Combined proteomics/miRNomics of dendritic cell immunotherapy-treated glioblastoma patients as a screening for survival-associated factors.

Glioblastoma is the most prevalent and aggressive brain cancer. With a median overall survival of ~15-20 months under standard therapy, novel treatment approaches are desperately needed. A recent phase II clinical trial with a personalized immunotherapy based on tumor lysate-charged dendritic cell (DC) vaccination, however, failed to prolong survival. Here, we investigated tumor tissue from trial patients to explore glioblastoma survival-related factors. We followed an innovative approach of combining mass spectrometry-based quantitative proteomics (n = 36) with microRNA sequencing plus RT-qPCR (n = 38). Protein quantification identified, e.g., huntingtin interacting protein 1 (HIP1), retinol-binding protein 1 (RBP1), ferritin heavy chain (FTH1) and focal adhesion kinase 2 (FAK2) as factor candidates correlated with a dismal prognosis. MicroRNA analysis identified miR-216b, miR-216a, miR-708 and let-7i as molecules potentially associated with favorable tissue characteristics as they were enriched in patients with a comparably longer survival. To illustrate the utility of integrated miRNomics and proteomics findings, focal adhesion was studied further as one example for a pathway of potential general interest. Taken together, we here mapped possible drivers of glioblastoma outcome under immunotherapy in one of the largest DC vaccination tissue analysis cohorts so far-demonstrating usefulness and feasibility of combined proteomics/miRNomics approaches. Future research should investigate agents that sensitize glioblastoma to (immuno)therapy-potentially building on insights generated here.

Spheroid glioblastoma culture conditions as antigen source for dendritic cell-based immunotherapy: spheroid proteins are survival-relevant targets but can impair immunogenic interferon γ production.

BACKGROUND: Glioblastoma is the most aggressive type of brain cancer. Dendritic cell (DC)-based immunotherapy against glioblastoma depends on the effectiveness of loaded antigens. Sphere-inducing culture conditions are being studied by many as a potential antigen source. Here, we investigated two different in vitro conditions (spheroid culture versus adherent culture) in relation to DC immunotherapy: (1) We studied the specific spheroid-culture proteome and assessed the clinical importance of spheroid proteins. (2) We evaluated the immunogenicity of spheroid lysate - both compared to adherent conditions. METHODS: We used seven spheroid culture systems, three of them patient-derived. Stemness-related markers were studied in those three via immunofluorescence. Spheroid-specific protein expression was measured via quantitative proteomics. The Cancer Genome Atlas (TCGA) survival data was used to investigate the clinical impact of spheroid proteins. Immunogenicity of spheroid versus adherent cell lysate was explored in autologous ELISPOT systems (DCs and T cells from the three patients). RESULTS: (1) The differential proteome of spheroid versus adherent glioblastoma culture conditions could successfully be established. The top 10 identified spheroid-specific proteins were associated with significantly decreased overall survival (TCGA MIT/Harvard cohort; n = 350, P = 0.014). (2) In exploratory experiments, immunogenicity of spheroid lysate vis-á-vis interferon (IFN)γ production was lower than that of adherent cell lysate (IFNγ ELISPOT; P = 0.034). CONCLUSIONS: Spheroid culture proteins seem to represent survival-relevant targets, supporting the use of spheroid culture conditions as an antigen source for DC immunotherapy. However, immunogenicity enhancement should be considered for future research. Transferability of our findings in terms of clinical impact and regarding different spheroid-generation techniques needs further validation.

Gliomasphere marker combinatorics: multidimensional flow cytometry detects CD44+/CD133+/ITGA6+/CD36+ signature.

Glioblastoma is the most dangerous brain cancer. One reason for glioblastoma's aggressiveness are glioblastoma stem-like cells. To target them, a number of markers have been proposed (CD133, CD44, CD15, A2B5, CD36, CXCR4, IL6R, L1CAM, and ITGA6). A comprehensive study of co-expression patterns of them has, however, not been performed so far. Here, we mapped the multidimensional co-expression profile of these stemness-associated molecules. Gliomaspheres - an established model of glioblastoma stem-like cells - were used. Seven different gliomasphere systems were subjected to multicolor flow cytometry measuring the nine markers CD133, CD44, CD15, A2B5, CD36, CXCR4, IL6R, L1CAM, and ITGA6 all simultaneously based on a novel 9-marker multicolor panel developed for this study. The viSNE dimensionality reduction algorithm was applied for analysis. All gliomaspheres were found to express at least five different glioblastoma stem-like cell markers. Multi-dimensional analysis showed that all studied gliomaspheres consistently harbored a cell population positive for the molecular signature CD44+/CD133+/ITGA6+/CD36+. Glioblastoma patients with an enrichment of this combination had a significantly worse survival outcome when analyzing the two largest available The Cancer Genome Atlas datasets (MIT/Harvard Affymetrix: P = 0.0015, University of North Carolina Agilent: P = 0.0322). In sum, we detected a previously unknown marker combination - demonstrating feasibility, usefulness, and importance of high-dimensional gliomasphere marker combinatorics.

Immunological analysis of phase II glioblastoma dendritic cell vaccine (Audencel) trial: immune system characteristics influence outcome and Audencel up-regulates Th1-related immunovariables.

Audencel is a dendritic cell (DC)-based cellular cancer immunotherapy against glioblastoma multiforme (GBM). It is characterized by loading of DCs with autologous whole tumor lysate and in vitro maturation via "danger signals". The recent phase II "GBM-Vax" trial showed no clinical efficacy for Audencel as assessed with progression-free and overall survival in all patients. Here we present immunological research accompanying the trial with a focus on immune system factors related to outcome and Audencel's effect on the immune system. Methodologically, peripheral blood samples (from apheresis before Audencel or venipuncture during Audencel) were subjected to functional characterization via enzyme-linked immunospot (ELISPOT) assays connected with cytokine bead assays (CBAs) as well as phenotypical characterization via flow cytometry and mRNA quantification. GBM tissue samples (from surgery) were subjected to T cell receptor sequencing and immunohistochemistry. As results we found: Patients with favorable pre-existing anti-tumor characteristics lived longer under Audencel than Audencel patients without them. Pre-vaccination blood CD8+ T cell count and ELISPOT Granzyme B production capacity in vitro upon tumor antigen exposure were significantly correlated with overall survival. Despite Audencel's general failure to induce a significant clinical response, it nevertheless seemed to have an effect on the immune system. For instance, Audencel led to a significant up-regulation of the Th1-related immunovariables ELISPOT IFNγ, the transcription factor T-bet in the blood and ELISPOT IL-2 in a dose-dependent manner upon vaccination. Post-vaccination levels of ELISPOT IFNγ and CD8+ cells in the blood were indicative of a significantly better survival. In summary, Audencel failed to reach an improvement of survival in the recent phase II clinical trial. No clinical efficacy was registered. Our concomitant immunological work presented here indicates that outcome under Audencel was influenced by the state of the immune system. On the other hand, Audencel also seemed to have stimulated the immune system. Overall, these immunological considerations suggest that DC immunotherapy against glioblastoma should be studied further - with the goal of translating an apparent immunological response into a clinical response. Future research should concentrate on investigating augmentation of immune reactions through combination therapies or on developing meaningful biomarkers.

Audencel Immunotherapy Based on Dendritic Cells Has No Effect on Overall and Progression-Free Survival in Newly Diagnosed Glioblastoma: A Phase II Randomized Trial.

Dendritic cells (DCs) are antigen-presenting cells that are capable of priming anti-tumor immune responses, thus serving as attractive tools to generate tumor vaccines. In this multicentric randomized open-label phase II study, we investigated the efficacy of vaccination with tumor lysate-charged autologous DCs (Audencel) in newly diagnosed glioblastoma multiforme (GBM). Patients aged 18 to 70 years with histologically proven primary GBM and resection of at least 70% were randomized 1:1 to standard of care (SOC) or SOC plus vaccination (weekly intranodal application in weeks seven to 10, followed by monthly intervals). The primary endpoint was progression-free survival at 12 months. Secondary endpoints were overall survival, safety, and toxicity. Seventy-six adult patients were analyzed in this study. Vaccinations were given for seven (3⁻20) months on average. No severe toxicity was attributable to vaccination. Seven patients showed flu-like symptoms, and six patients developed local skin reactions. Progression-free survival at 12 months did not differ significantly between the control and vaccine groups (28.4% versus 24.5%, p = 0.9975). Median overall survival was similar with 18.3 months (vaccine: 564 days, 95% CI: 436⁻671 versus control: 568 days, 95% CI: 349⁻680; p = 0.89, harzard ratio (HR) 0.99). Hence, in this trial, the clinical outcomes of patients with primary GBM could not be improved by the addition of Audencel to SOC.

Phase I dendritic cell p53 peptide vaccine for head and neck cancer.

BACKGROUND: p53 accumulation in head and neck squamous cell carcinoma (HNSCC) cells creates a targetable tumor antigen. Adjuvant dendritic cell (DC)-based vaccination against p53 was tested in a phase I clinical trial. EXPERIMENTAL METHODS: Monocyte-derived DC from 16 patients were loaded with two modified HLA-class I p53 peptides (Arm 1), additional Th tetanus toxoid peptide (Arm 2), or additional Th wild-type (wt) p53-specific peptide (Arm 3). Vaccine DCs (vDC) were delivered to inguinal lymph nodes at three time points. vDC phenotype, circulating p53-specific T cells, and regulatory T cells (Treg) were serially monitored by flow cytometry and cytokine production by Luminex. vDC properties were compared with those of DC1 generated with an alternative maturation regimen. RESULTS: No grade II-IV adverse events were observed. Two-year disease-free survival of 88% was favorable. p53-specific T-cell frequencies were increased postvaccination in 11 of 16 patients (69%), with IFN-γ secretion detected in four of 16 patients. Treg frequencies were consistently decreased (P = 0.006) relative to prevaccination values. The phenotype and function of DC1 were improved relative to vDC. CONCLUSION: Adjuvant p53-specific vaccination of patients with HNSCC was safe and associated with promising clinical outcome, decreased Treg levels, and modest vaccine-specific immunity. HNSCC patients' DC required stronger maturation stimuli to reverse immune suppression and improve vaccine efficacy.

Generation and immunosuppressive functions of p53-induced human adaptive regulatory T cells.

Inducible regulatory T cells (iTregs, also called Tr1 cells) are generated in the periphery (circulation or tissue) of cancer patients upon the encounter of naïve CD4+ T cells with tumor-associated antigens. As p53 is often inactivated by genetic or epigenetic events during oncogenesis, p53-induced Tr1 cells might play a key role in establishing immunosuppressive networks in cancer patients. Tr1 cells were generated by co-culturing circulating CD4+CD25- T cells with autologous immature dendritic cells pulsed with a wild-type (WT) p53-derived peptide or an unrelated peptide derived from mucin 1 (MUC1). The Tr1 phenotype and the specificity for p53 of these cells were confirmed by multicolor flow cytometry. Moreover, the Tr1 cell-mediated suppression of T-cell proliferation was evaluated by CFSE-based flow cytometry, while their ability to alter the T-cell cytokine profile by ELISA and Luminex assays. The capacity of p53-induced Tr1 cells to suppress the generation and function of cytotoxic T lymphcoytes (CTLs) was assessed by flow cytometry and ELISPOT. Of note, low doses of the p53-derived peptide (p53low) induced greater numbers of Tr1 cells than the same peptide employed at high doses (p53high). Moreover, Tr1/p53low cells not secreted higher levels of interleukin-10 and transforming growth factor ß1, but also mediated more robust suppressive effects on CTL proliferation than Tr1/p53high cells. Tr1/p53low cells, Tr1/p53high cells, as well as Tr1 cells generated with low doses of an unrelated MUC1-derived peptide were equally effective in suppressing the expansion and antitumor activity of p53-reactive CTLs. p53low induced the expansion of highly suppressive p53-reactive Tr1 cells. However, the capacity of these Tr1 cells to suppress the generation and function of p53-reactive CTLs was independent of their antigen-specificity.

17ß Hydroxysteroid dehydrogenase type 12 (HSD17B12) is a marker of poor prognosis in ovarian carcinoma.

OBJECTIVE: 17ß-hydroxysteroid dehydrogenase isoform 12 (HSD17B12) overexpression is associated with poor clinical outcome in invasive ductal carcinoma of the breast. Here, we evaluated HSD17B12 overexpression and its activity in ovarian carcinoma (OvCa) to determine its role in the growth and progression of this tumor. METHODS: Immunohistochemical analysis of HSD17B12 expression was performed in 100 tissue samples of untreated OvCa and was correlated with clinicopathologic characteristics and patient outcome. In A2780 OvCa cell line expressing HSD17B12, siRNA knockdown of the enzyme was performed, and its effects on tumor cell growth and Annexin V binding were determined. RESULTS: HSD17B12 expression was detected in all tumor samples, but the staining intensity was variable. Normal ovarian epithelium was negative. Patients with tumor showing weak/moderate expression of HSD17B12 had a better overall survival than those with strongly positive tumors (p<0.001). The time to first recurrence was longer for patients with tumors with heterogeneous staining relative to patients with tumors that were uniformly positive (p<0.001). Upon silencing of HSD17B12 in tumor cells, their growth was inhibited (p<0.005) and apoptosis was increased (p<0.05). Arachidonic acid but not estradiol reversed the growth inhibition mediated by HSD17B12 knockdown. CONCLUSION: HSD17B12 overexpression is shown to be a marker of poor survival in patients with OvCa. Expression in the tumor and function of this enzyme facilitates OvCa progression.

A gynecologic oncology group phase II trial of two p53 peptide vaccine approaches: subcutaneous injection and intravenous pulsed dendritic cells in high recurrence risk ovarian cancer patients.

PURPOSE: Peptide antigens have been administered by different approaches as cancer vaccine therapy, including direct injection or pulsed onto dendritic cells; however, the optimal delivery method is still debatable. In this study, we describe the immune response elicited by two vaccine approaches using the wild-type (wt) p53 vaccine. EXPERIMENTAL DESIGN: Twenty-one HLA-A2.1 patients with stage III, IV, or recurrent ovarian cancer overexpressing the p53 protein with no evidence of disease were treated in two cohorts. Arm A received SC wt p53:264-272 peptide admixed with Montanide and GM-CSF. Arm B received wt p53:264-272 peptide-pulsed dendritic cells IV. Interleukin-2 (IL-2) was administered to both cohorts in alternative cycles. RESULTS: Nine of 13 patients (69%) in arm A and 5 of 6 patients (83%) in arm B developed an immunologic response as determined by ELISPOT and tetramer assays. The vaccine caused no serious systemic side effects. IL-2 administration resulted in grade 3 and 4 toxicities in both arms and directly induced the expansion of T regulatory cells. The median overall survival was 40.8 and 29.6 months for arm A and B, respectively; the median progression-free survival was 4.2 and. 8.7 months, respectively. CONCLUSION: We found that using either vaccination approach generates comparable specific immune responses against the p53 peptide with minimal toxicity. Accordingly, our findings suggest that the use of less demanding SC approach may be as effective. Furthermore, the use of low-dose SC IL-2 as an adjuvant might have interfered with the immune response. Therefore, it may not be needed in future trials.

Function but not phenotype of melanoma peptide-specific CD8(+) T cells correlate with survival in a multiepitope peptide vaccine trial (ECOG 1696).

ECOG 1696 was a Phase II multi-center trial testing vaccination with melanoma peptides, gp100, MART-1 and tyrosinase delivered alone, with GM-CSF, IFN-α2b or both cytokines to HLA-A2(+) patients with metastatic melanoma. Here, the frequency of circulating CD8(+) tetramer(+) (tet(+) ) T cells and maturation stages of responding T cells were serially monitored and compared with baseline values in a subset of patients (n = 37) from this trial. Multiparameter flow cytometry was used to measure the frequency of CD8(+) T cells specific for gp100, MART-1, tyrosinase and influenza (FLU) peptides. Expression of CD45RA/CCR7 on CD8(+) tet(+) T cells and CD25, CD27, CD28 on all circulating T cells was determined. Vaccine-induced changes in the CD8(+) tet(+) T cell frequency and phenotype were compared with results of IFN-γ ELISPOT assays and with clinical responses. The frequency of CD8(+) tet(+) T cells in the circulation was increased for the melanoma peptides (p < 0.03-0.0001) but not for FLU (p < 0.9). Only gp100- and MART-1-specific T cells differentiated to CD45RA(+) CCR7(-) effector/memory T cells. In contrast to the IFN-γ ELISPOT frequency, previously correlated with overall survival (Kirkwood et al., Clin Cancer Res 2009;15:1443-51), neither the frequency nor differentiation stage of CD8(+) tet(+) T cells correlated with clinical responses. Delivery of GM-CSF and/or IFN-α2b had no effects on the frequency or differentiation of CD8(+) tet(+) , CD8+ or CD4+ T cells. Phenotypic analyses of CD8(+) tet(+) T cells did not correlate with clinical responses to the vaccine, indicating that functional assessments of peptide-specific T cells are preferable for monitoring of anti-tumor vaccines.

Inhibition of poly(ADP-ribose) polymerase (PARP) induces apoptosis in lung cancer cell lines.

We have tested PJ34, a potent inhibitor of poly(ADP-ribose) polymerase (PARP), against various lung cancer cell lines (Calu-6, A549, and H460) and normal human bronchial epithelial cells (HBECs). While using WST1 dye assay, lung cancer cells exhibited LD(50) values of approximately 30 µM PJ34 (72-hr assay). Molecular data showed that the effect of PJ34-induced apoptosis on lung cancer cells occurs via a caspase-dependent pathway. The present study has clearly shown that (a) PARP inhibitor can independently kill tumor cells, (b) caspase-3 has modest influence on PARP-inhibitor-mediated cancer-specific toxicity, and (c) a pan-caspase inhibitor decreases the apoptotic effect of PJ34.

Targeting ALDH(bright) human carcinoma-initiating cells with ALDH1A1-specific CD8⁺ T cells.

PURPOSE: Cancer-initiating cells (CIC) are considered to represent the subpopulation of tumor cells that is resistant to conventional cancer treatments, highly tumorigenic in immunodeficient mice, and responsible for tumor recurrence and metastasis. Based on an elevated aldehyde dehydrogenase (ALDH) activity attributable to ALDH1/3 isoforms, ALDH(bright) cells have been identified and isolated from tumors and shown to have characteristics of CIC. The ALDH1A1 isoform was previously identified as a tumor antigen recognized by CD8(+) T cells. This study examines the ability of ALDH1A1-specific CD8(+) T cells to eliminate ALDH(bright) cells and control tumor growth and metastases. EXPERIMENTAL DESIGN: ALDH(bright) cells were isolated by flow cytometry using ALDEFLUOR from HLA-A2(+) human head and neck, breast, and pancreas carcinoma cell lines and tested for their tumorigenicity in immunodeficient mice. ALDH1A1-specific CD8(+) T cells were generated in vitro and tested for their ability to eliminate CICs in vitro and in vivo by adoptive transfer to immunodeficient mice bearing human tumor xenografts. RESULTS: ALDH(bright) cells isolated by flow cytometry from HLA-A2(+) breast, head and neck, and pancreas carcinoma cell lines at low numbers (500 cells) were tumorigenic in immunodeficient mice. ALDH(bright) cells present in these cell lines, xenografts, or surgically removed lesions were recognized by ALDH1A1-specific CD8(+) T cells in vitro. Adoptive therapy with ALDH1A1-specific CD8(+) T cells eliminated ALDH(bright) cells, inhibited tumor growth and metastases, or prolonged survival of xenograft-bearing immunodeficient mice. CONCLUSIONS: The results of this translational study strongly support the potential of ALDH1A1-based immunotherapy to selectively target CICs in human cancer.

Identification of Hydroxysteroid (17ß) dehydrogenase type 12 (HSD17B12) as a CD8+ T-cell-defined human tumor antigen of human carcinomas.

Hydroxysteroid (17ß) dehydrogenase type 12 (HSD17B12) is a multifunctional isoenzyme functional in the conversion of estrone to estradiol (E2), and elongation of long-chain fatty acids, in particular the conversion of palmitic to archadonic (AA) acid, the precursor of sterols and the inflammatory mediator, prostaglandin E(2). Its overexpression together with that of COX-2 in breast carcinoma is associated with a poor prognosis. We have identified the HSD17B12(114-122) peptide (IYDKIKTGL) as a naturally presented HLA-A*0201 (HLA-A2)-restricted CD8(+) T-cell-defined epitope. The HSD17B12(114-122) peptide, however, is poorly immunogenic in its in vitro ability to induce peptide-specific CD8(+) T cells. Acting as an "optimized peptide", a peptide (TYDKIKTGL), which is identical to the HSD17B12(114-122) peptide except for threonine at residue 1, was required for inducing in vitro the expansion of CD8(+) T-cell effectors cross-reactive against the HSD17B12(114-122) peptide. In IFN-γ ELISPOT assays, these effector cells recognize HSD17B12(114-122) peptide-pulsed target cells, as well as HLA-A2(+) squamous cell carcinoma of the head and neck (SCCHN) and breast carcinoma cell lines overexpressing HSD17B12 and naturally presenting the epitope. Whereas growth inhibition of a breast carcinoma cell line induced by HSD17B12 knockdown was only reversed by AA, in a similar manner, the growth inhibition of the SCCHN PCI-13 cell line by HSD17B12 knockdown was reversed by E2 and AA. Our findings provide the basis for future studies aimed at developing cancer vaccines for targeting HSD17B12, which apparently can be functional in critical metabolic pathways involved in inflammation and cancer.

Identification of a 17beta-hydroxysteroid dehydrogenase type 12 pseudogene as the source of a highly restricted BALB/c Meth A tumor rejection peptide.

Mass spectrometric analysis identified the peptide recognized by a cytotoxic T lymphocyte (CTL) specific for the chemically induced BALB/c Meth A sarcoma as derived from a 17beta-hydroxysteroid dehydrogenase type 12 (Hsd17b12) pseudogene present in the BALB/c genome, but only expressed in Meth A sarcoma. The sequence of the peptide is TYDKIKTGL and corresponds to Hsd17b12(114-122) with threonine instead of isoleucine at codon 114 and is designated Hsd17b12(114T). Immunization of mice with an Hsd17b12(114T) peptide-pulsed dendritic cell-based vaccine or a non-viral plasmid construct expressing the Hsd17b12(114T) peptide protected the mice from lethal Meth A tumor challenge in tumor rejection assays. A Hsd17b12(114-122) peptide-pulsed vaccine was ineffective in inducing resistance in mice to Meth A sarcoma. These results confirm the immunogenicity of the identified tumor peptide, as well as demonstrate the efficacies of these vaccine vehicles. These findings suggest that the role of the human homolog of Hsd17b12, HSD17B12, as a potential human tumor antigen be explored.

Tumor-derived microvesicles promote regulatory T cell expansion and induce apoptosis in tumor-reactive activated CD8+ T lymphocytes.

Sera of patients with cancer contain membraneous microvesicles (MV) able to induce apoptosis of activated T cells by activating the Fas/Fas ligand pathway. However, the cellular origin of MV found in cancer patients' sera varies as do their molecular and cellular profiles. To distinguish tumor-derived MV in cancer patients' sera, we used MAGE 3/6(+) present in tumors and MV. Molecular profiles of MAGE 3/6(+) MV were compared in Western blots or by flow cytometry with those of MV secreted by dendritic cells or activated T cells. These profiles were found to be distinct for each cell type. Only tumor-derived MV were MAGE 3/6(+) and were variably enriched in 42-kDa Fas ligand and MHC class I but not class II molecules. Effects of MV on signaling via the TCR and IL-2R and proliferation or apoptosis of activated primary T cells and T cell subsets were also assessed. Functions of activated CD8(+) and CD4(+) T lymphocytes were differentially modulated by tumor-derived MV. These MV inhibited signaling and proliferation of activated CD8(+) but not CD4(+) T cells and induced apoptosis of CD8(+) T cells, including tumor-reactive, tetramer(+)CD8(+) T cells as detected by flow cytometry for caspase activation and annexin V binding or by DNA fragmentation. Tumor-derived but not dendritic cell-derived MV induced the in vitro expansion of CD4(+)CD25(+)FOXP3(+) T regulatory cells and enhanced their suppressor activity. The data suggest that tumor-derived MV induce immune suppression by promoting T regulatory cell expansion and the demise of antitumor CD8(+) effector T cells, thus contributing to tumor escape.

Spontaneous apoptosis of tumor-specific tetramer+ CD8+ T lymphocytes in the peripheral circulation of patients with head and neck cancer.

BACKGROUND: In cancer, tumor escape from the host immune system includes apoptosis of circulating CD3(+)CD8(+) effector T lymphocytes. Here, we compare sensitivity to apoptosis of virus- with tumor-specific circulating CD8(+) T cells in patients with head and neck cancer. METHODS: Wild-type p53 peptide-specific (p53(264-272) and p53(149-157)) and viral peptide-specific (EBV BMLF(259-267) and CMVpp65(495-503)) tetramers were used to measure the frequency of reactive T cells by flow cytometry. Annexin V (ANX) binding to circulating 7-amino-actinomycin D-negative but tetramer(+)CD8(+) T cells in PBMC obtained from 21 patients with head and neck cancer and 11 normal controls (NC) was evaluated. RESULTS: In patients with head and neck cancer, a higher percentage of tetramer(+)CD8(+) than tetramer(-)CD8(+) T cells bound ANX (p < .023-.005). Although most tumor-epitope(+)CD8(+) T cells bound ANX, lower percentages of virus-specific CD8(+) T cells were ANX(+) in the same patients. CONCLUSIONS: Preferential demise of circulating tumor-specific CD8(+) T cells and their paucity in head and neck cancer contribute to tumor escape.

Prognostic significance and diagnostic value of protein S-100 and tyrosinase in patients with malignant melanoma.

OBJECTIVES: The utility of many molecules as tumor markers in melanoma has been investigated with different results. The aims of this study was to compare the value of tyrosinase mRNA by reverse transcription polymerase chain reaction (RT-PCR) in peripheral blood and of serum S-100 protein in patients with melanoma at different stages of disease. METHODS: We have studied 90 peripheral blood samples corresponding to 90 patients that had been diagnosed with melanoma. The clinical staging at the time of blood sampling was performed according to the American Join Committee on Cancer guidelines. S-100 protein in serum was measured by enzyme-linked immunosorbent assay (normal range: 0-0.150 microg) and the presence of tyrosinase mRNA was assessed by RT-PCR. RESULTS: Median progression-free survival was 281 days for tyrosinase positive patients and it has not been reached for tyrosinase negative patients (P = 0.03). Median progression free survival was 213 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). Median overall survival (OS) was 396 days for tyrosinase positive patients and it has not been reached for negative patients (P = 0.0096). Median OS was 282 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). In a multivariate analysis, both markers have significant prognostic value for time to progression and for survival (chi(2) test). CONCLUSIONS: RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.

Identification of human aldehyde dehydrogenase 1 family member A1 as a novel CD8+ T-cell-defined tumor antigen in squamous cell carcinoma of the head and neck.

Few epitopes are available for vaccination therapy of patients with squamous cell carcinoma of the head and neck (SCCHN). Using a tumor-specific CTL, aldehyde dehydrogenase 1 family member A1 (ALDH1A1) was identified as a novel tumor antigen in SCCHN. Mass spectral analysis of peptides in tumor-derived lysates was used to determine that the CTL line recognized the HLA-A*0201 (HLA-A2) binding ALDH1A1(88-96) peptide. Expression of ALDH1A1 in established SCCHN cell lines, normal mucosa, and primary keratinocytes was studied by quantitative reverse transcription-PCR and immunostaining. Protein expression was further defined by immunoblot analysis, whereas ALDH1A1 activity was measured using ALDEFLUOR. ALDH1A1(88-96) peptide was identified as an HLA-A2-restricted, naturally presented, CD8(+) T-cell-defined tumor peptide. ALDH1A1(88-96) peptide-specific CD8(+) T cells recognized only HLA-A2(+) SCCHN cell lines, which overexpressed ALDH1A1, as well as targets transfected with ALDH1A1 cDNA. Target recognition was blocked by anti-HLA class I and anti-HLA-A2 antibodies. SCCHN cell lines overexpressing ALDH1 had high enzymatic activity. ALDH1A1 protein was expressed in 12 of 17 SCCHN, and 30 of 40 dysplastic mucosa samples, but not in normal mucosa. ALDH1A1 expression levels in target cells correlated with their recognition by ALDH1A1(88-96) peptide-specific CD8(+) T cells. Our findings identify ALDH1A1, a metabolic antigen, as a potential target for vaccination therapy in the cohort of SCCHN subjects with tumors overexpressing this protein. A smaller cohort of subjects with SCCHN, whose tumors express little to no ALDH1A1, and thus are deficient in conversion of retinal to retinoic acid, could benefit from chemoprevention therapy.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Results of a pilot trial of immunotherapy with dendritic cells pulsed with autologous tumor lysates in patients with advanced cancer.

AIMS AND BACKGROUND: The purpose of the study was to test the immunological and clinical effects of infusions of dendritic cells pulsed with autologous tumor lysate in patients with advanced cancer. PATIENTS AND METHODS: Peripheral blood mononuclear cells from 15 patients with metastatic cancer (melanoma in 10, lung cancer in 2, renal cell carcinoma in 1, sarcoma in 1, breast cancer in 1) were harvested by leukapheresis after mobilization with GM-CSF (5 microg/kg/day s.c. for 4 days). Mononuclear cells were separated and cultured in GM-CSF (1000 U/ml) and interleukin-4 (1000 U/ml) for 7 days. Phenotype was assessed by 2-color flow cytometry and immunocytochemistry. On day 6, dendritic cells were pulsed with 1 g of fresh autologous tumor lysate for 24 h and infused intravenously. Interleukin-2 (6 million IU), interferon a (4 million IU) and GM-CSF (400 microg) were injected s.c. daily for 10 days beginning on the day of dendritic cell infusion. Treatment was repeated every 21 days for 3 courses. RESULTS: The morphology, immunocytochemistry and phenotype of cultured cells was consistent with dendritic cells: intense positivity for HLA-DR and CD86, with negativity for markers of other lineages, including CD3, CD4, CD8 and CD14. More than 5 x 10(7) dendritic cells were injected in all patients. Nine patients developed >5 mm delayed type cutaneous hypersensitivity reactions to tumor lysate+/-GM-CSF after the first immunization (larger than GM-CSF in all cases). Median delayed type cutaneous hypersensitivity to lysate +/- GM-CSF was 3 cm after the third immunization. One melanoma patient with skin, liver, lung and bone metastases had a partial response lasting 8 months (followed by progression in the brain). Seven patients had stable disease for >3 months, and 7 had progression. CONCLUSIONS: Infusion of tumor lysate-pulsed dendritic cells induces a strong cell-mediated antitumor immune reaction in patients with advanced cancer and has some clinical activity.