RESUMEN
This paper addresses the issue of LED short-circuit fault detection in signaling and lighting systems in the automotive industry. The conventional diagnostic method commonly implemented in newer vehicles relies on measuring the voltage drop across different LED branches and comparing it with threshold values indicating faults caused by open circuits or LED short circuits. With this algorithm, detecting cases of a few LEDs short-circuited within a branch, particularly a single malfunctioning LED, is particularly challenging. In this work, two easily implementable algorithms are proposed to address this issue within the vehicle's control unit. One is based on a mathematical prediction model, while the other utilizes a neural network. The results obtained offer a 100% LED short-circuit fault detection rate in the majority of analyzed cases, representing a significant improvement over the conventional method, even in scenarios involving a single malfunctioning LED within a branch. Additionally, the neural network-based model can accurately predict the number of failed LEDs.
RESUMEN
In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.
RESUMEN
Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless, and although there are many detection tests in use, the reliability of PCR-based methods is compromised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In this study, a duplex RT-qPCR method was developed and validated against two previously published single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on the use of crude sap or tissue printing were compared with commercially available RNA purification kits. The performance of the new procedure was evaluated in a test performance study involving five participant laboratories. The new method, in combination with rapid-sample-preparation approaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.
RESUMEN
Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.
RESUMEN
Cucumber mosaic virus (CMV; Cucumovirus, Bromoviridae) is an omnipresent virus characterized by a large host range and high genetic variability. Using high-throughput sequencing, we have characterized near complete genomes of 14 Slovak CMV variants from different plant hosts. Of these, three variants originated from the Papaveraceae species (oilseed poppy, common poppy and great celandine), previously poorly described as CMV natural hosts. Based on a BLAST search and phylogenetic analysis, the Slovak CMV isolates can be divided into two genetically different Groups, Ia and II, respectively. The SL50V variant, characterized by a divergent RNA2 sequence, potentially represents a reassortant variant. In four samples (T101, SL50V, CP2, MVU2-21), the presence of satellite CMV RNA was identified along with CMV. Although mechanically transmitted to experimental cucumber plants, the role of satellite RNA in the symptomatology observed could not be established due to a complex infection of original hosts with different viruses.
RESUMEN
In this work, we present a ballistocardiographic (BCG) system for the determination of heart and breath rates and activity of a user lying in bed. Our primary goal was to simplify the analog and digital processing usually required in these kinds of systems while retaining high performance. A novel sensing approach is proposed consisting of a white LED facing a digital light detector. This detector provides precise measurements of the variations of the light intensity of the incident light due to the vibrations of the bed produced by the subject's breathing, heartbeat, or activity. Four small springs, acting as a bandpass filter, connect the boards where the LED and the detector are mounted. Owing to the mechanical bandpass filtering caused by the compressed springs, the proposed system generates a BCG signal that reflects the main frequencies of the heartbeat, breathing, and movement of the lying subject. Without requiring any analog signal processing, this device continuously transmits the measurements to a microcontroller through a two-wire communication protocol, where they are processed to provide an estimation of the parameters of interest in configurable time intervals. The final information of interest is wirelessly sent to the user's smartphone by means of a Bluetooth connection. For evaluation purposes, the proposed system has been compared with typical BCG systems showing excellent performance for different subject positions. Moreover, applied postprocessing methods have shown good behavior for information separation from a single-channel signal. Therefore, the determination of the heart rate, breathing rate, and activity of the patient is achieved through a highly simplified signal processing without any need for analog signal conditioning.
Asunto(s)
Balistocardiografía , Humanos , Balistocardiografía/métodos , Frecuencia Cardíaca/fisiología , Procesamiento de Señales Asistido por Computador , SueñoRESUMEN
The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.
Asunto(s)
Malus , Granada (Fruta) , Viroides , Frutas , Viroides/genéticaRESUMEN
Loquat (Eriobotrya japonica) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.
RESUMEN
The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina. In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.
Asunto(s)
Secuenciación de Nucleótidos de Alto Rendimiento , Olea/virología , Viroma/genética , Animales , Closteroviridae/clasificación , Closteroviridae/genética , Closteroviridae/aislamiento & purificación , Geminiviridae/clasificación , Geminiviridae/genética , Geminiviridae/aislamiento & purificación , Genoma Viral , Hemípteros/virología , Enfermedades de las Plantas/virología , Hojas de la Planta/virología , Virus de Plantas/clasificación , Virus de Plantas/genética , Virus de Plantas/aislamiento & purificación , España , IncertidumbreRESUMEN
BACKGROUND: The present study seeks to evaluate the change in mental health inequalities in the department of Meta after the signing of Colombia's Peace Agreement in 2016 with the FARC guerrilla group. Using a validated survey instrument composed of 20 questions ('SRQ-20'), we measure changes in mental health inequalities from 2014, before the signing of the agreement, to 2018, after the signing. We then decompose the changes in inequalities to establish which socioeconomic factors explain differences in mental health inequalities over time. METHODS: Our study uses information from the Conflicto, Salud y Paz (CONPAS) survey conducted in the department of Meta, Colombia, in 1309 households in 2018, with retrospective information for 2014. To measure inequalities, we calculate the concentration indices for both years. Through the Oaxaca change decomposition method, we disaggregate changes in mental health inequalities into its underlying factors. This method allows us to explain the relationship between changes in mental health inequalities and changes in inequalities in several sociodemographic factors. It also identifies the extent to which these factors help explain the changes in mental health inequalities. RESULTS: Mental health inequalities in Meta were reduced almost by half from 2014 to 2018. In 2018, the population at the lower and middle socioeconomic levels had fewer chances of experiencing mental health disorders in comparison to 2014. The reduction in mental health differences is mostly attributed to reductions in the influence of certain sociodemographic variables, such as residence in rural zones and conflict-affected territories, working in the informal sector, or experiencing internal displacement. However, even though mental health inequalities have diminished, overall mental health outcomes have worsened in these years. CONCLUSIONS: The reduction in the contribution of conflict-related variables for explaining mental health inequalities could mean that the negative consequences of conflict on mental health have started to diminish in the short run after the peace agreement. Nevertheless, conflict and the presence of other socioeconomic inequalities still contribute to persistent adverse mental health outcomes in the overall population. Thus, public policy should be oriented towards improving mental health care services in these territories, given the post-accord context.
Asunto(s)
Conflictos Armados , Disparidades en el Estado de Salud , Trastornos Mentales , Política , Adolescente , Adulto , Anciano , Conflictos Armados/prevención & control , Colombia/epidemiología , Femenino , Encuestas Epidemiológicas , Humanos , Masculino , Trastornos Mentales/epidemiología , Persona de Mediana Edad , Estudios Retrospectivos , Factores Socioeconómicos , Adulto JovenRESUMEN
Loquat (Eriobotrya japonica) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae, infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.
RESUMEN
Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni. In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.
RESUMEN
Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.
RESUMEN
Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).
RESUMEN
In this work, a freshness colorimetric sensor has been integrated with pork meat packages. The sensor tracks rising CO2 levels in the package associated with meat spoilage, as CO2 levels increase with bacterial population. The color of the sensor changes depending on the quantity of bacteria present, therefore it can be correlated with the freshness of meat, in this case pork loin. Detection is achieved by a simple photograph using a smartphone, and analyzing the grey scale from the RGB space color with a custom made app. Only 2 µL of the cocktail (all components are nontoxic) is needed to prepare the sensor, which have been integrated inside meat packages using a variety of support materials prior to sealing. The Smartphone measurements have been validated using a reference method (Checkpoint Analyzer) and the results suggest it can provide the basis for a quick test of the quality of the packaged pork.
Asunto(s)
Colorimetría , Carne/análisis , Teléfono Inteligente , Animales , Embalaje de Alimentos , Carne/microbiología , PorcinosRESUMEN
High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.
Asunto(s)
Closterovirus/genética , Biología Computacional/métodos , Genoma Viral/genética , Secuenciación de Nucleótidos de Alto Rendimiento/métodosRESUMEN
A versatile, compact and low-cost analytical platform has been designed, tested and validated to be used in the point-of-care settings. This passive measurement system is powered and complemented by a standard smartphone including a programmed application for measurement configuration and data processing as well as wireless results sharing. Electrochemical and electrochemiluminescence analytical techniques can be configured and realized by this platform that employs standard screen-printed electrodes for the sample managing and off-the-shelf electronic components. The power, electrical and optical signal processing have been studied in depth. The system can harvest energy up to 22.5â¯mW, set up a voltage in the range of ±1.15â¯V, and measure potentials in a range of 600â¯mV with an uncertainty of 1â¯mV, and current from 2⯵A to 0.75â¯mA with a resolution of 1.1⯵A. Moreover, standard tests have been performed to the platform consisting of amperometric, potentiometric, cyclic voltammetry and electrochemiluminescent analytical techniques, showing excellent agreement with a reference instrument. Finally, our design has also been applied to glucose, pH and H2O2 determinations, providing the full analytical parameters which are in very good agreement with the reference instrument results. Ranges (0.065-0.75â¯M, 0.62-100â¯mM and 3-9 pH units for glucose, H2O2 and pH, respectively) and limits of detection (0.024â¯M and 0.03â¯mM for glucose and H2O2, respectively) make this low-cost platform (Asunto(s)
Técnicas Biosensibles/instrumentación
, Sistemas de Atención de Punto
, Teléfono Inteligente/instrumentación
, Diseño de Equipo
, Glucosa/análisis
, Humanos
, Peróxido de Hidrógeno/análisis
, Concentración de Iones de Hidrógeno
, Límite de Detección
, Tecnología Inalámbrica/instrumentación
RESUMEN
Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.
Asunto(s)
Secuenciación de Nucleótidos de Alto Rendimiento , Enfermedades de las Plantas , Biología Computacional , Método Doble Ciego , Reproducibilidad de los ResultadosRESUMEN
RNASeq or double-stranded RNA based approaches allowed the reconstruction of a total of 9 full-length or near full-length genomes of the recently discovered grapevine virus T (GVT). In addition, datamining of publicly available grapevine RNASeq transcriptome data allowed the reconstruction of a further 14 GVT genomes from five grapevine sources. Together with four GVT sequences available in Genbank, these novel sequences were used to analyse GVT diversity. GVT shows a very limited amount of indels variation but a high level of nucleotide and aminoacid polymorphism. This level is comparable to that shown in the closely related grapevine rupestris stem pitting-associated virus (GRSPaV). Further analyses showed that GVT mostly evolves under conservative selection pressure and that recombination has contributed to its evolutionary history. Phylogenetic analyses allow to identify at least seven clearly separated groups of GVT isolates. Analysis of the only reported PCR GVT-specific detection primer pair indicates that it is likely to fail to amplify some GVT isolates. Taken together these results point at the distinctiveness of GVT but also at the many points it shares with GRSPaV. They constitute the first pan-genomic analysis of the diversity of this novel virus.
Asunto(s)
Variación Genética , Genoma Viral , Secuenciación de Nucleótidos de Alto Rendimiento/métodos , Virus de Plantas/genética , Vitis/virología , Secuencia de Bases , ADN Viral/genética , Filogenia , Virus de Plantas/aislamiento & purificación , ARN Viral/genética , Recombinación Genética/genética , Transcriptoma/genéticaRESUMEN
Perennial crops, such as fruit trees, are infected by many viruses, which are transmitted through vegetative propagation and grafting of infected plant material. Some of these pathogens cause severe crop losses and often reduce the productive life of the orchards. Detection and characterization of these agents in fruit trees is challenging, however, during the last years, the wide application of high-throughput sequencing (HTS) technologies has significantly facilitated this task. In this review, we present recent advances in the discovery, detection, and characterization of fruit tree viruses and virus-like agents accomplished by HTS approaches. A high number of new viruses have been described in the last 5 years, some of them exhibiting novel genomic features that have led to the proposal of the creation of new genera, and the revision of the current virus taxonomy status. Interestingly, several of the newly identified viruses belong to virus genera previously unknown to infect fruit tree species (e.g., Fabavirus, Luteovirus) a fact that challenges our perspective of plant viruses in general. Finally, applied methodologies, including the use of different molecules as templates, as well as advantages and disadvantages and future directions of HTS in fruit tree virology are discussed.