Robust soybean leaf agroinfiltration.

KEY MESSAGE: A robust agroinfiltration-mediated transient gene expression method for soybean leaves was developed. Plant genotype, developmental stage and leaf age, surfactant, and Agrobacterium culture conditions are important for successful agroinfiltration. Agroinfiltration of Nicotiana benthamiana has emerged as a workhorse transient assay for plant biotechnology and synthetic biology to test the performance of gene constructs in dicot leaves. While effective, it is nonetheless often desirable to assay transgene constructs directly in crop species. To that end, we innovated a substantially robust agroinfiltration method for Glycine max (soybean), the most widely grown dicot crop plant in the world. Several factors were found to be relevant to successful soybean leaf agroinfiltration, including genotype, surfactant, developmental stage, and Agrobacterium strain and culture medium. Our optimized protocol involved a multi-step Agrobacterium culturing process with appropriate expression vectors, Silwet L-77 as the surfactant, selection of fully expanded leaves in the VC or V1 stage of growth, and 5 min of vacuum at - 85 kPa followed by a dark incubation period before plants were returned to normal growth conditions. Using this method, young soybean leaves of two lines-V17-0799DT, and TN16-5004-were high expressors for GUS, two co-expressed fluorescent protein genes, and the RUBY reporter product, betalain. This work not only represents a new research tool for soybean biotechnology, but also indicates critical parameters for guiding agroinfiltration optimization for other crop species. We speculate that leaf developmental stage might be the most critical factor for successful agroinfiltration.

Soybean MKK2 establishes intricate signalling pathways to regulate soybean response to cyst nematode infection.

Mitogen-activated protein kinase (MPK) cascades play central signalling roles in plant immunity and stress response. The soybean orthologue of MPK kinase2 (GmMKK2) was recently identified as a potential signalling node whose expression is upregulated in the feeding site induced by soybean cyst nematode (SCN, Heterodera glycines). To investigate the role of GmMKK2 in soybean-SCN interactions, we overexpressed a catabolically inactive variant referred to as kinase-dead variant (KD-GmMKK2) using transgenic hairy roots. KD-GmMKK2 overexpression caused significant reduction in soybean susceptibility to SCN, while overexpression of the wild-type variant (WT-GmMKK2) exhibited no effect on susceptibility. Transcriptome analysis indicated that KD-GmMKK2 overexpressing plants are primed for SCN resistance via constitutive activation of defence signalling, particularly those related to chitin, respiratory burst, hydrogen peroxide and salicylic acid. Phosphoproteomic profiling of the WT-GmMKK2 and KD-GmMKK2 root samples upon SCN infection resulted in the identification of 391 potential targets of GmMKK2. These targets are involved in a broad range of biological processes, including defence signalling, vesicle fusion, chromatin remodelling and nuclear organization among others. Furthermore, GmMKK2 mediates phosphorylation of numerous transcriptional and translational regulators, pointing to the presence of signalling shortcuts besides the canonical MAPK cascades to initiate downstream signalling that eventually regulates gene expression and translation initiation. Finally, the functional requirement of specific phosphorylation sites for soybean response to SCN infection was validated by overexpressing phospho-mimic and phospho-dead variants of two differentially phosphorylated proteins SUN1 and IDD4. Together, our analyses identify GmMKK2 impacts on signalling modules that regulate soybean response to SCN infection.

Overexpression of soybean trypsin inhibitor genes decreases defoliation by corn earworm (Helicoverpa zea) in soybean (Glycine max) and Arabidopsis thaliana.

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

High-Throughput Transfection and Analysis of Soybean (Glycine max ) Protoplasts.

With the advent of plant synthetic biology, there is an urgent need to develop plant-based systems that are able to effectively enhance the speed of design-build-test cycles to screen large numbers of synthetic constructs. Thus far, protoplasts have served to fill this need, with cell suspension cultures serving as the primary source tissue to enable high-throughput protoplast experimentation. The possibility to use low-cost food-grade enzymes for cell wall digestion along with polyethylene glycol (PEG)-mediated transfection makes protoplasts particularly suited to automation and high-throughput screening. In other systems for which synthetic biology is well established (model bacteria and yeast), libraries of components, i.e., promoters, 5' untranslated regions, 3' untranslated regions, terminators, and transcription factors, serve as the basis for the design of complex genetic circuits. In order for synthetic biology to make similar strides in plant biology, well-characterized libraries of functional genetic parts for plants are required, necessitating the need for high-throughput protoplast assays.In this chapter, we describe an optimized method for the preparation of soybean (Glycine max ) dark-grown cell suspension cultures, followed by protoplast isolation, automated transfection , and subsequent screening.

Proteinase inhibitors in legume herbivore defense: from natural to genetically engineered protectants.

Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores.

Development and validation of a novel and robust cell culture system in soybean (Glycine max (L.) Merr.) for promoter screening.

KEY MESSAGE: A novel soybean cell culture was developed, establishing a reliable and rapid promoter assay to enable high-throughput automated screening in soybean protoplasts relevant to shoot tissues in whole plants. Transient reporter gene assays can be valuable to rapidly estimate expression characteristics of heterologous promoters. The challenge for maximizing the value of such screens is to combine relevant cells or tissues with methods that can be scaled for high-throughput screening, especially for crop-rather than model species. We developed a robust and novel soybean cell suspension culture derived from leaf-derived callus for protoplast production: a platform for promoter screening. The protoplasts were transfected with promoter-reporter constructs, of which were chosen and validated against known promoter expression profiles from tissue-derived protoplasts (leaves, stems, and immature cotyledons) and gene expression data from plants. The cell culture reliably produced 2.82 ± 0.94 × 108 protoplasts/g fresh culture mass with a transfection efficiency of 31.06 ± 7.69% at 48 h post-incubation. The promoter-reporter gene DNA expression levels of transfected cell culture-derived protoplasts were most similar to that of leaf- and stem-derived protoplasts (correlation coefficient of 0.99 and 0.96, respectively) harboring the same constructs. Cell culture expression was also significantly correlated to endogenous promoter-gene expression in leaf tissues as measured by qRT-PCR (correlation coefficient of 0.80). Using the manual protocols that produced these results, we performed early stage experiments to automate protoplast transformation on a robotic system. After optimizing the protocol, we achieved up to 29% transformation efficiency using our robotic system. We conclude that the soybean cell culture-to-protoplast transformation screen is amenable to automate promoter and gene screens in soybean that could be used to accelerate discoveries relevant for crop improvement. Key features of the system include low-cost, facile protoplast isolation, and transformation for soybean shoot tissue-relevant molecular screening.