Biological and Genetic Characterization of New and Known Necroviruses Causing an Emerging Systemic Necrosis Disease of Corn Salad (Valerianella locusta) in France.

An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses: tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV), and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus was also frequently observed. Koch's postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and caused the less severe symptoms. The emergence of this systemic disease may have been favored by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.

Complete Nucleotide Sequence of a French Isolate of Maize rough dwarf virus, a Fijivirus Member in the Family Reoviridae.

The complete nucleotide sequence of a French isolate of Maize rough dwarf virus (MRDV) was determined by next-generation sequencing and compared with the single available complete sequence and with the partial sequences of two additional isolates available in online databases.

Complete Nucleotide Sequence of Artichoke latent virus Shows it to be a Member of the Genus Macluravirus in the Family Potyviridae.

Complete genomic sequences of Artichoke latent virus (ArLV) have been obtained by classical or high-throughput sequencing for an ArLV isolate from Italy (ITBr05) and for two isolates from France (FR37 and FR50). The genome is 8,278 to 8,291 nucleotides long and has a genomic organization comparable with that of Chinese yam necrotic mosaic virus (CYNMV), the only macluravirus fully sequenced to date. The cleavage sites of the viral polyprotein have been tentatively identified by comparison with CYNMV, confirming that macluraviruses are characterized by the absence of a P1 protein, a shorter and N-terminally truncated coat protein (CP). Sequence comparisons firmly place ArLV within the genus Macluravirus, and confirm previous results suggesting that Ranunculus latent virus (RALV), a previously described Macluravirus sp., is very closely related to ArLV. Serological relationships and comparisons of the CP gene and of the partial RaLV sequence available all indicate that RaLV should not be considered as a distinct species but as a strain of ArLV. The results obtained also suggest that the spectrum of currently used ArLV-specific molecular hybridization or polymerase chain reaction detection assays should be improved to cover all isolates and strains in the ArLV species.

First Report of the Presence of Plum pox virus Rec Strain in France.

Plum pox virus (PPV) is the most detrimental virus in stone fruit crops (Prunus sp.). At least nine monophyletic PPV strains are recognized, three of which, PPV-D, PPV-M, and PPV-Rec, have broad distributions (2). PPV-Rec is characterized by a unique founding recombination event and has been reported mostly from Central and South-Central Europe (2). It is generally considered poorly adapted to peach, and the weak and transient symptoms it causes in the GF305 peach seedling indicator may complicate its biological detection (2). During surveys in the Alsace region of France in spring 2013, a plum orchard with trees (Prunus domestica cv. Quetsche d'Alsace 3066) showing dubious leaf symptoms possibly reminiscent of PPV infection was identified. Testing of material from this plant by ELISA (Bioreba AG, Switzerland) gave clear positive reactions, putting the overall infection rate of the orchard at 6.25%, while a second nearby orchard was found infected at a rate of 0.8%. The presence of PPV was confirmed by polymerase chain reaction (PCR) amplification using either the P1-P2 polyvalent primer pair or the P3M-P4b primer pair, which allows the specific amplification of isolates of the Rec and M strains (1). Sequencing of the 467-nt-long P3M-P4b PCR product (Genbank Accession No. KM035763), which spans the end of the NIb gene and the N-terminal hypervariable end of the coat protein gene, provided clear identification of the PPV isolate as belonging to the Rec strain, since it contained all the PPV-Rec specific mutations in the amplified region and showed 98.7 to 97.7% identity with a range of PPV Rec isolates mostly originating from the Balkans. Identification as a PPV-Rec isolate was also confirmed using a strain-specific reverse-transcription-PCR assay (3). This is, to our knowledge, the first report of the presence of PPV-Rec in France. This finding is worrisome given that PPV-Rec is considered well adapted to plum (2), the most important Prunus crop in Alsace. Further surveillance in Alsace during 2014 failed to provide evidence for the presence of PPV-Rec in other areas of the region away from the initial infection focus, which is currently undergoing eradication efforts. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) J. A. García et al. Mol. Plant Pathol. 15:226, 2014. (3) Z. Subr et al. Acta Virol. 48:173, 2004.

Key mutations in the cylindrical inclusion involved in lettuce mosaic virus adaptation to eIF4E-mediated resistance in lettuce.

We previously showed that allelic genes mol¹ and mo1² used to protect lettuce crops against Lettuce mosaic virus (LMV) correspond to mutant alleles of the gene encoding the eukaryotic translation initiation factor 4E. LMV resistance-breaking determinants map not only to the main potyvirus virulence determinant, a genome-linked viral protein, but also to the C-terminal region of the cylindrical inclusion (CI), with a key role of amino acid at position 621. Here, we show that the propagation of several non-lettuce isolates of LMV in mo1¹ plants is accompanied by a gain of virulence correlated with the presence in the CI C terminus of a serine at position 617 and the accumulation of mutations at positions 602 or 627. Whole-genome sequencing of native and evolved isolates showed that no other mutation could be associated with adaptation to mo1 resistance. Site-directed mutagenesis pinpointed the key role in the virulence of the combination of mutations at positions 602 and 617, in addition to position 621. The impact of these mutations on the fitness of the virus was evaluated, suggesting that the durability of mo1 resistance in the field relies on the fitness cost associated with the resistance-breaking mutations, the nature of the mutations, and their potential antagonistic effects.

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

The determinant of potyvirus ability to overcome the RTM resistance of Arabidopsis thaliana maps to the N-terminal region of the coat protein.

In Arabidopsis thaliana Columbia (Col-0) plants, the restriction of Tobacco etch virus (TEV) long-distance movement involves at least three dominant RTM (restricted TEV movement) genes named RTM1, RTM2, and RTM3. Previous work has established that, while the RTM-mediated resistance is also effective against other potyviruses, such as Plum pox virus (PPV) and Lettuce mosaic virus (LMV), some isolates of these viruses are able to overcome the RTM mechanism. In order to identify the viral determinant of this RTM-resistance breaking, the biological properties of recombinants between PPV-R, which systemically infects Col-0, and PPV-PSes, restricted by the RTM resistance, were evaluated. Recombinants that contain the PPV-R coat protein (CP) sequence in an RTM-restricted background are able to systemically infect Col-0. The use of recombinants carrying chimeric CP genes indicated that one or more PPV resistance-breaking determinants map to the 5' half of the CP gene. In the case of LMV, sequencing of independent RTM-breaking variants recovered after serial passages of the LMV AF199 isolate on Col-0 plants revealed, in each case, amino acid changes in the CP N-terminal region, close to the DAG motif. Taken together, these findings demonstrate that the potyvirus CP N-terminal region determines the outcome of the interaction with the RTM-mediated resistance.

First Report of Cherry virus A in Prunus mume in China.

Natural infections of Cherry virus A (CVA) have been reported in sweet (Prunus avium) and sour cherry (P. cerasus) from a number of European countries, North America, and Japan. CVA has been detected occasionally in other Prunus hosts such as peach, plum, and apricot (1). In the spring of 2007, samples from four Japanese apricot (Prunus mume) trees from the Jiangsu Province of China were analyzed by a polyvalent reverse transcriptase-PCR assay that amplifies a short region of the polymerase gene of viruses from several genera in the family Flexiviridae (2). Sequencing of the amplified products identified CVA in three samples. Two isolates (GenBank Accession Nos. EU730949 and EU730950) were closely related and highly homologous (97.5 to 99.3% identity) to noncherry isolates of CVA (GenBank Accession Nos AY792509 and DQ445275 to DQ445292). The third isolate (GenBank Accession No. EU730951) was approximately 90% identical to the other P. mume isolates and showed the highest identity (92.3%) to a cherry isolate (GenBank Accession No AF413923). CVA infection of the P. mume samples was confirmed by two CVA-specific primer pairs targeting genomic regions corresponding to the movement or coat protein genes. Since the samples showed mixed infections with Plum pox virus (PPV) or Asian Prunus virus 1 (APV1), potential CVA symptomatology could not be evaluated. To our knowledge, these results are the first identification of CVA in China and in P. mume, extending the geographical distribution and natural host range of this virus. Additional work is needed to evaluate whether CVA poses a threat to P. mume production or whether, as in other identified hosts, CVA is largely latent. References: (1) M. Barone et al. Plant Dis. 90:1459, 2006. (2) X. Foissac et al. Phytopathology 95:617, 2005.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers.

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

First Report of the Presence of Plum pox virus Rec Strain in Turkey.

Plum pox virus (PPV) is a detrimental virus in stone fruit crops. Six strains of PPV are recognized, one of which, PPV-Rec, represents a group of isolates sharing a unique founding recombination event (2). This strain has been reported only from central and south-central Europe. Its distribution is of interest because PPV-Rec is reported to induce only weak and transient symptoms in GF305 peach seedlings, which may complicate its detection using this widely used indicator (2). During a field trip in May 2006, a Japanese plum (Prunus salicina) tree showing leaf symptoms reminiscent of PPV infection was identified in Isparta, Turkey. A leaf sample tested by a serological lateral flow PPV Pocket Diagnostic (Central Science Laboratory, Sand Hutton, UK) gave a weak positive reaction. The presence of PPV was confirmed by grafting onto GF305 peach and by PCR amplification and sequencing of a short P3M-P4b PCR product (1; positions 8446 to 8912 on PPV-BOR3; GenBank Accession No. AY028309) spanning the end of the NIb gene and the N-terminal hypervariable end of the coat protein gene. Comparison of the sequence obtained (GenBank Accession No. EF051630) with databases unambiguously identified the isolate as belonging to the Rec strain because it contained all the PPV-Rec specific mutations in the amplified region. In keeping with this identification, the symptoms observed in GF305 were very weak, consisting only of slight vein clearing on a few leaves. This is, to our knowledge, the first report of the presence of PPV-Rec in Turkey. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. Glasa et al. J. Gen. Virol. 85:2671, 2004.

Frequent Occurrence of Lettuce mosaic virus in Cape Daisy (Osteospermum sp.) in Tunisia.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Asian prunus viruses: New related members of the family Flexiviridae in Prunus germplasm of Asian origin.

Serological reactivity to Plum pox virus (PPV) antisera has been described in several Prunus sources of Asian origin that are free of PPV infection. Using polyvalent or specific PCR assays, the presence of three closely related agents in two of these sources, Prunus mume cv. Bungo and P. persica cv. Ku Chu'a Hung, was demonstrated. Similarities in genome organization and sequence comparisons indicate that these agents should be regarded as members of the genus Foveavirus, their only singular trait being a very large (>800 nt) 3' non-coding region (NCR), as compared to the ca. 130-180 nt 3' NCR observed in other Foveaviruses. The three agents are very divergent from known Foveaviruses but are also significantly removed one from the others, with overall nucleotide sequence identity levels in the sequenced region of ca. 74-76% and of only 60.8-67.5% in their complete CP gene (61.9-71.3% amino acid sequence identity). Given the species discrimination criteria in the family Flexiviridae, these three agents should be regarded as three related yet distinct new viruses belonging to the Foveavirus genus, for which the names Asian prunus virus 1, 2 and 3 are proposed. Evidence is provided for the presence of variants of these new viruses in other Prunus germplasm of Asian origin.

Characterization and partial genome sequence of stocky prune virus, a new member of the genus Cheravirus.

Characterization of a seemingly new spherical virus isolated from severely affected plum trees in south-western France indicated that its divided genome is composed of two single-stranded, polyadenylated RNAs of approximately 7.4 and 3.7 kb. Its particles are composed of three coat protein subunits of approximately 23, 23.5, and 24.5 kDa. Partial sequencing of the genomic RNAs indicated that this new virus, tentatively named stocky prune virus (StPV), is distantly related to the two sequenced cheraviruses, cherry rasp leaf virus (CRLV) and apple latent spherical virus (ALSV). StPV should be regarded as a new member in the unassigned genus Cheravirus.

Molecular characterization of banana virus X (BVX), a novel member of the Flexiviridae family.

A novel virus was identified in banana (Musa spp). Analysis of the last 2917 nucleotides of its positive strand genomic RNA showed five open reading frames corresponding, from 5' to 3', to a truncated ORF coding for a replication-associated protein, three ORFs coding for a movement-associated triple gene block (TGB) and a capsid protein (CP) gene. This genome organization is similar to that of some members of the Flexiviridae family such as potexviruses and foveaviruses. This virus was named Banana virus X (BVX). Comparative sequence analysis showed that BVX is only distantly related to other members of the Flexiviridae family, in which it appears to define a new genus. BVX produces defective RNAs derived from its genomic RNA by non-homologous recombination. Three distinct pairs of donor/acceptor recombination sites involving short direct nucleotide repeats were characterized, accounting for deletions of 1268, 1358 and 1503 nucleotides. Contrary to the situation encountered for Potexviruses, these recombination sites are located within the TGB1 and CP genes and result in a truncated TGB1 protein.

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

First Report on the Natural Occurrence of Cherry virus A in Mirabelle Plum (Prunus domestica var. insititia).

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.

Molecular characterization of foveaviruses associated with the cherry necrotic mottle leaf disease and complete sequencing of an European isolate of Cherry green ring mottle virus.

Analysis of the P1C124 source (associated with the cherry necrotic mottle leaf (CNML) disease) revealed the presence of two different viral agents. The complete nucleotide sequence of one of these agents, P1A, had an overall nucleotide sequence similarity of 83% with a previously sequenced North American isolate of Cherry green ring mottle virus (CGRMV) and should therefore be regarded as an European isolate of CGRMV. Approximately 2 kb of the 5' end of the genome of the second agent, P1B, were also sequenced and were shown to be 82% homologous with Cherry necrotic rusty mottle virus (CNRMV), another member of the Foveavirus genus. The possible involvement of CGRMV-P1A and of CNRMV-P1B in the etiology of the CNML disease is discussed.

Candidate genes and QTLs for sugar and organic acid content in peach [ Prunus persica (L.) Batsch].

The identification of genes involved in variation of peach fruit quality would assist breeders in creating new cultivars with improved fruit quality. Major genes and quantitative trait loci (QTLs) for physical and chemical components of fruit quality have already been detected, based on the peach [ Prunus persica (L.) Batsch] cv. Ferjalou Jalousia((R)) (low-acid peach) x cv. Fantasia (normally-acid nectarine) F(2) intraspecific cross. Our aim was to associate these QTLs to structural genes using a candidate gene/QTL approach. Eighteen cDNAs encoding key proteins in soluble sugar and organic acid metabolic pathways as well as in cell expansion were isolated from peach fruit. A single-strand conformation polymorphism strategy based on specific cDNA-based primers was used to map the corresponding genes. Since no polymorphism could be detected in the Ferjalou Jalousia((R)) x Fantasia population, gene mapping was performed on the almond [ Prunus amygdalus ( P. dulcis)] cv. Texas x peach cv. Earlygold F(2) interspecific cross from which a saturated map was available. Twelve candidate genes were assigned to four linkage groups of the peach genome. In a second step, the previous QTL detection was enhanced by integrating anchor loci between the Ferjalou Jalousia((R)) x Fantasia and Texas x Earlygold maps and data from a third year of trait assessment on the Ferjalou Jalousia((R)) x Fantasia population. Comparative mapping allowed us to detect a candidate gene/QTL co-location. It involved a cDNA encoding a vacuolar H(+)-pyrophosphatase ( PRUpe;Vp2) that energises solute accumulation, and QTLs for sucrose and soluble solid content. This preliminary result may be the first step in the future development of marker-assisted selection for peach fruit sucrose and soluble solid content.