Evaluating Fluorinated-Aniline Units with Functionalized Spiro[Fluorene-9,9'-Xanthene] as Hole-Transporting Materials in Perovskite Solar Cells and Light-Emitting Diodes.

In the field of perovskite optoelectronics, developing hole-transporting materials (HTMs) on the spiro[fluorene-9,9'-xanthene] (SFX) platform is one of the current research focuses. The SFX inherits the merits of spirobifluorene in terms of the configuration and property, but it is more easily derivatized and regulated by virtue of its binary structure. In this work, we design and synthesize four isomeric SFX-based HTMs, namely m-SFX-mF, p-SFX-mF, m-SFX-oF, and p-SFX-oF, through varying the positions of fluorination on the peripheral aniline units and their substitutions on the SFX core, and the optoelectronic performance of the resulting HTMs is evaluated in both perovskite solar cells (PSCs) and light-emitting diodes (PeLEDs) by the vacuum thermal evaporating hole-transporting layers (HTLs). The HTM p-SFX-oF exhibits an improved power conversion efficiency of 15.21% in an inverted PSC using CH3NH3PbI3 as an absorber, benefiting from the deep HOMO level and good HTL/perovskite interface contact. Meanwhile, the HTM m-SFX-mF provides a maximum external quantum efficiency of 3.15% in CsPb(Br/Cl)3-based PeLEDs, which is attributed to its perched HOMO level and shrunken band-gap for facilitating charge carrier injection and then exciton combination. Through elucidating the synergistic position effect of fluorination on aniline units and their substitutions on the SFX core, this work lays the foundation for developing low-cost and efficient HTMs in the future.

Ligand Homogenized Br-I Wide-Bandgap Perovskites for Efficient NiOx-Based Inverted Semitransparent and Tandem Solar Cells.

Phase heterogeneity of bromine-iodine (Br-I) mixed wide-bandgap (WBG) perovskites has detrimental effects on solar cell performance and stability. Here, we report a heterointerface anchoring strategy to homogenize the Br-I distribution and mitigate the segregation of Br-rich WBG-perovskite phases. We find that methoxy-substituted phenyl ethylammonium (x-MeOPEA+) ligands not only contribute to the crystal growth with vertical orientation but also promote halide homogenization and defect passivation near the buried perovskite/hole transport layer (HTL) interface as well as reduce trap-mediated recombination. Based on improvements in WBG-perovskite homogeneity and heterointerface contacts, NiOx-based opaque WBG-perovskite solar cells (WBG-PSCs) achieved impressive open-circuit voltage (Voc) and fill factor (FF) values of 1.22 V and 83%, respectively. Moreover, semitransparent WBG-PSCs exhibit a PCE of 18.5% (15.4% for the IZO front side) and a high FF of 80.7% (79.4% for the IZO front side) for a designated illumination area (da) of 0.12 cm2. Such a strategy further enables 24.3%-efficient two-terminal perovskite/silicon (double-polished) tandem solar cells (da of 1.159 cm2) with a high Voc of over 1.90 V. The tandem devices also show high operational stability over 1000 h during T90 lifetime measurements.

Anti-hyperuricemia bioactive peptides: a review on obtaining, activity, and mechanism of action.

Hyperuricemia, a disorder of uric acid metabolism, serves as a significant risk factor for conditions such as hypertension, diabetes mellitus, renal failure, and various metabolic syndromes. The main contributors to hyperuricemia include overproduction of uric acid in the liver or impaired excretion in the kidneys. Despite traditional clinical drugs being employed for its treatment, significant health concerns persist. Recently, there has been growing interest in utilizing protein peptides sourced from diverse food origins to mitigate hyperuricemia. This article provides a comprehensive review of bioactive peptides with anti-hyperuricemia properties derived from animals, plants, and their products. We specifically outline the methods for preparing these peptides from food proteins and elucidate their efficacy and mechanisms in combating hyperuricemia, supported by in vitro and in vivo evidence. Uric acid-lowering peptides offer promising prospects due to their safer profile, enhanced efficacy, and improved bioavailability. Therefore, this review underscores significant advancements and contributions in identifying peptides capable of metabolizing purine and/or uric acid, thereby alleviating hyperuricemia. Moreover, it offers a theoretical foundation for the development of functional foods incorporating uric acid-lowering peptides.

Crystallization Kinetics of Perovskite Films by a Green Mixture Antisolvent for Efficient NiOx-Based Inverted Solar Cells.

Environment-friendly antisolvents are critical for obtaining highly efficient, reproducible, and sustainable perovskite solar cells (PSCs). Here, we introduced a green mixture antisolvent of ethyl acetate-isopropanol (EA/IPA) to finely regulate the crystal grain growth and related film properties, including the morphology, crystal structure, and chemical composition of the perovskite thin film. The IPA with suitable content in EA plays a key role in achieving a smooth and compact high-quality perovskite thin film, leading to the suppression of film defect-induced nonradiative recombination. As a result, the PSCs based on the EA/IPA (5:1) antisolvent showed a power conversion efficiency of 22.9% with an open-circuit voltage of 1.17 V.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Study on Electrically Modulated Quasi-Continuous Wave Fe: ZnSe Solid-State Laser with Hundred-Hertz.

Iron-doped binary chalcogenide crystals are very promising for tunable solid-state lasers operating over the 3~5 µm spectral range. Fe: ZnSe is one of the most important gain crystals with the obvious advantages of material characteristics and conversion efficiency. By adjusting the output mode of the pump source, an Fe: ZnSe laser can operate in two modes at liquid nitrogen temperatures: continuous wave (CW) and pulse output. In terms of CW output, the Fe: ZnSe laser obtained a maximum 2.63 W continuous power output which was confined to the power of the pump source. An optical-to-optical efficiency of 47.05% was acquired. Direct electrical modulation was applied to the pump source. The highest average power of the quasi-CW laser, whose central wavelength is 4.02 µm, has a value of 253 mW with an optical-to-optical efficiency of 42.88% and a full width at half maximum (FWHM) of 23 nm when the pulse frequency is 100 Hz of 10% duty factor. The output waveform is consistent with the modulation waveform applied to the pump source. We report to the first of our knowledge an electrically modulated quasi-CW Fe: ZnSe laser in the pulse regime, equipped with features of compactness in structure, ignoring additional modulators, convenience in control, high efficiency, and sustainable operation, of great interest for solving numerous scientific and applied problems.

Urolithins: A Prospective Alternative against Brain Aging.

The impact of host-microbiome interactions on cognitive health and disease has received increasing attention. Microbial-derived metabolites produced in the gut are one of crucial mechanisms of the gut-brain axis interaction, showing attractive perspectives. Urolithins (Uros) are gut microbial-derived metabolites of ellagitannins and ellagic acid, whose biotransformation varies considerably between individuals and decreases greatly with age. Recently, accumulating evidence has suggested that Uros may have specific advantages in preventing brain aging including favorable blood-brain barrier permeability, selective brain distribution, and increasingly supporting data from preclinical and clinical studies. However, the usability of Uros in diagnosis, prevention, and treatment of neurodegenerative diseases remains elusive. In this review, we aim to present the comprehensive achievements of Uros in age-related brain dysfunctions and neurodegenerative diseases and discuss their prospects and knowledge gaps as functional food, drugs, or biomarkers against brain aging.

Therapeutic Activity of Green Tea Epigallocatechin-3-Gallate on Metabolic Diseases and Non-Alcoholic Fatty Liver Diseases: The Current Updates.

Green tea polyphenols have numerous functions including antioxidation and modulation of various cellular proteins and are thus beneficial against metabolic diseases including obesity, type 2 diabetes, cardiovascular and non-alcoholic fatty liver diseases, and their comorbidities. Epigallocatechin-3-gallate (EGCG) is the most abundant polyphenol in green tea and is attributed to antioxidant and free radical scavenging activities, and the likelihood of targeting multiple metabolic pathways. It has been shown to exhibit anti-obesity, anti-inflammatory, anti-diabetic, anti-arteriosclerotic, and weight-reducing effects in humans. Worldwide, the incidences of metabolic diseases have been escalating across all age groups in modern society. Therefore, EGCG is being increasingly investigated to address the problems. This review presents the current updates on the effects of EGCG on metabolic diseases, and highlights evidence related to its safety. Collectively, this review brings more evidence for therapeutic application and further studies on EGCG and its derivatives to alleviate metabolic diseases and non-alcoholic fatty liver diseases.

Recent Advances in Synthetic Drugs and Natural Actives Interacting with OAT3.

Organic anion transporter 3 (OAT3) is predominantly expressed in the kidney and plays a vital role in drug clearance. Consequently, co-ingestion of two OAT3 substrates may alter the pharmacokinetics of the substrate. This review summarizes drug-drug interactions (DDIs) and herbal-drug interactions (HDIs) mediated by OAT3, and inhibitors of OAT3 in natural active compounds in the past decade. This provides a valuable reference for the combined use of substrate drugs/herbs for OAT3 in clinical practice in the future and for the screening of OAT3 inhibitors to avoid harmful interactions.

Bioactive Compounds in Sea Buckthorn and their Efficacy in Preventing and Treating Metabolic Syndrome.

Sea buckthorn (Hippophae rhamnoides L. or Elaeagnus rhamnoides L.) is a plant that has long been used as a Chinese herbal medicine. This species is known to contain numerous bioactive components, including polyphenols, fatty acids, vitamins, and phytosterols, which may be responsible for its medicinal value. In experiments both in vitro and in vivo (ranging from cell lines to animal models and human patients), sea buckthorn has shown positive effects on symptoms of metabolic syndrome; evidence suggests that sea buckthorn treatment can decrease blood lipid content, blood pressure, and blood sugar levels, and regulate key metabolites. This article reviews the main bioactive compounds present in sea buckthorn and discusses their efficacy in treating metabolic syndrome. Specifically, we highlight bioactive compounds isolated from distinct sea buckthorn tissues; their effects on abdominal obesity, hypertension, hyperglycemia, and dyslipidemia; and their potential mechanisms of action in clinical applications. This review provides key insight into the benefits of sea buckthorn, promoting future research of this species and expansion of sea buckthorn-based therapies for metabolic syndrome.

Ras2 Is Responsible for the Environmental Responses, Melanin Metabolism, and Virulence of Botrytis cinerea.

Ras proteins are monomeric G proteins that are ubiquitous in fungal cells and play important roles in fungal growth, virulence, and environmental responses. Botrytis cinerea is a phytopathogenic fungus that infects various crops. However, under specific environmental conditions, the overripe grapes infected by B. cinerea can be used to brew valuable noble rot wine. As a Ras protein, the role of Bcras2 in the environmental responses of B. cinerea is poorly understood. In this study, we deleted the Bcras2 gene using homologous recombination and examined its functions. Downstream genes regulated by Bcras2 were explored using RNA sequencing transcriptomics. It was found that ΔBcras2 deletion mutants showed significantly reduced growth rate, increased sclerotia production, decreased resistance to oxidative stress, and enhanced resistance to cell wall stress. Additionally, Bcras2 deletion promoted the expression of melanin-related genes in sclerotia and decreased the expression of melanin-related genes in conidia. The above results indicate that Bcras2 positively regulates growth, oxidative stress resistance, and conidial melanin-related genes expression, and negatively regulates sclerotia production, cell wall stress resistance and sclerotial melanin-related genes expression. These results revealed previously unknown functions of Bcras2 in environmental responses and melanin metabolism in B. cinerea.

Hole-Transport Management Enables 23%-Efficient and Stable Inverted Perovskite Solar Cells with 84% Fill Factor.

NiOx-based inverted perovskite solar cells (PSCs) have presented great potential toward low-cost, highly efficient and stable next-generation photovoltaics. However, the presence of energy-level mismatch and contact-interface defects between hole-selective contacts (HSCs) and perovskite-active layer (PAL) still limits device efficiency improvement. Here, we report a graded configuration based on both interface-cascaded structures and p-type molecule-doped composites with two-/three-dimensional formamidinium-based triple-halide perovskites. We find that the interface defects-induced non-radiative recombination presented at HSCs/PAL interfaces is remarkably suppressed because of efficient hole extraction and transport. Moreover, a strong chemical interaction, halogen bonding and coordination bonding are found in the molecule-doped perovskite composites, which significantly suppress the formation of halide vacancy and parasitic metallic lead. As a result, NiOx-based inverted PSCs present a power-conversion-efficiency over 23% with a high fill factor of 0.84 and open-circuit voltage of 1.162 V, which are comparable to the best reported around 1.56-electron volt bandgap perovskites. Furthermore, devices with encapsulation present high operational stability over 1,200 h during T90 lifetime measurement (the time as a function of PCE decreases to 90% of its initial value) under 1-sun illumination in ambient-air conditions.

Walnut polyphenols and the active metabolite urolithin A improve oxidative damage in SH-SY5Y cells by up-regulating PKA/CREB/BDNF signaling.

Accumulating evidence has confirmed the health benefits of walnut diets in maintaining brain function with age. Recent studies have indicated that walnut polyphenols (WP) and their active metabolites urolithins may play an important role in the health benefits of walnut diets. In the present study, we evaluated the protective effect of WP and urolithin A (UroA) on H2O2-induced damage in human neuroblastoma (SH-SY5Y) cells, and investigated its mechanisms in the cAMP-response element binding protein (CREB)-mediated signaling pathway, which is tightly involved in neurodegenerative and neurological diseases. The results demonstrated that both WP (50 and 100 µg mL-1) and UroA (5 and 10 µM) treatment significantly reversed the decrease of cell viability, the leakage of extracellular lactate dehydrogenase (LDH), the overload of intracellular calcium and cell apoptosis induced by H2O2 treatment. Moreover, WP and UroA treatment also relieved H2O2-induced oxidative stress including overproduction of intracellular reactive oxygen species (ROS) and reduced activities of superoxide dismutase (SOD) and catalase (CAT). Additionally, western blot analysis showed that WP and UroA treatment significantly increased the activity of cAMP-dependent protein kinase A (PKA) and the expression of pCREB (Ser133) and its downstream molecule brain-derived neurotrophic factor (BDNF), which were decreased by H2O2 treatment. Furthermore, pretreatment with the PKA inhibitor H89 abolished the protective effects of WP and UroA, indicating that up-regulation of the PKA/CREB/BDNF neurotrophic signaling pathway is required for their neuroprotective effects against oxidative stress. The current work provides new perspectives for understanding the beneficial effects of WP and UroA on brain function, which warrants further investigation.

[A consensus on prenatal diagnosis and genetic counseling for chromosomal mosaicism].

With the extensive application of highly sensitive genetic techniques in the field of prenatal diagnosis, prenatal chromosomal mosaicisms including true fetal mosaicisms and confined placental mosaicisms are frequently identified in clinical settings, and the diagnostic criteria and principle of genetic counseling and clinical management for such cases may vary significantly among healthcare centers across the country. This not only has brought challenges to laboratory technician, genetic counselor and fetal medicine doctor, but can also cause confusion and anxiety of the pregnant woman and their family members. In this regard, we have formulated a consensus over the prenatal diagnosis and genetic counseling for chromosomal mosaicisms with the aim to promote more accurate and rational evaluation for fetal chromosomal mosaicisms in prenatal clinics.

Multifunctional Two-Dimensional Benzodifuran-Based Polymer for Eco-Friendly Perovskite Solar Cells Featuring High Stability.

Perovskite solar cells (PSCs) have been regarded as an exceptional renewable energy conversion technology due to their rapidly increasing photovoltaic efficiency, while their practical application is highly retarded by their intrinsic instability and potential lead ion leakage. Here, a two-dimensional (2D) π-conjugated benzodifuran-based polymer, PBDFP-Bz, is adopted to modify the perovskite film. Note that PBDFP-Bz could neutralize surface defects, fine-tune interfacial energetics, and hamper moisture ingression into the perovskite film. Therefore, high-quality perovskite films featuring reduced trap state density and enhanced moisture tolerance could be obtained after modification via PBDFP-Bz. Consequently, PBDFP-Bz-modified devices deliver a higher efficiency of 21.73% versus 19.55% of control ones. Meanwhile, PBDFP-Bz-modified devices can preserve 82.7 and 90.8% of their initial efficiency under continuous heating at 85 °C or light soaking for 500 h. However, the corresponding retained values of control devices are only 56.4 and 70.2%, respectively. Moreover, PBDFP-Bz can effectively prevent the leakage of lead ions in modified devices relative to control ones. This work not only reveals that PBDFP-Bz features high potential for fabricating high-performance and robust PSCs but also indicates that 2D π-conjugated benzodifuran-based polymers can endow PSCs with great security for sustainable development without the concern of lead ion leakage.

Evolution patterns and spatial sources of water and sediment discharge over the last 70 years in the Yellow River, China: A case study in the Ningxia Reach.

The hydrology and sediment processes in large rivers play important roles in maintaining aquatic and coastal ecosystems and advancing civilization and production in human systems. Therefore, quantitatively analyzing the spatiotemporal variability and dynamics of water and sediment discharge in large rivers is essential for improving watershed management and sustainable development in the areas surrounding rivers, especially the Yellow River, which is one of the most sediment-laden rivers in the world. In this study, we analyzed the evolution patterns and spatial sources of water and sediment discharge in the Yellow River from 1951 to 2020 and determined the impacts of different factors on water and sediment discharge variations. The results showed that the annual water and sediment discharge significantly decreased (p < 0.05) over the past 70 years, with an abrupt change occurring in 1986. The first dominant periodicity of water discharge was approximately 29 years, while the first dominant periodicity of sediment discharge was approximately 28 years. In terms of the water and sediment discharge sources, the dominant factor affecting variations in water discharge was water diversion from 1951 to 2020, while the dominant factor affecting variations in sediment discharge was sediment aggradation from 1951 to 1985 and changed to tributary inflow sediment from 1986 to 2020. In addition, the water and sediment discharge changes were also affected by anthropogenic activities, such as water and sediment diversions, dams and reservoirs, and water and soil conservation measures. In particular, the water and sediment interception capabilities of the established soil and water conservation measures gradually became saturated over time. Specifically, the maximum water and sediment interception capabilities of the current soil and water conservation measures were 12.2 billion m3 and 1.9 Gt, respectively. Overall, the results of the present study can help tailor water and sediment regulation countermeasures in the future.

Elevated CO2 exposure induces core browning in Yali pears by inhibiting the electron transport chain.

Pears may be affected by core browning during storage, reducing their commercial value. The effect of CO2 stress on the core browning process in Yali pears was investigated. Exposure to a 4% CO2 atmosphere significantly increased the core browning and reduced titratable acidity and soluble solids content. The activity of succinate dehydrogenase and peroxidase was reduced in CO2-stressed pears, whereas the levels of H2O2 and malondialdehyde were increased. Transmission electron microscopy revealed significant damage to cellular membrane structure in the core tissues of CO2-stressed pears. In addition, CO2-stressed pears showed increased polyphenol oxidase activity. These results suggest that high concentrations of carbon dioxide can accelerate core browning in pears by inhibiting the activities of enzymes in the electron transport chain, resulting in increased levels of free radicals that damage cellular membranes.

Ionic liquid-based dispersive liquid-liquid microextraction followed by magnetic solid-phase extraction for determination of quinolones.

An ionic liquid-based dispersive liquid-liquid microextraction (IL-DLLME) combined with magnetic solid-phase extraction (MSPE) was developed for extraction of quinolones (quinolones) from honey and milk prior to high-performance liquid chromatography (HPLC) analysis. 1-Butyl-3-methylimidazolium hexafluorophosphate was used as the extraction solvent and an effective adsorbent based on chitosan modified magnetic core-shell functionalized multi-walled carbon nanotube (MWCNTs-Fe3O4@SiO2-CS) nanoparticles was used to assist IL to adsorb quinolone residues in honey and milk samples. Extraction conditions were optimized through one-factor-at-a-time and response surface methodology using a Box-Behnken design. Under optimum conditions satisfactory linearity (R2 > 0.999) and high sensitivity (method limits of quantification were 4-8 µg kg-1 or µg L-1 in honey or milk samples) was achieved. The recoveries of quinolones in honey and milk ranged from 81.2 to 109%. Based on this study, the proposed method was employed for the determination of antibiotic residues in honey and milk samples.

Recent Updates of Natural and Synthetic URAT1 Inhibitors and Novel Screening Methods.

Human urate anion transporter 1 (hURAT1) is responsible for the reabsorption of uric acid in the proximal renal tubules and is a promising therapeutic target for treating hyperuricemia. To mitigate the side effects of URAT1-targeted clinical agents such as benzbromarone, there is significant interest in discovering new URAT1 inhibitors and developing technology that can evaluate URAT1 inhibition. This review summarizes the methods for assay of URAT1 inhibition and the progress on the discovery of natural and synthetic URAT1 inhibitors in the past five years.

An Embedding 2D/3D Heterostructure Enables High-Performance FA-Alloyed Flexible Perovskite Solar Cells with Efficiency over 20.

Flexible perovskite solar cells (f-PSCs) have attracted increasing attention because of their enormous potential for use in consumer electronic devices. The key to achieve high device performance is to deposit pinhole-free, uniform and defect-less perovskite films on the rough surface of polymeric substrates. Here, a solvent engineering to tailor the crystal morphology of FA-alloyed perovskite films prepared by one-step blade coating is first deployed. It is found that the use of binary solvents DMF:NMP, rather than the conventional DMF:DMSO, enables to deposit dense and uniform FA-alloyed perovskite films on both the rigid and flexible substrates. As a decisive step, an embedding 2D/3D perovskite heterostructure is in situ formed by incorporating a small amount of 4-guanidinobutanoic acid (GBA). Accordingly, photovoltage increases up to 100 mV are realized due to the markedly suppressed nonradiative recombination, leading to high efficiencies of 21.45% and 20.16% on the rigid and flexible substrates, respectively. In parallel, improved mechanical robustness of the flexible devices is achieved due to the presence of the embedded 2D phases. The results underpin the importance of morphology control and defect passivation in delivering high-performance flexible FA-alloyed flexible perovskite devices.