Taxa of the Nasal Microbiome Are Associated with Influenza-Specific IgA Response to Live Attenuated Influenza Vaccine.

Live attenuated influenza vaccine (LAIV) has demonstrated varying levels of efficacy against seasonal influenza; however, LAIV may be used as a tool to measure interactions between the human microbiome and a live, replicating virus. To increase our knowledge of this interaction, we measured changes to the nasal microbiome in subjects who received LAIV to determine if associations between influenza-specific IgA production and the nasal microbiome exist after immunization with a live virus vaccine. The anterior nares of 47 healthy subjects were swabbed pre- (Day 0) and post- (Days 7 and 28) LAIV administration, and nasal washes were conducted on Days 0 and 28. We performed next-generation sequencing on amplified 16s rRNA genes and measured mucosal influenza-specific IgA titers via enzyme-linked immunosorbent assay (ELISA). A significant increase in alpha diversity was identified (Observed, CHAO, and ACE) between Days 7 vs 0 (p-values = 0.017, 0.005, 0.005, respectively) and between Days 28 vs 0 (p-values = 0.054, 0.030, 0.050, respectively). Several significant associations between the presence of different microbial species, including Lactobacillus helveticus, Prevotella melaninogenica, Streptococcus infantis, Veillonella dispar, and Bacteroides ovatus, and influenza-specific H1 and H3 IgA antibody response were demonstrated. These data suggest that LAIV alters the nasal microbiome, allowing several less-abundant OTUs to establish a community niche. Additionally, specific alterations in the nasal microbiome are significantly associated with variations in influenza-specific IgA antibody production and could be clinically relevant.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Cytokine production associated with smallpox vaccine responses.

Smallpox was eradicated 34 years ago due to the success of the smallpox vaccine; yet, the vaccine continues to be studied because of its importance in responding to potential biological warfare and the adverse events associated with current smallpox vaccines. Interindividual variations in vaccine response are observed and are, in part, due to genetic variation. In some cases, these varying responses lead to adverse events, which occur at a relatively high rate for the smallpox vaccine compared with other vaccines. Here, we aim to summarize the cytokine responses associated with smallpox vaccine response to date. Along with a description of each of these cytokines, we describe the genetic and adverse event data associated with cytokine responses to smallpox vaccination.

Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

HLA alleles associated with the adaptive immune response to smallpox vaccine: a replication study.

We previously reported HLA allelic associations with vaccinia virus (VACV)-induced adaptive immune responses in a cohort of healthy individuals (n = 1,071 subjects) after a single dose of the licensed smallpox (Dryvax) vaccine. This study demonstrated that specific HLA alleles were significantly associated with VACV-induced neutralizing antibody (NA) titers (HLA-B*13:02, *38:02, *44:03, *48:01, and HLA-DQB1*03:02, *06:04) and cytokine (HLA-DRB1*01:03, *03:01, *10:01, *13:01, *15:01) immune responses. We undertook an independent study of 1,053 healthy individuals and examined associations between HLA alleles and measures of adaptive immunity after a single dose of Dryvax-derived ACAM2000 vaccine to evaluate previously discovered HLA allelic associations from the Dryvax study and determine if these associations are replicated with ACAM2000. Females had significantly higher NA titers than male subjects in both study cohorts [median ID50 discovery cohort 159 (93, 256) vs. 125 (75, 186), p < 0.001; replication cohort 144 (82, 204) vs. 110 (61, 189), p = 0.024]. The association between the DQB1*03:02 allele (median ID50 discovery cohort 152, p = 0.015; replication cohort 134, p = 0.010) and higher NA titers was replicated. Two HLA associations of comparable magnitudes were consistently found between DRB1*04:03 and DRB1*08:01 alleles and IFN-γ ELISPOT responses. The association between the DRB1*15:01 allele with IFN-γ secretion was also replicated (median pg/mL discovery cohort 182, p = 0.052; replication cohort 203, p = 0.014). Our results suggest that smallpox vaccine-induced adaptive immune responses are significantly influenced by HLA gene polymorphisms. These data provide information for functional studies and design of novel candidate smallpox vaccines.

Associations between race, sex and immune response variations to rubella vaccination in two independent cohorts.

INTRODUCTION: Immune response variations after vaccination are influenced by host genetic factors and demographic variables, such as race, ethnicity and sex. The latter have not been systematically studied in regard to live rubella vaccine, but are of interest for developing next generation vaccines for diverse populations, for predicting immune responses after vaccination, and for better understanding the variables that impact immune response. METHODS: We assessed associations between demographic variables, including race, ethnicity and sex, and rubella-specific neutralizing antibody levels and secreted cytokines (IFNγ, IL-6) in two independent cohorts (1994 subjects), using linear and linear mixed models approaches, and genetically defined racial and ethnic categorizations. RESULTS: Our replicated findings in two independent, large, racially diverse cohorts indicate that individuals of African descent have significantly higher rubella-specific neutralizing antibody levels compared to individuals of European descent and/or Hispanic ethnicity (p<0.001). CONCLUSION: Our study provides consistent evidence for racial/ethnic differences in humoral immune response following rubella vaccination.

Granzyme B ELISPOT assay to measure influenza-specific cellular immunity.

The immunogenicity and efficacy of influenza vaccination are markedly lower in the elderly. Granzyme B (GrzB), quantified in fresh cell lysates, has been suggested to be a marker of cytotoxic T lymphocyte (CTL) response and a predictor of influenza illness among vaccinated older individuals. We have developed an influenza-specific GrzB ELISPOT assay using cryopreserved PBMCs. This method was tested on 106 healthy older subjects (ages 50-74) at baseline (Day 0) and three additional time points post-vaccination (Day 3, Day 28, Day 75) with influenza A/H1N1-containing vaccine. No significant difference was seen in GrzB response between any of the time points, although influenza-specific GrzB response appears to be elevated at all post-vaccination time points. There was no correlation between GrzB response and hemagglutination inhibition (HAI) titers, indicating no relationship between the cytolytic activity and humoral antibody levels in this cohort. Additionally, a significant negative correlation between GrzB response and age was observed. These results reveal a reduction in influenza-specific GrzB response as one ages. In conclusion, we have developed and optimized an influenza-specific ELISPOT assay for use with frozen cells to quantify the CTL-specific serine protease GrzB, as a measure of cellular immunity after influenza vaccination.