Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG2-3'-3'-G2C5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K+ ions. Herein, by using CD, PAGE, HPLC size exclusion chromatography, and NMR investigations we studied the propensity of shorter analogues having sequences 5'CGn-3'-3'-GmC5' (with n = 1 and 1 ≤ m ≤ 3) to form the corresponding G-quadruplexes and stacked G-wires. The results revealed that the formation of G-wires starting from d(5'CGn-3'-3'-GmC5') ONs is possible only for the sequences having n and m > 1 in which both guanosines flanking the 5'-ending cytosines are not involved into the 3'-3' phosphodiester bond.

Synthesis of Brominated Lactones Related to Mycalin A: Selective Antiproliferative Activity on Metastatic Melanoma Cells and Inhibition of the Cell Migration.

Starting from D-xylonolactone and D-ribonolactone, several five-membered bromolactones, related to the C1-C5 portion of mycalin A lactone, have been synthesized. The bromination of D-ribonolactone with HBr/AcOH, without a subsequent transesterification step, has been studied for the first time, giving us most of the acetylated lactones investigated in the present study. For each compound, where possible, both the C-3 alcohol and the corresponding acetate were prepared. Evaluation of their anti-tumor activity showed that all the acetates possess a good cytotoxicity towards human melanoma (A375), human cervical adenocarcinoma (HeLa) and human metastatic melanoma (WM266) cancer cells, comparable or even higher than that displayed by the original mycalin A lactone. Lactone acetates derived from D-ribonolactone showed the higher selectivity of action, exhibiting a strong cytotoxicity on all the tested tumor cells but only a limited toxicity on healthy human dermal fibroblast (HDF) cells, used as a control. Wound healing assays showed that two of these substances inhibit the migration of the WM266 cells.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.

Microfluidic-Assisted Production of Gastro-Resistant Active-Targeted Diatomite Nanoparticles for the Local Release of Galunisertib in Metastatic Colorectal Cancer Cells.

The oral route is highly desirable for colorectal cancer (CRC) treatment because it allows concentrating the drug in the colon and achieving a localized effect. However, orally administered drugs are often metabolized in the liver, resulting in reduced efficacy and the need for higher doses. Nanoparticle-based drug delivery systems can be engineered to prevent the diffusion of the drug in the stomach, addressing the release at the target site, and enhancing the efficacy of the delivered drug. Here, an orally administrable galunisertib delivery system is developed with gelatin-covered diatomite nanoparticles targeting the ligand 1-cell adhesion molecule (L1-CAM) on metastatic cells, and further encapsulated in an enteric matrix by microfluidics. The gastro-resistant polymer protects the nanoparticles from the action of the digestive enzymes and allows for a sustained release of galunisertib at the intestinal pH. The efficacy of antibody-antigen interactions to drive the internalization of nanoparticles in the targeted cells is investigated in CRC cells expressing abnormal (SW620) or basal levels (Caco-2, HT29-MTX) of L1-CAM. The combination of local drug release and active targeting enhances the effect of the delivered galunisertib, which inhibits the migration of the SW620 cells with greater efficiency compared to the free drug.

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δß-turn + Δß-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the ß-structure are consistent with a partial protein destabilization due to the interaction with U2O.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

Bioconjugation of Peptides to Hybrid Gold Nanoparticles.

Gold nanoparticles (AuNPs) can be produced by well-assessed synthesis methods and can show a high surface area-to-volume ratio, chemical inertness, high electron density, strong optical absorption as well as low toxicity. AuNPs have been conjugated with many different biomolecules for a wide range of biomedical applications. These applications require an increasingly complex level of surface decoration in order to achieve stability, efficacy, and specific functionalities. This chapter provides detailed instructions about the synthesis of AuNPs and bioconjugation strategies in order to obtain stable hybrid nanomaterials. The described biofunctionalization procedures are based on carbodiimide chemistry and ligand-exchange methods allowing the conjugation of Lys-peptide or Cys-peptide, respectively, to the AuNPs surface.

SERS Quantification of Galunisertib Delivery in Colorectal Cancer Cells by Plasmonic-Assisted Diatomite Nanoparticles.

The small molecule Galunisertib (LY2157299, LY) shows multiple anticancer activities blocking the transforming growth factor-ß1 receptor, responsible for the epithelial-to-mesenchymal transition (EMT) by which colorectal cancer (CRC) cells acquire migratory and metastatic capacities. However, frequent dosing of LY can produce highly toxic metabolites. Alternative strategies to reduce drug side effects can rely on nanoscale drug delivery systems that have led to a medical revolution in the treatment of cancer, improving drug efficacy and lowering drug toxicity. Here, a hybrid nanosystem (DNP-AuNPs-LY@Gel) made of a porous diatomite nanoparticle decorated with plasmonic gold nanoparticles, in which LY is retained by a gelatin shell, is proposed. The multifunctional capability of the nanosystem is demonstrated by investigating the efficient LY delivery, the enhanced EMT reversion in CRCs and the intracellular quantification of drug release with a sub-femtogram resolution by surface-enhanced Raman spectroscopy (SERS). The LY release trigger is the pH sensitivity of the gelatin shell to the CRC acidic microenvironment. The drug release is real-time monitored at single-cell level by analyzing the SERS signals of LY in CRC cells. The higher efficiency of LY delivered by the DNP-AuNPs-LY@Gel complex paves the way to an alternative strategy for lowering drug dosing and consequent side effects.

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the µM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers.

Porous Silicon Optical Devices: Recent Advances in Biosensing Applications.

This review summarizes the leading advancements in porous silicon (PSi) optical-biosensors, achieved over the past five years. The cost-effective fabrication process, the high internal surface area, the tunable pore size, and the photonic properties made the PSi an appealing transducing substrate for biosensing purposes, with applications in different research fields. Different optical PSi biosensors are reviewed and classified into four classes, based on the different biorecognition elements immobilized on the surface of the transducing material. The PL signal modulation and the effective refractive index changes of the porous matrix are the main optical transduction mechanisms discussed herein. The approaches that are commonly employed to chemically stabilize and functionalize the PSi surface are described.

PNA-Based Graphene Oxide/Porous Silicon Hybrid Biosensor: Towards a Label-Free Optical Assay for Brugada Syndrome.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

Time-gated luminescence imaging of positively charged poly-l-lysine-coated highly microporous silicon nanoparticles in living Hydra polyp.

The development of non-toxic fluorescent agents alternative to heavy metal-based semiconductor quantum dots represents a relevant topic in biomedical research and in particular in the bioimaging field. Herein, highly luminescent Si─H terminal microporous silicon nanoparticles with µs-lived photoemission are chemically modified with a two step process and successfully used as label-free probes for in vivo time-gated luminescence imaging. In this context, Hydra vulgaris is used as model organism for in vivo study and validity assessment. The application of time gating allows to pursue an effective sorting of the signals, getting rid of the most common sources of noise that are fast-decay tissue autofluorescence and excitation scattering within the tissue. Indeed, an enhancement by a factor ~ 20 in the image signal-to-noise ratio can be estimated.

Antiproliferative Activity of Mycalin A and Its Analogues on Human Skin Melanoma and Human Cervical Cancer Cells.

Mycalin A, a polybrominated C15 acetogenin isolated from the encrusting sponge Mycale rotalis, displays an antiproliferative activity on human melanoma (A375) and cervical adenocarcinoma (HeLa) cells and induces cell death by an apoptotic mechanism. Various analogues and degraded derivatives of the natural substance have been prepared. A modification of the left-hand part of the molecule generates the most active substances. A structurally simplified lactone derivative of mycalin A, lacking the C1-C3 side chain, is the most active among the synthesized compounds exhibiting a strong cytotoxicity on both A375 and HeLa cells but not but not on human dermal fibroblast (HDF) used as healthy cells. Further evidence on a recently discovered chlorochromateperiodate-catalyzed process, used to oxidise mycalin A, have been collected.

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

Porous Silicon-Based Aptasensors: The Next Generation of Label-Free Devices for Health Monitoring.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).