a case control, one was a cohort study, and the rest were cross-sectional studies. Two studies were rated as high quality and six as medium quality. The results revealed no link between mercury exposure and diabetes (OR: 1.11, 95% CI: 0.80, 1.55, n=6, I2=73.7%; and SMD: 0.41, 95% CI: -0.32, 1.14, n=3, I2=88.7%). In the stratified male and female subgroups, the pooled OR was 0.71 (95% CI: 0.57, 0.90, n=3, I2=0.0%), 1.11 (95% CI: 0.69, 1.79, n=3, I2=67.7%). The Begg's test results revealed no significant publication bias (P=0.06), but the Egger's test results did (P=0.013). The sensitivity analysis confirmed the stability of our results. Conclusions: No significant relationship was observed between mercury and diabetes mellitus. However, more well-designed studies on mercury exposure and diabetes risk are still needed, particularly on the type of mercury (i.e., elemental, inorganic, and organic), exposure time and dose, type of biological specimen, and the population's sex and age.

Fast Fourier transform Ångström method for fast thermal measurements of microfibers.

The Ångström method is a promising thermal diffusivity measurement method for microfibers. Based on the heat-loss Ångström method and micro-Ångström method, the FFT (Fast Fourier Transform) Ångström method can be used to shorten the testing time and enhance the testing robustness of thermal conductivity. The FFT Ångström uses multi-frequency superimposed input signals and then uses the FFT for frequency division analysis. Since different frequencies are input at the same time, the measuring time is greatly reduced. Moreover, because different frequencies are input in the same environment, the random and environmental perturbations of the frequencies are the same, enhancing the fitting robustness. In contrast, the single feeding strategy is relatively time-consuming, and its measurement homogeneity for different frequencies cannot be guaranteed. By comparing the measurement results from a multi-frequency input and separated single-frequency input, the FFT shows good feasibility and robustness. It may also have great potential in other types of thermal wave measurements.

The relationship between islet ß-cell function and metabolomics in overweight patients with Type 2 diabetes.

A cross-sectional study was performed using metabolomics in overweight patients with Type 2 diabetes (T2D) at different stages of the disease. We aimed to identify potential metabolites for assessing islet ß-cell function in order to investigate the correlation between islet ß-cell dysfunction and metabolite changes in overweight patients with T2D. We selected 60 overweight adults (24 ≤ body mass index [BMI] < 28 kg/m2) with T2D who had been admitted to our hospital. The participants were equally divided into three groups according to disease duration: H1 (duration ≤ 5 years), H2 (5 years < duration ≤ 10 years), and H3 (duration > 10 years). Questionnaires, physical examinations, laboratory tests, and imaging studies were administered to all participants. The modified homeostasis model of assessment (HOMA) index was calculated using fasting C-peptide levels, and metabolite assays were performed using mass spectrometry. The results showed that HOMA-ß and visceral fat area (VFA) were negatively correlated with diabetes duration. The VFA was positively correlated with arginine, cysteine, methionine, proline, and succinyl/methylmalonylcarnitine levels. The HOMA-ß was negatively correlated with the serine and tetradecanoyldiacylcarnitine levels, and positively correlated with the aspartic acid, cysteine, homocysteine, piperamide, proline, and valine levels. The HOMA-IR was negatively correlated with hydroxypalmitoylcarnitine levels and positively correlated with the myristoylcarnitine levels. Thus, at different stages of T2D progression in overweight patients, serine, aspartic acid, cysteine, homocysteine, piperamide, proline, valine, and tetradecanoyldiacylcarnitine may be associated with HOMA-ß and represent potential novel biomarkers for evaluating islet ß-cell function.

Downregulation of desmoglein 2 promotes EMT progression in gallbladder cancer.

OBJECTIVE: To explore the correlation between the expression level of Desmoglein 2 (DSG2) and the epithelial-mesenchymal transition (EMT) progression in gallbladder cancer (GBC). METHOD: 106 GBC tissue specimens and corresponding clinical information were collected to make a tissue microarray. Immunohistochemical method was used to test the expression level of DSG2 in GBC tissues. DSG2 was knocked down in the GBC cell line GBC-SD to detect the change of its invasion and metastasis ability. Then RT-qPCR and Western Blot were applied on the DSG2-knocked down GBC-SD cells to detect the expression level change of genes associated with EMT. RESULT: The high expression rate of DSG2 was significantly correlated with the N, M and TNM staging of patients (P<0.05). Survival analysis identified that GBC patients with high DSG2 expression level had significantly better survival (P<0.05). To further investigate the potential mechanism of DSG2 on regulating GBC tumor progression, we used knockdown DSG2 on GBC-SD cell lines. The results showed that GBC-SD cell lines with DSG2 knockdown showed a promotion of cell invasion and metastatic ability. The mRNA levels of EMT-related genes E-Cadherin, Snail, Twist, ZEB1, and ß-catenin, which is a key protein in the Wnt signaling pathway, were also significantly altered. Besides, protein levels of E-cadherin and Snail showed consistent results. CONCLUSION: The downregulation of DSG2 in gallbladder cancer is hypothesized to be associated with the invasion and metastasis progression of gallbladder cancer cells by regulating EMT-related pathways. Its expression level can be a novel biomarker for gallbladder cancer, providing new perspectives for diagnosis and treatment strategies.

The influence of water level fluctuations on the migration and enrichment of phosphorus in an agricultural groundwater system, Jianghan Plain.

The enrichment of phosphorus (P) in groundwater (GW) has been regarded as one of the most important sources of water eutrophication, but its sources and mechanisms have remained unclear. This study focused on hydraulic change show that drove the migration of P in an agricultural groundwater system, Jianghan Plain, Central China. Based on four rounds of field investigation over different seasons and across two consecutive years. Seasonable water table fluctuations (WLFs) reached 1.6 m and 3.8 m in GW and surface water (SW), respectively. Moreover, the concentrations of P in GW were obviously higher than those in SW where 54.1% of all GW samples presented higher content of P than the World Health Organization (WHO) limit of 0.4 mg/L with the highest one arriving to 1.97 mg/L. Although the trends and amplitudes varied at different points and depths, the spatial and temporal distribution of P corresponded with the local WLFs that were responsible for the enrichment of GW P. On the one hand, WLFs changed hydraulic conditions to enhance the migration of soluble P in the unsaturated zone into the aquifer. On the other hand, WLFs resulted in changes to the redox conditions or to the GW hydrochemical compositions, which promoted the dissolution of Fe or Mn containing P. These caused the release and enrichment of P in GW. Therefore, this study helps understand the geochemical cycling of P and improves GW management in the local GW system, Jianghan Plain.