Trisomy 12 compromises the mesendodermal differentiation propensity of human pluripotent stem cells.

Trisomy 12 is one of the most frequent chromosomal abnormalities in cultured human pluripotent stem cells (hPSCs). Although potential oncogenic properties and augmented cell cycle caused by trisomy 12 have been reported, the consequences of trisomy 12 in terms of cell differentiation, which is the basis for regenerative medicine, drug development, and developmental biology studies, have not yet been investigated. Here, we report that trisomy 12 compromises the mesendodermal differentiation of hPSCs. We identified sublines of hPSCs carrying trisomy 12 after their prolonged culture. Transcriptome analysis revealed that these hPSC sublines carried abnormal gene expression patterns in specific signaling pathways in addition to cancer-related cell cycle pathways. These hPSC sublines showed a lower propensity for mesendodermal differentiation in embryoid bodies cultured in a serum-free medium. BMP4-induced exit from the self-renewal state was impaired in the trisomy 12 hPSC sublines, with less upregulation of key transcription factor gene expression. As a consequence, the differentiation efficiency of hematopoietic and hepatic lineages was also impaired in the trisomy 12 hPSC sublines. We reveal that trisomy 12 disrupts the genome-wide expression patterns that are required for proper mesendodermal differentiation.

Abnormal glomerular basement membrane maturation impairs mesangial cell differentiation during murine postnatal nephrogenesis.

Although mesangial cell-glomerular basement membrane (GBM) connections play a key role in maintaining the glomerular capillary loop structure, information remains limited about how these connections are formed during glomerulogenesis. We have previously shown that weakened podocyte-GBM interactions owing to tensin 2 (Tns2) deficiency lead to abnormal GBM maturation during postnatal glomerulogenesis. Here, we investigated whether abnormal GBM maturation affected mesangial cell-GBM connections and mesangial cell differentiation. Histological analysis of the outer cortical glomeruli in Tns2-deficient mice revealed that GBM materials overproduced by stressed immature podocytes accumulated in the mesangium and interrupted the formation of mesangial cell-GBM connections, resulting in fewer capillary loops compared with that of normal glomeruli. In addition, expression of α-smooth muscle actin, an immature mesangial cell marker, persisted in mesangial cells of Tns2-deficient outer cortical glomeruli even after glomerulogenesis was completed, resulting in mesangial expansion. Furthermore, analysis of mouse primary mesangial cells revealed that mesangial cell differentiation depended on the type of extracellular matrix components to which the cells adhered, suggesting the participation of mesangial cell-GBM connections in mesangial cell differentiation. These findings suggest that abnormal GBM maturation affects mesangial cell differentiation by impairing mesangial cell-GBM connections.NEW & NOTEWORTHY Mesangial cell-glomerular basement membrane (GBM) connections play an important role in maintaining the structural integrity of the glomerular tuft. However, information remains scarce about how GBM maturation affects the formation of these connections during glomerular development. Here, we show that abnormal GBM maturation due to tensin 2 deficiency affects mesangial cell differentiation by impairing mesangial cell-GBM connections during postnatal glomerulogenesis.

Understanding women's choices for management of cervical intraepithelial neoplasia 2 (CIN2): Qualitative analysis of a randomised experimental study.

BACKGROUND: Active surveillance for cervical intraepithelial neoplasia 2 (CIN2) would allow time for most cases to regress naturally and in turn avoid potentially unnecessary and harmful treatment. AIM: To determine reasons for choosing active surveillance over surgery among women given a hypothetical diagnosis of CIN2. MATERIALS AND METHODS: Women residing in Australia aged 25-40 years with no prior diagnosis of cervical cancer, cervical abnormality CIN2 or above, and/or previous hysterectomy, were randomised to one of four identical hypothetical scenarios of testing human papillomavirus (HPV)-positive: high-grade cytology and a diagnosis of CIN2 that used alternate terminology to describe resolution of abnormal cells and/or inclusion of an overtreatment statement. Participants selected active surveillance or surgery after viewing the scenario and free-text reason/s for their choice were thematically analysed. RESULTS: Of the 1638 women randomised, 79% (n = 1293) opted for active surveillance. The most common reasons for choosing active surveillance included concerns about surgery and associated risks, preferring to 'wait and see', trusting the doctor's recommendations and having an emotional response toward surgery. For women who chose surgery, being risk-averse, addressing the issue straight away and perceiving surgery to be the better option for them were the most common themes identified. CONCLUSION: When presented with balanced information on the benefits and harms of different management options for CIN2 and given a choice, most women in this hypothetical situation chose active surveillance over surgery. Addressing women's concerns about active surveillance may open up the possibility that if deemed safe, it could be an acceptable alternative for women.

Urinary protein analysis in mice lacking major urinary proteins.

Mouse urine contains major urinary proteins (MUPs) that are not found in human urine. Therefore, even healthy mice exhibit proteinuria, unlike healthy humans, making it challenging to use mice as models for human diseases. It was also unknown whether dipsticks for urinalysis could measure protein concentrations precisely in urine containing MUPs. To resolve these problems, we produced MUP-knockout (Mup-KO) mice by removing the Mup gene cluster using Cas9 proteins and two guide RNAs and characterized the urinary proteins in these mice. We measured the urinary protein concentrations in Mup-KO and wild-type mice using a protein quantitation kit and dipsticks. We also examined the urinary protein composition using SDS-PAGE and two-dimensional electrophoresis (2DE). The urinary protein concentration was significantly lower (P<0.001) in Mup-KO mice (17.9 ± 1.8 mg/dl, mean ± SD, n=3) than in wild-type mice (73.7 ± 8.2 mg/dl, n=3). This difference was not reflected in the dipstick values, perhaps due to the low sensitivity to MUPs. This suggests that dipsticks have limited ability to measure changes in MUPs with precision. SDS-PAGE and 2DE confirmed that Mup-KO mice, like humans, had no MUPs in their urine, whereas wild-type mice had abundant MUPs in their urine. The absence of the masking effect of MUPs in 2DE would enable clear comparisons of urinary proteins, especially low-molecular-weight proteins. Thus, Mup-KO mice may provide a useful model for human urinalysis.

Tensin2 is important for podocyte-glomerular basement membrane interaction and integrity of the glomerular filtration barrier.

Tensin2 (Tns2), an integrin-linked protein, is enriched in podocytes within the glomerulus. Previous studies have revealed that Tns2-deficient mice exhibit defects of the glomerular basement membrane (GBM) soon after birth in a strain-dependent manner. However, the mechanisms for the onset of defects caused by Tns2 deficiency remains unidentified. Here, we aimed to determine the role of Tns2 using newborn Tns2-deficient mice and murine primary podocytes. Ultrastructural analysis revealed that developing glomeruli during postnatal nephrogenesis exhibited abnormal GBM processing due to ectopic laminin-α2 accumulation followed by GBM thickening. In addition, analysis of primary podocytes revealed that Tns2 deficiency led to impaired podocyte-GBM interaction and massive expression of laminin-α2 in podocytes. Our study suggests that weakened podocyte-GBM interaction due to Tns2 deficiency causes increased mechanical stress on podocytes by continuous daily filtration after birth, resulting in stressed podocytes ectopically producing laminin-α2, which interrupts GBM processing. We conclude that Tns2 plays important roles in the podocyte-GBM interaction and maintenance of the glomerular filtration barrier.

Analysis of the transgene insertion pattern in a transgenic mouse strain using long-read sequencing.

Transgene insertion patterns are critical for the analysis of transgenic animals because the influence of transgenes may change depending on the insertion pattern (such as copy numbers and orientations of concatenations) and the insertion position in the genome. We previously reported a genomic walking strategy to locate transgenes in the genomes of transgenic mice (Exp. Anim. 53: 103-111, 2004) and to analyze transgene insertion patterns (Exp. Anim. 55: 65-69, 2006). With such strategies, however, we could not determine the copy number of transgenes or global genome modification induced by transgene insertion due to read-length limitation. In this study, we used a long-read sequencer (MinION, Oxford Nanopore Technologies) to overcome this limitation. We obtained 922,210 reads using MinION with genomic DNA from a transgenic mouse strain (4C30, Proc. Jpn. Acad. Ser. B. Phys. Biol. Sci. 87: 550-562, 2011). Among the reads, we found one 21,457-bp read containing the transgene using a local BLAST search. Nucleotide dot plot analysis revealed that the transgene was inserted in the genome as a tandem concatemer with an almost entire construct (15-3,508 of 3,508 bp) and a partial fragment (4-660, 657 bp). Ensembl's BLAST search against the C57BL/6N genome revealed a 9,388-bp deletion at the insertion position in the intron of the Sgcd gene, confirming that mutations such as a large genomic deletion could occur at the time of transgene insertion. Thus, long-read sequencers are useful tools for the analysis of transgene insertion patterns.

C1r/C1s deficiency is insufficient to induce murine systemic lupus erythematosus.

C1s deficiency is strongly associated with the development of human systemic lupus erythematosus (SLE); however, the mechanisms by which C1s deficiency contributes to the development of SLE have not yet been elucidated in detail. Using ICR-derived-glomerulonephritis (ICGN) mouse strain that develops SLE and very weakly expresses C1s in the liver, we investigated the protective roles of C1s against SLE. A genetic sequence analysis revealed complete deletion of the C1s1 gene, a mouse homolog of the human C1s gene, with partial deletion of the C1ra and C1rb genes in the ICGN strain. This deletion led to the absence of C1r/C1s and a low level of C1q in the circulation. In order to investigate whether the C1r/C1s deficiency induces SLE, we produced a congenic mouse strain by introducing the deletion region of ICGN into the C57BL/6 strain. Congenic mice exhibited no C1r/C1s and a low level of C1q in the circulation, but did not have any autoimmune defects. These results suggest that C1r/C1s deficiency is not sufficient to drive murine SLE and also that other predisposing genes exist in ICGN mice.

Essential Role of CARD14 in Murine Experimental Psoriasis.

Caspase recruitment domain family member 14 (CARD14) was recently identified as a psoriasis-susceptibility gene, but its immunological role in the pathogenesis of psoriasis in vivo remains unclear. In this study, we examined the role of CARD14 in murine experimental models of psoriasis induced by either imiquimod (IMQ) cream or recombinant IL-23 injection. In all models tested, the psoriasiform skin inflammation was abrogated in Card14-/- mice. Comparison of the early gene signature of the skin between IMQ-cream-treated Card14-/- mice and Tlr7-/-Tlr9-/- mice revealed not only their similarity, but also distinct gene sets targeted by IL-23. Cell type-specific analysis of these mice identified skin Langerinhigh Langerhans cells as a potent producer of IL-23, which was dependent on both TLR7 and TLR9 but independent of CARD14, suggesting that CARD14 is acting downstream of IL-23, not TLR7 or TLR9. Instead, a bone marrow chimera study suggested that CARD14 in radio-sensitive hematopoietic cells was required for IMQ-induced psoriasiform skin inflammation, controlling the number of Vγ4+ T cells producing IL-17 or IL-22 infiltrating through the dermis to the inflamed epidermis. These data indicate that CARD14 is essential and a potential therapeutic target for psoriasis.

Epstein-Barr virus infection and gene promoter hypermethylation in rheumatoid arthritis patients with methotrexate-associated B cell lymphoproliferative disorders.

We analyzed CpG-island hypermethylation status in 12 genes of paraffin-embedded tissues from 38 rheumatoid arthritis (RA) patients with methotrexate (MTX)-associated large B cell lymphoproliferative disorder (BLPD), 11 RA patients with non-MTX-associated BLPD (non-MTX-BLPD), 22 controls with diffuse large B cell lymphoma (DLBCL), and 10 controls with Epstein-Barr virus (EBV)+ DLBCL. Among them, tumor cells from EBV+ MTX-BLPD patients and control EBV+ DLBCL patients had significantly lower median incidence of CpG island methylator phenotype (CIMP) than those from non-MTX-BLPD and control DLBCL groups (2.3 and 1.7 vs. 4.3 and 4.4; P < 0.01 for each). In the MTX-BLPD group, EBV+ patients showed lower median CIMP than EBV- patients (2.3 vs. 3.2); they also had significantly lower hypermethylation incidence in four apoptosis-related genes, especially death-associated protein kinase (14 vs. 55 %), higher incidence of massive tumor necrosis (86 vs. 27 %), and lower BCL2 protein expression (19 vs. 86 %) than did the control DLBCL group (P < 0.01 for all). In all clinical stages, EBV+ MTX-BLPD patients had better prognoses than the EBV- MTX-BLPD (P = 0.011), non-MTX-BLPD (P = 0.002), and control DLBCL groups (P = 0.015). MTX-BLPD patients without hypermethylated RAS-associated domain family-1A (RASSF1A) or O 6 -methyl guanine-DNA methyltransferase (MGMT) had significantly better prognosis than those with hypermethylation of those genes (P = 0.033). We conclude that in RA patients with MTX-BLPD, EBV infection is associated with a lower incidence of CIMP, apoptosis-related gene hypermethylation, and BCL2 expression, which can induce tumor regression by MTX withdrawal and lead to better prognoses.

Incorrect strain information for mouse cell lines: sequential influence of misidentification on sublines.

Misidentification or cross-contamination of cell lines can cause serious issues. Human cell lines have been authenticated by short tandem repeat profiling; however, mouse cell lines have not been adequately assessed. In this study, mouse cell lines registered with the JCRB cell bank were examined by simple sequence length polymorphism (SSLP) analysis to identify their strains. Based on comparisons with 7 major inbred strains, our results revealed their strains in 80 of 90 cell lines. However, 12 of the 80 cell lines (15%) were found to differ from registered information. Of them, 4 cell lines originated from the same mouse, which had been generated through mating between two different inbred strains. The genotype of the mouse sample had not been examined after the backcross, leading to strain misidentification in those cell lines. Although 8 other cell lines had been established as sublines of a BALB/c cell line, their SSLP profiles are similar to a Swiss cell line. This affects differences in genotypes between inbred and outbred strains. Because the use of inbred samples and interbreeding between strains are not involved in human materials, our results suggest that the cause and influence of misidentification in mouse cell lines are different from those in human.

Parametric analysis of colony morphology of non-labelled live human pluripotent stem cells for cell quality control.

Given the difficulties inherent in maintaining human pluripotent stem cells (hPSCs) in a healthy state, hPSCs should be routinely characterized using several established standard criteria during expansion for research or therapeutic purposes. hPSC colony morphology is typically considered an important criterion, but it is not evaluated quantitatively. Thus, we designed an unbiased method to evaluate hPSC colony morphology. This method involves a combination of automated non-labelled live-cell imaging and the implementation of morphological colony analysis algorithms with multiple parameters. To validate the utility of the quantitative evaluation method, a parent cell line exhibiting typical embryonic stem cell (ESC)-like morphology and an aberrant hPSC subclone demonstrating unusual colony morphology were used as models. According to statistical colony classification based on morphological parameters, colonies containing readily discernible areas of differentiation constituted a major classification cluster and were distinguishable from typical ESC-like colonies; similar results were obtained via classification based on global gene expression profiles. Thus, the morphological features of hPSC colonies are closely associated with cellular characteristics. Our quantitative evaluation method provides a biological definition of 'hPSC colony morphology', permits the non-invasive monitoring of hPSC conditions and is particularly useful for detecting variations in hPSC heterogeneity.

Tensin2-deficient mice on FVB/N background develop severe glomerular disease.

Tensin2 (Tns2) is an essential component for the maintenance of glomerular basement membrane (GBM) structures. Tns2-deficient mice were previously shown to develop mild glomerular injury on a DBA/2 background, but not on a C57BL/6J or a 129/SvJ background, suggesting that glomerular injury by the deletion of Tns2 was strongly dependent on the genetic background. To further understand the mechanisms for the onset and the progression of glomerular injury by the deletion of Tns2, we generated Tns2-deficient mice on an FVB/N (FVB) strain, which is highly sensitive to glomerular disease. Tns2-deficient mice on FVB (FVBGN) developed severe nephrotic syndrome, and female FVBGN mice died within 8 weeks. Ultrastructural analysis revealed that FVBGN mice exhibited severe glomerular defects with mesangial process invasion of glomerular capillary tufts, lamination and thickening of the GBM and subsequent podocyte foot process effacement soon after birth. Aberrant laminin components containing α1, α2 and ß1 chains, which are normally expressed in the mesangium, accumulated in the GBM of FVBGN, suggesting that these components originated from mesangial cells that invaded glomerular capillary tufts. Compared to Tns2-deficient mice on the other backgrounds in previous reports, FVBGN mice developed earlier onset of glomerular defects and rapid progression of renal failure. Thus, this study further extended our understanding of the possible genetic background effect on the deterioration of nephrotic syndrome by Tns2 deficiency.

Clinicopathological characteristics and rituximab addition to cytotoxic therapies in patients with rheumatoid arthritis and methotrexate-associated large B lymphoproliferative disorders.

AIMS: To analyse the clinicopathological characteristics and prognosis of 40 rheumatoid arthritis (RA) patients with methotrexate (MTX)-associated large B cell lymphoproliferative disorders (MTX-BLPD). METHODS AND RESULTS: Soluble interleukin 2 receptor titres (median 1500 U/ml) in 40 patients with MTX-BLPD were lower than those of 24 RA patients with non-MTX- associated (non-MTX) BLPD (5731 U/ml) and 15 with control diffuse large B cell lymphoma (DLBCL, 5918 U/ml) (P < 0.01). Using in-situ hybridization, Epstein-Barr virus (EBV) was detected in tumour cells of 25 of 40 RA patients with MTX-BLPD (63%). Immunohistologically, BCL2 expression was detected in 35% of patients with MTX-BLPD, which was lower than 93% of control DLBCL patients (P < 0.01). Eleven patients with EBV(+) MTX-BLPD (44%) showed remission after MTX withdrawal. In RA patients with clinical stage III/IV BLPD, 15 with rituximab (R)+ cytotoxic therapies pursued better prognosis than 10 with R- cytotoxic therapies (P < 0.05). Among the 15 patients, seven with MTX-BLPD showed better overall survival than nine control DLBCL patients (P < 0.01). CONCLUSIONS: In RA patients with MTX-BLPD, immunosuppression by MTX, EBV infection and low BCL2 expression in tumour cells may play roles in tumorigenesis and tumour regression. R+ cytotoxic therapies as well as MTX withdrawal were highly effective in these patients.

Detailed clinicopathological characteristics and possible lymphomagenesis of type II intestinal enteropathy-associated T-cell lymphoma in Japan.

Twenty-six Japanese cases of type II enteropathy-associated T-cell lymphoma (EATL) were examined. Multiple tumors throughout the small intestine were found in 15 patients (58%) and duodenal and colonic mucosal lesions in 8 and 6 cases, respectively. Histologically, intramucosal tumor spread and a zone of neoplastic intraepithelial lymphocytes (IELs) neighboring the main transmural tumors were detected in 20 (91%) and 17 (77%) of the 22 cases examined, respectively. Inside and outside the IEL zone, some degree of enteropathy with many reactive small IELs and villous atrophy was detected in 11 cases (50%). Immunohistologically, many CD56/CD8-positive small IELs were found in the enteropathic lesions of 4 (36%) and 7 (64%) of these 11 cases. Lymphoma cells expressed tyrosine kinase receptor c-Met, serial phosphorylated (p)-mitogen-activated protein kinase/extracellular signal-regulated kinase, c-Myc, and Bcl2 in 18 (78%), 21 (91%), 11 (42%), and 19 (73%) of the total cases, respectively. By fluorescence in situ hybridization, chromosomal loci 7q31 (c-Met) and 8q24 (c-Myc) were amplified in 11 (65%) and 12 (71%) of the 17 cases analyzed. Gain of 7q31 and c-Met expression were significantly (P < .01) higher than in peripheral CD8-positive T-cell or CD56-positive natural killer-cell lymphomas. Enteropathy was seen near the IEL zone in type II EATL, and activation of the c-Met, mitogen-activated protein kinase/extracellular signal-regulated kinase-mitogen-activated protein kinase pathway, and c-Myc-Bcl2-mediated cell survival may play important roles in lymphomagenesis, converting enteropathy to type II EATL. Seven cases in the early clinical stages I and II-1 showed significantly (P < .01) better prognoses than did those in the advanced stages. Early detection of the mucosal lesions and tumors may improve patient prognosis.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Tenc1-deficient mice develop glomerular disease in a strain-specific manner.

BACKGROUND/AIMS: Tenc1 (also known as tensin2) is an integrin-associated focal adhesion molecule that is broadly expressed in mouse tissues including the liver, muscle, heart and kidney. A mouse strain carrying mutated Tenc1, the ICR-derived glomerulonephritis (ICGN) strain, develops severe nephrotic syndrome. METHODS: To elucidate the function of Tenc1 in the kidney, Tenc1(ICGN) was introduced into 2 genetic backgrounds, i.e. DBA/2J (D2) and C57BL/6J (B6), strains that are respectively susceptible and resistant to chronic kidney disease. RESULTS: Biochemical and histological analysis revealed that homozygous Tenc1(ICGN) mice develop nephrotic syndrome on the D2 background (D2GN) but not on the B6 background (B6GN). Initially, abnormal assembly and maturation of glomerular basement membrane (GBM) were observed, and subsequently effacement of podocyte foot processes was noted in the kidneys of D2GN but not B6GN mice. These defects are likely to be involved in the integrin signaling pathway. CONCLUSION: This study suggests that Tenc1 contributes to the maintenance of GBM structures and that the genetic background influences the severity of nephrotic syndrome.

Gene expression analysis detected a low expression level of C1s gene in ICR-derived glomerulonephritis (ICGN) mice.

BACKGROUND: ICR-derived glomerulonephritis (ICGN) strain is a novel inbred strain of mice with a hereditary nephrotic syndrome. Deletion mutation of tensin 2 (Tns2), a focal adhesion molecule, has been suggested to be responsible for nephrotic syndrome in ICGN mice; however, the existence of other associative factors has been suggested. METHODS AND RESULTS: To identify additional associative factors and to better understand the onset mechanism of nephrotic syndrome in ICGN mice, we conducted a comprehensive gene expression analysis using DNA microarray. Immune-related pathways were markedly altered in ICGN mice kidney as compared with ICR mice. Furthermore, the gene expression level of complement component 1, s subcomponent (C1s), whose human homologue has been reported to associate with lupus nephritis, was markedly low in ICGN mouse kidney. Real-time quantitative reverse transcription-polymerase chain reaction confirmed a low expression level of C1s in ICGN mouse liver where the C1s protein is mainly synthesized. A high serum level of anti-dsDNA antibody and deposits of immune complexes were also detected in ICGN mice by enzyme-linked immunosorbent assay and immunohistochemical analyses, respectively. CONCLUSION: Our results suggest that the immune system, especially the complement system, is associated with nephrotic syndrome in ICGN mice. We identified a low expression level of C1s gene as an additional associative factor for nephrotic syndrome in ICGN mice. Further studies are needed to elucidate the role of the complement system in the onset of nephrotic syndrome in ICGN mice.

Mature T/NK-cell lymphoproliferative disease and Epstein-Barr virus infection are more frequent in patients with rheumatoid arthritis treated with methotrexate.

We retrospectively analyzed in 54 consecutively enrolled Japanese patients with rheumatoid arthritis (RA) and lymphoproliferative disease (LPD) relevant clinicopathological characteristics, in particular paying attention to treatment with methotrexate (MTX). Between the 28 patients treated with MTX (MTX-treated group) and the 26 who were not (non-MTX group), there was no difference in age, interval between onset of RA and LPD, and lymphoma stage. Immunohistochemical analysis showed that in the MTX-treated group, 15 (53 %) patients had mature B-cell LPD, eight (29 %) mature T/NK-cell LPD, and five (18 %) had Hodgkin lymphoma. In the non-MTX group, 22 (84 %) had mature B-cell LPD, 2 (8 %) had mature T/NK-cell LPD, and 2 (8 %) had Hodgkin lymphoma. The frequency of mature T/NK-cell LPD was significantly higher in the MTX-treated group (p < 0.05). Of the eight patients in the MTX-treated group with mature T/NK-cell LPD, two had large granular lymphocytic leukemia and the other six had a variety of different histological types with frequent CD8 but not CD56 expression. Epstein-Barr virus (EBV) infection was significantly higher in the MTX-treated group (p < 0.05); evidence of latent type II EBV infection was found in four of the eight patients with mature T/NK-cell LPD. Withdrawal of MTX led to complete remission in seven patients with mature T/NK-cell LPD irrespective of EBV infection. Our findings highlight that mature T/NK-cell LPD is a frequent complication in RA patients treated with MTX. EBV infection may play a role in the pathogenesis of T/NK-cell LPD, as well as B-cell LPD and Hodgkin lymphoma in MTX-treated RA patients.

Protein kinase C regulates human pluripotent stem cell self-renewal.

BACKGROUND: The self-renewal of human pluripotent stem (hPS) cells including embryonic stem and induced pluripotent stem cells have been reported to be supported by various signal pathways. Among them, fibroblast growth factor-2 (FGF-2) appears indispensable to maintain self-renewal of hPS cells. However, downstream signaling of FGF-2 has not yet been clearly understood in hPS cells. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we screened a kinase inhibitor library using a high-throughput alkaline phosphatase (ALP) activity-based assay in a minimal growth factor-defined medium to understand FGF-2-related molecular mechanisms regulating self-renewal of hPS cells. We found that in the presence of FGF-2, an inhibitor of protein kinase C (PKC), GF109203X (GFX), increased ALP activity. GFX inhibited FGF-2-induced phosphorylation of glycogen synthase kinase-3ß (GSK-3ß), suggesting that FGF-2 induced PKC and then PKC inhibited the activity of GSK-3ß. Addition of activin A increased phosphorylation of GSK-3ß and extracellular signal-regulated kinase-1/2 (ERK-1/2) synergistically with FGF-2 whereas activin A alone did not. GFX negated differentiation of hPS cells induced by the PKC activator, phorbol 12-myristate 13-acetate whereas Gö6976, a selective inhibitor of PKCα, ß, and γ isoforms could not counteract the effect of PMA. Intriguingly, functional gene analysis by RNA interference revealed that the phosphorylation of GSK-3ß was reduced by siRNA of PKCδ, PKCε, and ζ, the phosphorylation of ERK-1/2 was reduced by siRNA of PKCε and ζ, and the phosphorylation of AKT was reduced by PKCε in hPS cells. CONCLUSIONS/SIGNIFICANCE: Our study suggested complicated cross-talk in hPS cells that FGF-2 induced the phosphorylation of phosphatidylinositol-3 kinase (PI3K)/AKT, mitogen-activated protein kinase/ERK-1/2 kinase (MEK), PKC/ERK-1/2 kinase, and PKC/GSK-3ß. Addition of GFX with a MEK inhibitor, U0126, in the presence of FGF-2 and activin A provided a long-term stable undifferentiated state of hPS cells even though hPS cells were dissociated into single cells for passage. This study untangles the cross-talk between molecular mechanisms regulating self-renewal and differentiation of hPS cells.

Primary splenic histiocytic sarcoma complicated with prolonged idiopathic thrombocytopenia and secondary bone marrow involvement: a unique surgical case presenting with splenomegaly but non-nodular lesions.

A 67-year-old Japanese female was followed up due to prolonged idiopathic thrombocytopenia with non-response to steroid therapy for 4 years, but recent progressive pancytopenia, hypo-albuminemia, and hypo-γ-globulinemia were presented. An abdominal CT scan revealed heterogeneously enhanced splenomegaly without any nodular lesions. A splenectomy was performed, and gross examination showed markedly hyperemic red pulp, weighing 760 g, accompanied by multiple foci of peripheral anemic infarction. Surprisingly, microscopic findings exhibited a diffuse proliferation of medium-sized to large tumor cells having pleomorphic nuclei, prominent nucleoli, and abundant eosinophilic cytoplasm, predominantly within the sinuses and cords of the red pulp, which occasionally displayed conspicuous hemophagocytosis and vascular permeation. In immunohistochemistry, these atypical cells were specifically positive for CD68 (KP-1), CD163, and lysozyme, which was consistent with histiocytic sarcoma (HS) of the spleen. Subsequently, section from the aspiration of bone marrow showed infiltration of the neoplastic cells associated with erythrophagocytosis 2 months after the operation, but never before it. Therefore, primary splenic HS presenting with secondary bone marrow involvement was conclusively diagnosed. Since early diagnosis and treatment are necessary for the HS patients with poor outcomes, splenic HS should be considered as a differential diagnosis in cases with chronic thrombocytopenia and splenomegaly. VIRTUAL SLIDES: The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1009474924812827.