SARS-CoV-2 spike protein induces endothelial inflammation via ACE2 independently of viral replication.

COVID-19, caused by SARS-CoV-2, is a respiratory disease associated with inflammation and endotheliitis. Mechanisms underling inflammatory processes are unclear, but angiotensin converting enzyme 2 (ACE2), the receptor which binds the spike protein of SARS-CoV-2 may be important. Here we investigated whether spike protein binding to ACE2 induces inflammation in endothelial cells and determined the role of ACE2 in this process. Human endothelial cells were exposed to SARS-CoV-2 spike protein, S1 subunit (rS1p) and pro-inflammatory signaling and inflammatory mediators assessed. ACE2 was modulated pharmacologically and by siRNA. Endothelial cells were also exposed to SARS-CoV-2. rSP1 increased production of IL-6, MCP-1, ICAM-1 and PAI-1, and induced NFkB activation via ACE2 in endothelial cells. rS1p increased microparticle formation, a functional marker of endothelial injury. ACE2 interacting proteins involved in inflammation and RNA biology were identified in rS1p-treated cells. Neither ACE2 expression nor ACE2 enzymatic function were affected by rSP1. Endothelial cells exposed to SARS-CoV-2 virus did not exhibit viral replication. We demonstrate that rSP1 induces endothelial inflammation via ACE2 through processes that are independent of ACE2 enzymatic activity and viral replication. We define a novel role for ACE2 in COVID-19- associated endotheliitis.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Mechanisms of macromolecular reactions.

During the past two decades, philosophers of biology have increasingly turned their attention to mechanisms of biological phenomena. Through analyses of mechanistic proposals advanced by biologists, the goal of these philosophers is to understand what a mechanism is and how mechanisms explain. These analyses have generally focused on mechanistic proposals for phenomenon that occur at the cellular or sub-cellular level, such as synapse firing, protein synthesis, or metabolic pathway operation. Little is said about the mechanisms of the macromolecular reactions that underpin these phenomena. These reactions comprise a diverse family of reaction types, and include protein folding, macromolecular complex formation, receptor-ligand interactions, and enzyme catalysis. In this paper, I develop an account of mechanism that focuses exclusively on macromolecular reactions. I begin by reviewing how mechanism is understood in enzymology, and how mechanistic concepts of enzymology apply to macromolecular reactions in general. We will see that the mechanism of a macromolecular reaction is most accurately described as a progression of reaction intermediates, where the evolution of intermediates, from one to the next, is characterized by an energetic coupling between chemistry and protein dynamics. I then make the case that this description necessitates a grounding in a process ontology. To describe the mechanism by which a macromolecular reaction occurs is to describe a process.

Kinetic Studies of the Activation of Bordetella pertussis Adenylate Cyclase by Calmodulin.

Adenylate cyclase toxin (ACT) is a virulence factor secreted by Bordetella pertussis and plays a causative role in whooping cough. After ACT attaches to lung phagocytes, the adenylate cyclase (AC) domain of the toxin is transported into the cytoplasm where it is activated by calmodulin (CaM) to cyclize ATP into 3',5'-cyclic adenosine monophosphate (cAMP). Production of high concentrations of cAMP disrupts immune functions of phagocytes. To better understand the mechanism of activation of AC by CaM, the studies reported herein were conducted. Major observations are as follows: (1) dependence of steady-state velocities on CaM and ATP concentrations suggests that CaM and ATP bind to AC in a random fashion. (2) A pre-steady-state lag phase is observed when AC is added to solutions of CaM and ATP, reflecting the association of AC and CaM. Analysis of pre-steady-state data indicates that CaM binds to AC and AC:ATP with second-order rate constants of 30 and 60 µM-1 s-1, respectively, and that CaM dissociates from the resultant complexes with a first-order rate constant of 0.002 s-1. (3) A biphasic dependence of steady-state velocities on CaM concentration is observed: the first phase extending from 0.01 to 1 nM CaM (Kd,obs ∼ 0.06 nM) and the second phase from 1 to 2000 nM CaM (Kd,obs ∼ 60 nM). These results suggest that AC exists in at least two conformations, with each conformation exhibiting distinct binding affinity for CaM and distinct potential for activation.

Small molecule metalloprotease inhibitor with in vitro, ex vivo and in vivo efficacy against botulinum neurotoxin serotype A.

Botulinum neurotoxins (BoNTs) are the most toxic substances known to mankind and are the causative agents of the neuroparalytic disease botulism. Their ease of production and extreme toxicity have caused these neurotoxins to be classified as Tier 1 bioterrorist threat agents and have led to a sustained effort to develop countermeasures to treat intoxication in case of a bioterrorist attack. While timely administration of an approved antitoxin is effective in reducing the severity of botulism, reversing intoxication requires different strategies. In the present study, we evaluated ABS 252 and other mercaptoacetamide small molecule active-site inhibitors of BoNT/A light chain using an integrated multi-assay approach. ABS 252 showed inhibitory activity in enzymatic, cell-based and muscle activity assays, and importantly, produced a marked delay in time-to-death in mice. The results suggest that a multi-assay approach is an effective strategy for discovery of potential BoNT therapeutic candidates.

KEAP1-modifying small molecule reveals muted NRF2 signaling responses in neural stem cells from Huntington's disease patients.

The activity of the transcription factor nuclear factor-erythroid 2 p45-derived factor 2 (NRF2) is orchestrated and amplified through enhanced transcription of antioxidant and antiinflammatory target genes. The present study has characterized a triazole-containing inducer of NRF2 and elucidated the mechanism by which this molecule activates NRF2 signaling. In a highly selective manner, the compound covalently modifies a critical stress-sensor cysteine (C151) of the E3 ligase substrate adaptor protein Kelch-like ECH-associated protein 1 (KEAP1), the primary negative regulator of NRF2. We further used this inducer to probe the functional consequences of selective activation of NRF2 signaling in Huntington's disease (HD) mouse and human model systems. Surprisingly, we discovered a muted NRF2 activation response in human HD neural stem cells, which was restored by genetic correction of the disease-causing mutation. In contrast, selective activation of NRF2 signaling potently repressed the release of the proinflammatory cytokine IL-6 in primary mouse HD and WT microglia and astrocytes. Moreover, in primary monocytes from HD patients and healthy subjects, NRF2 induction repressed expression of the proinflammatory cytokines IL-1, IL-6, IL-8, and TNFα. Together, our results demonstrate a multifaceted protective potential of NRF2 signaling in key cell types relevant to HD pathology.

Expanding the results of a high throughput screen against an isochorismate-pyruvate lyase to enzymes of a similar scaffold or mechanism.

Antibiotic resistance is a growing health concern, and new avenues of antimicrobial drug design are being actively sought. One suggested pathway to be targeted for inhibitor design is that of iron scavenging through siderophores. Here we present a high throughput screen to the isochorismate-pyruvate lyase of Pseudomonas aeruginosa, an enzyme required for the production of the siderophore pyochelin. Compounds identified in the screen are high nanomolar to low micromolar inhibitors of the enzyme and produce growth inhibition in PAO1 P. aeruginosa in the millimolar range under iron-limiting conditions. The identified compounds were also tested for enzymatic inhibition of Escherichia coli chorismate mutase, a protein of similar fold and similar chemistry, and of Yersinia enterocolitica salicylate synthase, a protein of differing fold but catalyzing the same lyase reaction. In both cases, subsets of the inhibitors from the screen were found to be inhibitory to enzymatic activity (mutase or synthase) in the micromolar range and capable of growth inhibition in their respective organisms (E. coli or Y. enterocolitica).

The 11 April 2012 east Indian Ocean earthquake triggered large aftershocks worldwide.

Large earthquakes trigger very small earthquakes globally during passage of the seismic waves and during the following several hours to days, but so far remote aftershocks of moment magnitude M ≥ 5.5 have not been identified, with the lone exception of an M = 6.9 quake remotely triggered by the surface waves from an M = 6.6 quake 4,800 kilometres away. The 2012 east Indian Ocean earthquake that had a moment magnitude of 8.6 is the largest strike-slip event ever recorded. Here we show that the rate of occurrence of remote M ≥ 5.5 earthquakes (>1,500 kilometres from the epicentre) increased nearly fivefold for six days after the 2012 event, and extended in magnitude to M ≤ 7. These global aftershocks were located along the four lobes of Love-wave radiation; all struck where the dynamic shear strain is calculated to exceed 10(-7) for at least 100 seconds during dynamic-wave passage. The other M ≥ 8.5 mainshocks during the past decade are thrusts; after these events, the global rate of occurrence of remote M ≥ 5.5 events increased by about one-third the rate following the 2012 shock and lasted for only two days, a weaker but possibly real increase. We suggest that the unprecedented delayed triggering power of the 2012 earthquake may have arisen because of its strike-slip source geometry or because the event struck at a time of an unusually low global earthquake rate, perhaps increasing the number of nucleation sites that were very close to failure.

Stress imparted by the great 2004 Sumatra earthquake shut down transforms and activated rifts up to 400 km away in the Andaman Sea.

The origin and prevalence of triggered seismicity and remote aftershocks are under debate. As a result, they have been excluded from probabilistic seismic hazard assessment and aftershock hazard notices. The 2004 M = 9.2 Sumatra earthquake altered seismicity in the Andaman backarc rift-transform system. Here we show that over a 300-km-long largely transform section of the backarc, M≥4.5 earthquakes stopped for five years, and over a 750-km-long backarc section, the rate of transform events dropped by two-thirds, while the rate of rift events increased eightfold. We compute the propagating dynamic stress wavefield and find the peak dynamic Coulomb stress is similar on the rifts and transforms. Long-period dynamic stress amplitudes, which are thought to promote dynamic failure, are higher on the transforms than on the rifts, opposite to the observations. In contrast to the dynamic stress, we calculate that the mainshock brought the transform segments approximately 0.2 bar (0.02 MPa) farther from static Coulomb failure and the rift segments approximately 0.2 bar closer to static failure, consistent with the seismic observations. This accord means that changes in seismicity rate are sufficiently predictable to be included in post-mainshock hazard evaluations.

Structure-activity relationship study of beta-carboline derivatives as haspin kinase inhibitors.

Haspin is a serine/threonine kinase that phosphorylates Thr-3 of histone H3 in mitosis that has emerged as a possible cancer therapeutic target. High throughput screening of approximately 140,000 compounds identified the beta-carbolines harmine and harmol as moderately potent haspin kinase inhibitors. Based on information obtained from a structure-activity relationship study previously conducted for an acridine series of haspin inhibitors in conjunction with in silico docking using a recently disclosed crystal structure of the kinase, harmine analogs were designed that resulted in significantly increased haspin kinase inhibitory potency. The harmine derivatives also demonstrated less activity towards DYRK2 compared to the acridine series. In vitro mouse liver microsome stability and kinase profiling of a representative member of the harmine series (42, LDN-211898) are also presented.

Decay of aftershock density with distance does not indicate triggering by dynamic stress.

Resolving whether static or dynamic stress triggers most aftershocks and subsequent mainshocks is essential to understand earthquake interaction and to forecast seismic hazard. Felzer and Brodsky examined the distance distribution of earthquakes occurring in the first five minutes after 2 ≤ M < 3 and 3 ≤ M < 4 mainshocks and found that their magnitude M ≥ 2 aftershocks showed a uniform power-law decay with slope -1.35 out to 50 km from the mainshocks. From this they argued that the distance decay could be explained only by dynamic triggering. Here we propose an alternative explanation for the decay, and subject their hypothesis to a series of tests, none of which it passes. At distances more than 300 m from the 2 ≤ M < 3 mainshocks, the seismicity decay 5 min before the mainshocks is indistinguishable from the decay five minutes afterwards, indicating that the mainshocks have no effect at distances outside their static triggering range. Omori temporal decay, the fundamental signature of aftershocks, is absent at distances exceeding 10 km from the mainshocks. Finally, the distance decay is found among aftershocks that occur before the arrival of the seismic wave front from the mainshock, which violates causality. We argue that Felzer and Brodsky implicitly assume that the first of two independent aftershocks along a fault rupture triggers the second, and that the first of two shocks in a creep- or intrusion-driven swarm triggers the second, when this need not be the case.

Structure-activity relationship study of acridine analogs as haspin and DYRK2 kinase inhibitors.

Haspin is a serine/threonine kinase required for completion of normal mitosis that is highly expressed during cell proliferation, including in a number of neoplasms. Consequently, it has emerged as a potential therapeutic target in oncology. A high throughput screen of approximately 140,000 compounds identified an acridine analog as a potent haspin kinase inhibitor. Profiling against a panel of 270 kinases revealed that the compound also exhibited potent inhibitory activity for DYRK2, another serine/threonine kinase. An optimization study of the acridine series revealed that the structure-activity relationship (SAR) of the acridine series for haspin and DYRK2 inhibition had many similarities. However, several structural differences were noted that allowed generation of a potent haspin kinase inhibitor (33, IC50 <60 nM) with 180-fold selectivity over DYRK2. In addition, a moderately potent DYRK2 inhibitor (41, IC50 <400 nM) with a 5.4-fold selectivity over haspin was also identified.

SIRT1 activation by small molecules: kinetic and biophysical evidence for direct interaction of enzyme and activator.

SIRT1 is a protein deacetylase that has emerged as a therapeutic target for the development of activators to treat diseases of aging. SIRT1-activating compounds (STACs) have been developed that produce biological effects consistent with direct SIRT1 activation. At the molecular level, the mechanism by which STACs activate SIRT1 remains elusive. In the studies reported herein, the mechanism of SIRT1 activation is examined using representative compounds chosen from a collection of STACs. These studies reveal that activation of SIRT1 by STACs is strongly dependent on structural features of the peptide substrate. Significantly, and in contrast to studies reporting that peptides must bear a fluorophore for their deacetylation to be accelerated, we find that some STACs can accelerate the SIRT1-catalyzed deacetylation of specific unlabeled peptides composed only of natural amino acids. These results, together with others of this study, are at odds with a recent claim that complex formation between STACs and fluorophore-labeled peptides plays a role in the activation of SIRT1 (Pacholec, M., Chrunyk, B., Cunningham, D., Flynn, D., Griffith, D., Griffor, M., Loulakis, P., Pabst, B., Qiu, X., Stockman, B., Thanabal, V., Varghese, A., Ward, J., Withka, J., and Ahn, K. (2010) J. Biol. Chem. 285, 8340-8351). Rather, the data suggest that STACs interact directly with SIRT1 and activate SIRT1-catalyzed deacetylation through an allosteric mechanism.

Development of a mechanism-based high-throughput screen assay for leucine-rich repeat kinase 2--discovery of LRRK2 inhibitors.

LRRK2 is a large and complex protein that possesses kinase and GTPase activities and has emerged as the most relevant player in PD pathogenesis possibly through a toxic gain-of-function mechanism. Kinase activity is a critical component of LRRK2 function and represents a viable target for drug discovery. We now report the development of a mechanism-based TR-FRET assay for the LRRK2 kinase activity using full-length LRRK2. In this assay, PLK-peptide was chosen as the phosphoryl acceptor. A combination of steady-state kinetic studies and computer simulations was used to calculate the initial concentrations of ATP and PLK-peptide to generate a steady-state situation that favors the identification of ATP noncompetitive inhibitors. The assay was also run in the absence of GTP. Under these conditions, the assay was sensitive to inhibitors that directly interact with the kinase domain and those that modulate the kinase activity by directly interacting with other domains including the GTPase domain. The assay was optimized and used to robustly evaluate our compound library in a 384-well format. An inhibitor identified through the screen was further characterized as a noncompetitive inhibitor with both ATP and PLK-peptide and showed similar inhibition against LRRK2 WT and the mutant G2019S.

Designed inhibitors of insulin-degrading enzyme regulate the catabolism and activity of insulin.

BACKGROUND: Insulin is a vital peptide hormone that is a central regulator of glucose homeostasis, and impairments in insulin signaling cause diabetes mellitus. In principle, it should be possible to enhance the activity of insulin by inhibiting its catabolism, which is mediated primarily by insulin-degrading enzyme (IDE), a structurally and evolutionarily distinctive zinc-metalloprotease. Despite interest in pharmacological inhibition of IDE as an attractive anti-diabetic approach dating to the 1950s, potent and selective inhibitors of IDE have not yet emerged. METHODOLOGY/PRINCIPAL FINDINGS: We used a rational design approach based on analysis of combinatorial peptide mixtures and focused compound libraries to develop novel peptide hydroxamic acid inhibitors of IDE. The resulting compounds are approximately 10(6) times more potent than existing inhibitors, non-toxic, and surprisingly selective for IDE vis-à-vis conventional zinc-metalloproteases. Crystallographic analysis of an IDE-inhibitor complex reveals a novel mode of inhibition based on stabilization of IDE's "closed," inactive conformation. We show further that pharmacological inhibition of IDE potentiates insulin signaling by a mechanism involving reduced catabolism of internalized insulin. CONCLUSIONS/SIGNIFICANCE: The inhibitors we describe are the first to potently and selectively inhibit IDE or indeed any member of this atypical zinc-metalloprotease superfamily. The distinctive structure of IDE's active site, and the mode of action of our inhibitors, suggests that it may be possible to develop inhibitors that cross-react minimally with conventional zinc-metalloproteases. Significantly, our results reveal that insulin signaling is normally regulated by IDE activity not only extracellularly but also within cells, supporting the longstanding view that IDE inhibitors could hold therapeutic value for the treatment of diabetes.

Kinetic mechanistic studies of Cdk5/p25-catalyzed H1P phosphorylation: metal effect and solvent kinetic isotope effect.

Cdk5/p25 is a member of the cyclin-dependent, Ser/Thr kinase family and has been identified as one of the principle Alzheimer's disease-associated kinases that promote the formation of hyperphosphorylated tau, the major component of neurofibrillary tangles. We and others have been developing inhibitors of cdk5/p25 as possible therapeutic agents for Alzheimer's disease (AD). In support of these efforts, we examine the metal effect and solvent kinetic isotope effect on cdk5/p25-catalyzed H1P (a histone H-1-derived peptide) phosphorylation. Here, we report that a second Mg(2+) in addition to the one forming the MgATP complex is required to bind to cdk5/p25 for its catalytic activity. It activates cdk5/p25 by demonstrating an increase in k(cat) and induces a conformational change that favors ATP binding but has no effect on the binding affinity for the H1P peptide substrate. The binding of the second Mg(2+) does not change the binding order of substrates. The reaction follows the same rapid equilibrium random mechanism in the presence or absence of the second Mg(2+) as evidenced by initial velocity analysis and substrate analogue and product inhibition studies. A linear proton inventory with a normal SKIE of 2.0 +/- 0.1 in the presence of the second Mg(2+) was revealed and suggested a single proton transfer in the rate-limiting phosphoryl transfer step. The pH profile revealed a residue with a pK(a) of 6.5 that is most likely the general acid-base catalyst facilitating the proton transfer.

Kinetic mechanistic studies of wild-type leucine-rich repeat kinase 2: characterization of the kinase and GTPase activities.

Recent studies have identified mutations in the leucine-rich repeat kinase2 gene (LRRK2) in the most common familial forms and some sporadic forms of Parkinson's disease (PD). LRRK2 is a large and complex protein that possesses kinase and GTPase activities. Some LRRK2 mutants enhance kinase activity and possibly contribute to PD through a toxic gain-of-function mechanism. Given the role of LRRK2 in the pathogenesis of PD, understanding the kinetic mechanism of its two enzymatic properties is critical for the discovery of inhibitors of LRRK2 kinase that would be therapeutically useful in treating PD. In this report, by using LRRK2 protein purified from murine brain, first we characterize kinetic mechanisms for the LRRK2-catalyzed phosphorylation of two peptide substrates: PLK-derived peptide (PLK-peptide) and LRRKtide. We found that LRRK2 follows a rapid equilibrium random mechanism for the phosphorylation of PLK-peptide with either ATP or PLK-peptide being the first substrate binding to the enzyme, as evidenced by initial velocity and inhibition mechanism studies with nucleotide analogues AMP and AMP-PNP, product ADP, and an analogue of the peptide substrate. The binding of the first substrate has no effect on the binding affinity of the second substrate. Identical mechanistic conclusions were drawn when LRRKtide was the phosphoryl acceptor. Next, we characterize the GTPase activity of LRRK2 with a k(cat) of 0.2 +/- 0.02 s(-1) and a K(m) of 210 +/- 29 microM. A SKIE of 0.97 +/- 0.04 was measured on k(cat) for the GTPase activity of LRRK2 in a D(2)O molar fraction of 0.86 and suggested that the product dissociation step is rate-limiting, of the steps governed by k(cat) in the LRRK2-catalyzed GTP hydrolysis. Surprisingly, binding of GTP, GDP, or GMP has no effect on kinase activity, although GMP and GDP inhibit the GTPase activity. Finally, we have identified compound LDN-73794 through screen of LRRK2 kinase inhibitors. Our study revealed that this compound is a competitive inhibitor of the binding of ATP and inhibits the kinase activity without affecting the GTPase activity.

Structure and functional characterization of the atypical human kinase haspin.

The protein kinase haspin/Gsg2 plays an important role in mitosis, where it specifically phosphorylates Thr-3 in histone H3 (H3T3). Its protein sequence is only weakly homologous to other protein kinases and lacks the highly conserved motifs normally required for kinase activity. Here we report structures of human haspin in complex with ATP and the inhibitor iodotubercidin. These structures reveal a constitutively active kinase conformation, stabilized by haspin-specific inserts. Haspin also has a highly atypical activation segment well adapted for specific recognition of the basic histone tail. Despite the lack of a DFG motif, ATP binding to haspin is similar to that in classical kinases; however, the ATP gamma-phosphate forms hydrogen bonds with the conserved catalytic loop residues Asp-649 and His-651, and a His651Ala haspin mutant is inactive, suggesting a direct role for the catalytic loop in ATP recognition. Enzyme kinetic data show that haspin phosphorylates substrate peptides through a rapid equilibrium random mechanism. A detailed analysis of histone modifications in the neighborhood of H3T3 reveals that increasing methylation at Lys-4 (H3K4) strongly decreases substrate recognition, suggesting a key role of H3K4 methylation in the regulation of haspin activity.