Bacterial diversity and composition on the rinds of specific melon cultivars and hybrids from across different growing regions in the United States.

The goal of this study was to characterize the bacterial diversity on different melon varieties grown in different regions of the US, and determine the influence that region, rind netting, and variety of melon has on the composition of the melon microbiome. Assessing the bacterial diversity of the microbiome on the melon rind can identify antagonistic and protagonistic bacteria for foodborne pathogens and spoilage organisms to improve melon safety, prolong shelf-life, and/or improve overall plant health. Bacterial community composition of melons (n = 603) grown in seven locations over a four-year period were used for 16S rRNA gene amplicon sequencing and analysis to identify bacterial diversity and constituents. Statistically significant differences in alpha diversity based on the rind netting and growing region (p < 0.01) were found among the melon samples. Principal Coordinate Analysis based on the Bray-Curtis dissimilarity distance matrix found that the melon bacterial communities clustered more by region rather than melon variety (R2 value: 0.09 & R2 value: 0.02 respectively). Taxonomic profiling among the growing regions found Enterobacteriaceae, Bacillaceae, Microbacteriaceae, and Pseudomonadaceae present on the different melon rinds at an abundance of ≥ 0.1%, but no specific core microbiome was found for netted melons. However, a core of Pseudomonadaceae, Bacillaceae, and Exiguobacteraceae were found for non-netted melons. The results of this study indicate that bacterial diversity is driven more by the region that the melons were grown in compared to rind netting or melon type. Establishing the foundation for regional differences could improve melon safety, shelf-life, and quality as well as the consumers' health.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Development of an IPM Strategy for Thrips and Tomato spotted wilt virus in Processing Tomatoes in the Central Valley of California.

Tomato spotted wilt virus (TSWV; species Tomato spotted wilt orthotospovirus; genus Orthotospovirus; family Tospoviridae) is a thrips-transmitted virus that can cause substantial economic losses to many crops, including tomato (Solanum lycopersicum). Since 2005, TSWV emerged as an economically important virus of processing tomatoes in the Central Valley of California, in part due to increased populations of the primary thrips vector, western flower thrips (WFT; Frankliniella occidentalis). To develop an understanding of the epidemiology of TSWV in this region, population densities of WFT and incidence of TSWV were monitored in California's processing tomato transplant-producing greenhouses and associated open fields from 2007 to 2013. Thrips were monitored with yellow sticky cards and in tomato flowers, whereas TSWV incidence was assessed with indicator plants and field surveys for virus symptoms. All thrips identified from processing tomato fields were WFT, and females were three-fold more abundant on sticky cards than males. Symptoms of TSWV infection were observed in all monitored processing tomato fields. Incidences of TSWV ranged from 1 to 20%, with highest incidence found in late-planted fields. There was no single primary inoculum source, and inoculum sources for thrips/TSWV varied depending on the production region. These results allowed us to develop a model for TSWV infection of processing tomatoes in the Central Valley of California. The model predicts that low levels of primary TSWV inoculum are amplified in early-planted tomatoes and other susceptible crops leading to highest levels of infection in later-planted fields, especially those with high thrips populations. Based upon these findings, an integrated pest management (IPM) strategy for TSWV in processing tomatoes in California was devised. This IPM strategy focuses on strategic field placement (identification of high-risk situations), planting TSWV- and thrips-free transplants, planting resistant varieties, monitoring for TSWV symptoms and thrips, roguing infected plants, thrips management targeting early generations, extensive sanitation after harvest, and strategic cropping to avoid overlap with winter bridge crops.