Regulation of IFN signaling is critical in host recognition and response to pathogens while its dysregulation underlies the pathogenesis of several chronic diseases. STimulator of IFN Genes (STING) has been identified as a critical mediator of IFN inducing innate immune pathways, but little is known about direct coregulators of this protein. We report here that TMEM203, a conserved putative transmembrane protein, is an intracellular regulator of STING-mediated signaling. We show that TMEM203 interacts, functionally cooperates, and comigrates with STING following cell stimulation, which in turn leads to the activation of the kinase TBK1, and the IRF3 transcription factor. This induces target genes in macrophages, including IFN-ß. Using Tmem203 knockout bone marrow-derived macrophages and transient knockdown of TMEM203 in human monocyte-derived macrophages, we show that TMEM203 protein is required for cGAMP-induced STING activation. Unlike STING, TMEM203 mRNA levels are elevated in T cells from patients with systemic lupus erythematosus, a disease characterized by the overexpression of type I interferons. Moreover, TMEM203 mRNA levels are associated with disease activity, as assessed by serum levels of the complement protein C3. Identification of TMEM203 sheds light into the control of STING-mediated innate immune responses, providing a potential novel mechanism for therapeutic interventions in STING-associated inflammatory diseases.
Inflammation/metabolism , Macrophages/metabolism , Macrophages/pathology , Membrane Proteins/metabolism , Signal Transduction , Conserved Sequence , Down-Regulation , Evolution, Molecular , HeLa Cells/metabolism , Humans , Inflammation/pathology , Interferon Regulatory Factor-3/metabolism , Interferon Type I/metabolism , Lupus Erythematosus, Systemic/metabolism , Lupus Erythematosus, Systemic/pathology , Lysosomes/metabolism , Membrane Proteins/chemistry , Membrane Proteins/genetics , Nucleotides, Cyclic/metabolism , Protein Binding , Protein Domains , Protein Serine-Threonine Kinases/metabolism , RNA, Messenger/genetics , RNA, Messenger/metabolism , Stromal Interaction Molecule 1/metabolism
Objective: To study the effect of titanium dioxide (TiO2) nanoparticles on intestinal glucose absorption in young rats and its size effect.Methods: In the study, 63 small intestine segments were isolated from 63 Sprague-Dawley rats (SD rats, 4-week-old) to prepare the everted gut sac model.In the first part of our work, the everted sacs were exposed to 0, 50 mg/L TiO2 nanoparticles (24 nm) for 2 h with the presence of a series of glucose concentrations (10, 25, 50, 100, 200, 400, and 800 mmol/L), and the glucose absorbing function of the everted sacs were assessed in the process.On the basis of the work, utilizing the same method, further study was carried out to compare the effects of TiO2 nanoparticles (24 nm) and fine-particles (120 nm) on intestinal glucose absorbing function with the presence of 400 mmol/L glucose and 0, 10, 50, 200 mg/L TiO2.3 intestine segments were used in each group.Results: The cumulative glucose absorption increased with time extension and increased glucose concentration.In the first part of our work, with the presence of 400 mmol/L glucose, the group treated with 50 mg/L TiO2 nanoparticles showed significantly lower cumulative glucose absorption and glucose absorbing rate than the control group at the exposure time of 30 min (tcumulative absorption=3.254, P<0.05;tglucose absorbing rate=3.958, P<0.05), 90 min (tcumulative absorption=3.323, P<0.05;tglucose absorbing rate=3.063, P<0.05) and 120 min (tcumulative absorption=2.834, P<0.05;tglucose absorbing rate=3.002, P<0.05).At other glucose concentrations, statistically significant differences in cumulative glucose absorption or glucose absorbing rates were not found between the TiO2 nanoparticle exposed group and the control group.In the second part of our work, when compared with the control group, no significant downregulations in cumulative glucose absorption or glucose absorbing rates were observed in both TiO2 nano-particle treated group and TiO2 fine particle treated group.Differences between the TiO2 nanoparticle treated group and the TiO2 fine particle treated group were not statistically significant.Conclusion: Short-term exposure to TiO2 nanoparticles may downregulate the intestinal glucose absorbing function in young rats, and the difference with TiO2 fine particlesis is not obvious.
Objective Salidroside is a major active component of integripetal rhodiola herbal medicine, which has a significant activity against hypoxia and ischemia.This study was to investigate the effects of side chain carbon losssalidroside analogues (N04) on the expressions of HIF-1α-related factors in the hypoxia-injured EAhy926 human vascular endothelial cells.Methods EAhy926 human umbilical vein endothelial cells in the logarithmic growth phase were randomly divided into a normal control, a hypoxia model control, a salidroside, a high-dose N04, a medium-dose N04, and a low-dose N04 group.The hypoxia model was established by depriving the culture medium of sugar and serum and culturing the EAhy926 cells in an environment of 95%N2+5%CO2 for 2 hours, followed by intervention with salidroside at 1×10-6 mol/L and N04 at 1×10-6, 1×10-7, and 1×10-8 mol/L, respectively.Then, the activity of the cells was detected by MTT assay, their LDH activity examined by spectrophotometry, the mRNA expressions of HIF-1α and VEGF measured by RT-PCR, the protein expressions of HIF-1α, VEGF and pVHL determined by Western blot, and the activity of eNOS measured by ELISA.Results Compared with the normal control group, the hypoxia model cells showed significantly reduced activity (0.51±0.05 vs 0.27±0.02, P<0.01), an elevated LDH level ([6.65±1.43] vs [78.82±2.33] U/L, P<0.01), and decreased eNOS activity ([1.56±0.23] vs [1.16±0.20] U/100 mL, P<0.01).In comparison with the hypoxia model group, the cells treated with high-, medium-, and low-dose N04 exhibited remarkably increased activity (0.27±0.02 vs 0.0.42±0.05, 0.40±0.03 and 0.37±0.04, P<0.01), a reduced LDH level ([78.82±2.33] vs [53.05±3.90], [58.42±4.45] and [62.73±3.63] U/L, P<0.01), and increased eNOS activity ([1.16±0.20] vs [3.01±0.47], [2.60±0.26] and [2.32±0.29] U/100 mL, P<0.01).The activity of eNOS was also increased in the salidroside group ([2.32±0.29] U/100 mL, P<0.01).The cell activity in the high-and medium-dose N04 groups was markedly higher than that in the salidroside group (P<0.05), and so was the eNOS activity in the high-dose N04 group and the LDH level in the medium-and low-dose N04 groups (P<0.05).In comparison with the normal control group, the expressions of HIF-1α mRNA, HIF-1α protein and VEGF protein were significantly up-regulated in the hypoxia model group (P<0.01) while that of the pVHL protein markedly down-regulated (P<0.01).Compared with the hypoxia model group, the expressions of HIF-1α mRNA, HIF-1α protein and VEGF protein were remarkably reduced (P<0.05), while that of the pVHL protein markedly elevated (P<0.05).Both the expressions of VEGF mRNA and HIF-1α protein were significantly lower in the medium-and low-dose N04 groups than in the salidroside group (P<0.05).Conclusion N04 can protect vascular endothelial cells against hypoxia-induced injury by regulating the expression of HIF-1α-related factors and eNOS.
Objective To investigate the distribution of ideal cardiovascular health status in Chinese health checkup population. Methods Subjects were enrolled from a health checkup population coming to the PLA health management center from Sept 2009 to Mar 2016. Modified with China's specifications, lifestyle and checkup data were collected and analyzed according to the American ideal cardiovascular health standard. Results A total of 37664 people were included in the study, of whom 72.88%were male and 27.12%were female. Comprehensive analysis showed that, among 7 health indicators including smoking, physical activity, diet, fasting blood glucose, blood pressure, total cholesterol and body mass index, there were only 43 subjects (0.11%) whose lifestyle reached the ideal cardiovascular health status, 11 subjects were in the poor cardiovascular health status, accounting for 0.03%. The rest of the subjects were in the intermediate levels of cardiovascular health status. There was a large gap between the daily diet intake and the dietary recommendation, and there was also a large gap between the actual level physical activity and the ideal level of physical activity recommended by related guidelines, indicating that unhealthy diet and inadequate physical activity are two bottleneck factors. Dairy product intake has the lowest satisfaction ratio, followed by vegetable and fruit intake. Most subjects (94.10%) showed insufficient physical activity. The percentage of three status of cardiovascular health among young, middle-aged and elderly subjects differed significantly (χ2=1200, P=0.000), and presented an increasing trend of ideal cardiovascular health and a declining trend of poor cardiovascular health status with age from youth to middle age, to the elderly, which reflected insufficient physical activity especially among the young people, and then the middle-aged. Meanwhile, the proportion of ideal cardiovascular health in men was higher than that in women. Conclusion The rate of ideal cardiovascular health is relatively low in the study population, unhealthy diet and inadequate physical activity are two bottleneck factors. Encouraging people to develop good eating and exercise habits might be the most effective method to improve population's ideal cardiovascular health status.
Objective@#To evaluate the applicability of quantitative grading method (GBZ/T 229.1-2010) and occupational hazard risk index method in coal dust occupational health risk assessment.@*Methods@#Taking 4 coal mines as the research object of risk assessment and making occupational health field testing and investigation. Based on two risk assessment methods, we analysed the health risk levels of 20 occupations which were exposed to coal dust in workplaces.@*Results@#Coal dust working post had different risk levels in 4 coal mines, the post of higher risk level were mainly concentrated in the underground workplace of coal mine, especially the post of coal mining and tunneling system. The two risk assessment results showed that the risk levels of coal-mining machine drivers and tunneling machine drivers were the highest. The risk levels of coal dust working post used by two risk assessment methods had no significant difference (P>0.05) and were highly correlated (r=0.821, P<0.001) . Evaluation results of two risk assessment methods were supported by the field investigation and literatures.@*Conclusion@#The two risk assessment methods can be used in coal dust occupational health risk assessment.
<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>
Adult , Aged , Female , Humans , Male , Middle Aged , Genes, Neurofibromatosis 2 , Mutation , Neurilemmoma , Genetics , Spinal Cord Neoplasms , Genetics
Since its introduction as an alternative intestinal microbiota alteration approach, fecal microbiota transplantation (FMT) has been increasingly used as a treatment of choice for patients with ulcerative colitis (UC), but no reports exist regarding FMT via percutaneous endoscopic cecostomy (PEC). This report describes the case of a 24-year-old man with a 7-year history of recurrent, steroid-dependent UC. He received FMT via PEC once per day for 1 month in the hospital. After the remission of gastrointestinal symptoms, he was discharged from the hospital and continued FMT via PEC twice per week for 3 months at home. The frequency of stools decreased, and the characteristics of stools improved soon thereafter. Enteral nutrition was regained after 1 week, and an oral diet was begun 1 month later. Two months after the FMT end point, the patient resumed a normal diet, with formed soft stools once per day. The follow-up colonoscopy showed normal mucus membranes; then, the PEC set was removed. On the subsequent 12 months follow-up, the patient resumed orthobiosis without any gastrointestinal discomfort and returned to work. This case emphasizes that FMT via PEC can not only induce remission but also shorten the duration of hospitalization and reduce the medical costs; therefore, this approach should be considered an alternative option for patients with UC.
Humans , Young Adult , Cecostomy , Colitis, Ulcerative , Colonoscopy , Diet , Enteral Nutrition , Fecal Microbiota Transplantation , Follow-Up Studies , Gastrointestinal Microbiome , Hospitalization , Membranes , Mucus , Ulcer
The mitogen-activated protein kinases (MAPKs) are key regulators of cell growth and survival in physiological and pathological processes. Aberrant MAPK signaling plays a critical role in the development and progression of human cancer, as well as in determining responses to cancer treatment. The MAPK phosphatases (MKPs), also known as dual-specificity phosphatases (DUSPs), are a family of proteins that function as major negative regulators of MAPK activities in mammalian cells. Studies using mice deficient in specific MKPs including MKP1/DUSP1, PAC-1/DUSP2, MKP2/DUSP4, MKP5/DUSP10 and MKP7/DUSP16 demonstrated that these molecules are important not only for both innate and adaptive immune responses, but also for metabolic homeostasis. In addition, the consequences of the gain or loss of function of the MKPs in normal and malignant tissues have highlighted the importance of these phosphatases in the pathogenesis of cancers. The involvement of the MKPs in resistance to cancer therapy has also gained prominence, making the MKPs a potential target for anti-cancer therapy. This review will summarize the current knowledge of the MKPs in cancer development, progression and treatment outcomes.
Animals , Humans , Mice , Dual-Specificity Phosphatases , Homeostasis , Mitogen-Activated Protein Kinase Phosphatases , Mitogen-Activated Protein Kinases , Pathologic Processes , Phosphoric Monoester Hydrolases
<p><b>OBJECTIVE</b>To observe the effects of warm needling moxibustion on body mass, knee cartilage andmorphology in rats with knee osteoarthritis (KOA).</p><p><b>METHODS</b>Forty SD rats were randomly divided into a normalgroup, a model group, a medication group and a warm needling group, 10 rats in each one. Except the normalgroup, the rats in the remaining three groups were injected with papain to establish the model of KOA. After themodeling, rats in the model group did not receive any treatment; rats in the warm needling group were treated withwarm needling moxibustion at bilateral "Xiqian"; rats in the medication group were treated with intragastric administration of meloxicam; rats in the normal group were treated with 0. 9% NaCl solution (identical dose as medication group) and immobilized as the warm needling group. The treatment was given once a day for consecutive20 days. The body mass, scale of knee cartilage and morphological changes were observed in each group after'treatment.</p><p><b>RESULTS</b>The increasing of body mass in the medication group and warm needling group was faster than!that in the model group, but slower than that in the normal group (all P<0. 05); the difference between medication group and warm needling group was not statistically significant (P>0. 05). The scale of knee cartilage in thewarm needling group and medication group was significantly lower than that in the model group (both P<0. 05),while the scale in the warm needling group was lower than that in the medication group (P<. 05). Regarding theknee morphology under micro-CT, the relief of knee degeneration and improvement of knee recovery in the warm needlinggroup were superior to those in the medication group.</p><p><b>CONCLUSION</b>The warm needling moxibustion could effectively reduce the knee pain, improve the recovery of knee cartilage, which is a safe and effective treatment.</p>
Animals , Humans , Male , Rats , Acupuncture Points , Cartilage , Disease Models, Animal , Knee Joint , Moxibustion , Osteoarthritis, Knee , Therapeutics , Rats, Sprague-Dawley , Treatment Outcome
In order to find the most suitable algorithm of T-wave end point detection for clinical detection, we tested three methods, which are not just dependent on the threshold value of T-wave end point detection, i. e. wavelet method, cumulative point area method and trapezium area method, in PhysioNet QT database (20 records with 3 569 beats each). We analyzed and compared their detection performance. First, we used the wavelet method to locate the QRS complex and T-wave. Then we divided the T-wave into four morphologies, and we used the three algorithms mentioned above to detect T-wave end point. Finally, we proposed an adaptive selection T-wave end point detection algorithm based on T-wave morphology and tested it with experiments. The results showed that this adaptive selection method had better detection performance than that of the single T-wave end point detection algorithm. The sensitivity, positive predictive value and the average time errors were 98.93%, 99.11% and (--2.33 ± 19.70) ms, respectively. Consequently, it can be concluded that the adaptive selection algorithm based on T-wave morphology improves the efficiency of T-wave end point detection.
Humans , Algorithms , Electrocardiography , Wavelet Analysis
BACKGROUND:Studies have shown that the non-surgical therapy for knee osteoarthritis is exactly effective, but there is a lack of scientific and rational evaluation system. OBJECTIVE:To review the evaluation methods of non-surgical therapy for knee osteoarthritis in recent 5 years. METHODS:A computer-based retrieval of PubMed, WOK, CNKI, VIP, Wanfang databases was performed to find literature related to the evaluation methods of non-surgical therapy for knee osteoarthritis. Al data were primarily screened to exclude irrelevant literature. Those literatures about the evaluation methods of non-surgical therapy for knee osteoarthritis were included. Repetitive studies and untypical reports were excluded. RESULTS AND CONCLUSION:Total y 42 articles were col ected, including 28 in Chinese and 14 in English. The analysis results showed that the non-surgical treatment for knee osteoarthritis can improve knee function and the quality of life in patients, and have an exact effect and a good economic benefit. Therefore, exploring a scientific and reasonable evaluation method to guide the choice of clinical treatment for knee osteoarthritis is greatly significant, which can improve the efficacy of non-surgical therapy for knee osteoarthritis. Scale-based evaluation method is simple and practical, but the presence of a single scale has a lack of objectivity. The method of biomechanics or imaging has the advantages of objective, highly reliable, accurate, non-invasive and so on. In the future therapeutic evaluation system, the combination of subjective scale observation and objective indicators should be more recommended, and the evaluation methods of non-surgical therapy for knee osteoarthritis should be selected appropriately based on the difference of clinical therapy and effect.
Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P < 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.
Objective To evaluate the detection rate of congenital heart defect (CHD) during the first trimester screening for chromosomal abnormalities,the role of ultrasound soft markers including increased nuchal translucency (NT),tricuspid regurgitation (TR) and abnormal ductus venosus (DV) flow in the screening for cardiac anomalies was also investigated.Methods From January 2009 to January 2012,4 673 fetuses were scanned at 11-14 weeks at Department of Fetal Medicine,the First Affiliated Hospital of Jinan University.The ultrasound findings and follow up outcomes were recorded,False-positive rate of different first-trimester ultrasound markers for the detection of CHD was calculated,sensitivity of the markers for all major CHD was calculated as well.Results There was a significant association between major CHD and first trimester ultrasound markers.(1) Overall findings:among the 4 673 fetuses,31 fetuses were diagnosed CHD prenatally,17,12 and 2 of which were detected in the first,second and third trimester,respectively.In 22 of the 31 CHD cases,invasive procedure was performed,fetal karyotype was abnormal in 12 cases,including triosmy 21 (5 cases),trisomy 18 (2 cases),trisomy 13 (2 cases),Turner syndrome (2 cases) and pericentric inversion of chromosome 9 (1 cases).(2) NT measurement and prenatal detected CHD:in 4 673 cases,NT measurement between 95th-99th percentile were present in 206 (4.41%),5 cases were diagnosed CHD prenatally,in 4 of 5 cases were detected in first trimester; NT measurement < 95th percentile were present in 4 430(94.80%),16 cases were diagnosed CHD prenatally,in 5 of 16 cases were detected in first trimester; NT measurement > 99th percentile (> 3.5 mm) were present in 37 (0.79%,37/4 673),10 cases were diagnosed CHD prenatally,in 8 of 10 cases were detected in first trimester.(3) TR and inverted a-wave at the DV and prenatal detected CHD:among 4 673 cases,TR or inverted a-wave at the DV were present in 51 (1.09%),98 (2.10%) respectively.TR was present in 8 of 31 CHD cases,inverted a-wave at the DV was present in 7 of 31 CHD cases.(4)Sensitivity of different first trimester ultrasound markers for detection of major CHD cases:in 31 CHD cases diagnosed prenatally,23 eased were defined as major CHD.Sensitivity of at least one of the ultrasound narkers,NT measurement between 95th-99th percentile,> 99th percentile(> 3.5 mm),TR or inverted a-wave at the DV for detection of major CHD eases was 74% (17/23),22% (5/23),39% (9/23),35% (8/23),30% (7/23),respectively.(5) Specificity of different first trimester ultrasound markers for detection of CHD cases:specificity of NT measurement between 95th-99th percentile,> 99th percentile(> 3.5 mm),TR or inverted a-wave at the DV for detection of major CHD cases was 4.30% (201/4 673),0.58% (27/4 673),0.92% (43/4 673),1.94% (91/4 673).Conclusions Routine first trimester soft markers for chromosomal abnormalities screening combined with cardiac assessment can detect quite a number of major heart defects.Increased NT,TR and abnormal DV flow can be important indicators for echocardiography,which is favorable to early prenatal diagnosis of CHD.
Objective To study in vitro the inhibitory effects and mechanisms of N-butanol extract of Potentilla anserine L.(NP)against hypoxia-induced nitric oxide(NO)in hippocampus neuron of rats. Methods The models of hippocampus neurons hypoxia injury of Sprague-Dawley(SD)neonatal rats were cultured in vitro. The cultured hippocampus neurons were divided randomly into blank control group, hypoxia injury model group, nimodipine group(2 μmol/L)and NP high(250.0 mg/L),middle(62.5 mg/L),low(15.6 mg/L)dose groups. The activities of hippocampus neurons were examined by methyl thiazolyl tetrazolium(MTT)assay,and meanwhile their contents of nitrogen monoxidum(NO)were detected. Half quantity reverse transcription-polymerase chain reaction(RT-PCR)and Western blotting were used to detect neuronal nitric oxide synthetase(nNOS)mRNA and protein expression levels respectively in each group,immunocytochemistry stain was used to detect protein positive rate. Results Compared with blank control group,the activity of neuron〔absorbance(A)value〕was significantly decreased(0.0826±0.0095 vs. 0.3315±0.0105),content of NO(μmol/g:0.0509±0.0027 vs. 0.0291±0.0032), the expression levels of nNOS mRNA (0.1463±0.0081 vs. 0.0801±0.0058), the positive rate of nNOS〔(74.4238±3.9423)%vs.(28.3714±4.1361)%〕,the expression levels of nNOS protein(A value:1.9130±0.0471 vs. 0.5068±0.0368)were all significantly increased in the hypoxia injury model group(all P0.05). Conclusions NP can ameliorate the injury of rat hippocampus neurons induced by hypoxia in vitro. The possible mechanisms might be related to the effective inhibition of the synthesis of nNOS and NO excessive generation.
Objective To investigate the clinical values of multiple ultrasound soft markers in screening for fetal chromosomal abnormality during first-trimester.Methods Two thousand seven hundred and eighty-nine nulliparas in Department of Obstetrics,the First Affiliated Hospital of Jinan University during early pregnancy (11-13+6 gestational weeks) were selected for this study.Fetalnuchal translucency (NT),facial angle (FA),ductus venosus (DV),fetal heart rate (FHR),tricuspid reverse (TR),nasal bone (NB) and fetal structures were scanned and measured.Risk calculation software (Astraia) was used to calculate the chromosomal abnormal risk (cut-off line:>1/300) based on ultrasound records.The chorionic villi or amniotic fluid of high risk patients was collected with informed consent for karyotype analysis (prenatal diagnosis).All patients were followed up until six months after delivery.Chi-square test or Fisher exact test was used to compare the difference.Results One hundred and seven cases were high-risk of trisomy 21 among which 96 cases accepted invasive prenatal diagnosis.Sixteen chromosomal anomaly and six trisomy 21 cases were diagnosed out the 96 fetuses.Among 2789 cases,four were high-risk of trisomy 21 according to ultrasound screening.Six cases were diagnosed as trisomy 21.The false positive rate of ultrasound screening was 3.6%(101/2783).There were 196 cases whose NT ≥2.5 mm,in which 66 cases were high risk of chromosomal abnormality,and 16 fetal chromosomal abnormalities were diagnosed after chorionic villus sampling.The invasive procedure rate was 2.3% (66/2789).Totally,186 pregnant women were older than 35 years,among which 32 cases were high risk.There was no significantly difference on the of rate fetal chromosomal abnormality between the groups of age≥ 35 pregnant women and the general population (P=0.055).But 29.9% (32/107) high risk cases were detected in the group of age≥35.Five of thirteen fetal malformations cases were associated with abnormal karyotype.Conclusions Multiple ultrasound soft markers screening during early pregnancy could increase the diagnosis rate of chromosomal abnormality and decrease the false positive rate,false negative rate and invasive procedure rate.Early ultrasound screening might be effective in not only identifying chromosomal abnormality,but also diagnosing severe structure deformity of fetus.
<p><b>OBJECTIVE</b>Assessing the reproducibility of a portable spirometer, including reproducibility of inter-observer and day-today.</p><p><b>METHODS</b>Lung ventilation function was performed in 22 healthy volunteers by two observers on the same day and repeated by the first observer after 24h.</p><p><b>RESULTS</b>The inter-observer and day-to-day intra-class correlation coefficients are all higher than 0.75. There are no significant difference between each other. Bland-Altman chart shows good limits of agreement between inter-observer and day-to-day, only scattered data are outside of the limits of agreement.</p><p><b>CONCLUSIONS</b>The portable spirometer shows good inter-observer and day-to-day reproducibility, and can be used for testing lung function in clinical.</p>
Adult , Female , Humans , Male , Middle Aged , Monitoring, Ambulatory , Observer Variation , Reproducibility of Results , Spirometry
Skeletal muscle is becoming an attractive target tissue for gene therapy. Nevertheless, the low level of gene therapeutic expression in this tissue is the major limitation to it becoming an ideal target for gene transfer. The promoter is important element for gene transcription; however, the gene expression efficiencies and specificities of viral promoters and skeletal muscle-specific promotors are in themselves limiting factors. In this study, we established a dual-promoters system in skeletal muscle using a cytomegalovirus (CMV) promoter and a skeletal muscle-specific synthetic promoter. Mouse myoblast cell line C2C12 cells were transfected with the system. We demonstrated that the dual-promoters system could significantly improve exogenous gene expression rate in vitro when compared with a single CMV promoter system and a skeletal muscle-specific synthetic promoter system in C2C12 cell line, by 69.48% and 41.93%, respectively. Next, we evaluated the system efficiency in vivo, the results showed that the dual-promoters system increased gene expression in mice 1.23-fold and 1.60-fold, respectively compared with expression controlled by the two single promoter vectors. Finally, we tested the dual-promoters system in growth hormone-releasing hormone (GHRH) gene therapy, and revealed that when these two promoters co-drove the GHRH gene expression in vivo animal growth was enhanced significantly. All these results indicate that use of the dual-promoter vector was more efficient for gene expression in skeletal muscle tissue than use of the single promoter vectors. These finding could, hopefully, lead to the development of a high efficiency expression system in myocytes and form an ideal approach for gene therapy.
Cytomegalovirus/genetics , Gene Expression , Genetic Vectors , Growth Hormone-Releasing Hormone/biosynthesis , Muscle Fibers, Skeletal/metabolism , Promoter Regions, Genetic/genetics , Animals , Cricetinae , Genetic Therapy/methods , Growth Hormone-Releasing Hormone/genetics , HEK293 Cells , HeLa Cells , Humans , Mice , Muscle Fibers, Skeletal/cytology , Organ Specificity/genetics
Objective To discuss the interactive management mode (IMM) of preventive treatment on osteoporosis self-rehabilitation of rural elderly residents.Methods IMM was used to manage osteoporosis patients in the community of Changshu,and general self-efficacy scale was adopted for evaluation.Results Self-efficacy score (34.2) increased comparing with before(23.5 ) the medical management,the difference was statistically significant ( P<0.05 ).Conclusion IMM of preventive treatment can effectively improve the rural community general self-efficacy level.
ObjectiveTo report the results of preventive control program of severe thalassemias in Zhuhai City of Guangdong Province from 1998 to 2010.MethodsAs the guide centre of marriage and childbearing and the greatest maternity hospital in Zhuhai City of Guangdong Province,Zhuhai Municipal Maternity and Child Healthcare Hospital constructed the genetic screening network for thalassemias testing and referred for follow-up and for genetic counseling.The couples for premarital medical examination or regular healthcare examination in pregnancy were enrolled to this preventive control program.A conventional strategy of screening for heterozygote was used to identify the α- and β-thalassemia traits in women and their spouses according to the standard procedures of hematological phenotype analysis which was recommended by Thalassemia International Federation (T IF).Then those suspected couples at risk were diagnosed for α- and β-thalassemia by PCR-based DNA assays.The couples at risk for severe thalassemias were counseled and offered prenatal diagnosis and termination of pregnancy in case of an affected fetus in the rights of consent and of option voluntarily.ResultsFrom January 1998 to December 2010,85 522 brides and grooms-to-be for premarital screening and 41 503 pregnant women in addition to 14 141 partners for prenatal screening were recorded,the covering rates of premarital screening and prenatal screening in the city were 92.698% (from 1998 to 2003) and 27.667% (from 2004 to 2010),respectively.Totally 10 726 cases were found to be the carriers of thalassemias,with 7393 for o-thalassemia (5.237%,7 393/141 166) and 3333 for β-thalassemia (2.361%,3 333/141 166).A total of 257 couples at-risk for severe thalassemias were detected including 190 for α-thalassemia and 67 for β-thalassemia.Among them,251 (97.7%,251/257) couples were performed prenatal diagnosis.During the preventive control program,a total of 72 fetuses with severe thalassemias including hemoglobin H disease were voluntarily terminated.In Zhuhai City,the average annual birth rate of fetuses with severe thalassemia was declined by 32.9% (49/149).ConclusionsThis study has reduced effectively birth rate of perinatal infants with severe thalassemias in Zhuhai City by genetic screening and prenatal diagnosis of thalassemia in the large population of 13 years.Our summary comes out of technical proposals for prenatal screening and diagnosis,which could be take example by preventative control of thalassemia in other regions of China where are prevalent.
<p><b>OBJECTIVE</b>To observe the protective effect of alcohol extract of Potentilla anserina against myocardial apoptosis induced by acute myocardial ischemia/reperfusion by arteria coronaria ligation and the effect on the expressions of Caspase-3 and Caspase-9 in myocardial apoptosis signal pathway.</p><p><b>METHOD</b>Male SD rats were randomly divided into the sham-operated group, the model group, the diltiazem group (30 mg x kg(-1)) and P. anserine alcohol extract intervention groups (0.9, 1.8, 3.6 g x kg(-1)). Rat acute myocardial ischemia/reperfusion model was established by ligating left anterior descending. Apoptosis of myocardial cells were detected by TUNEL (Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling assay). The expressions of Caspase-3 and Caspase-9 mRNA were assayed by reverse transcription-polymerase chain reaction (RT-PCR). Semi-quantitative analysis was made for the expressions of Caspase-3 and Caspase-9 by immunohistochemistry.</p><p><b>RESULT</b>According to TUNEL results, after I/R injury-induced myocardial apoptosis, the apoptotic index (AI) of model group was (31.5 +/- 3.6)%. All P. anserine alcohol extract intervention groups showed obvious inhibition of ischemia/reperfusion-induced myocardial apoptosis. In the model group, myocardial apoptosis caused increased expression of Caspase-3, Caspase-9 mRNA and proteins. After the administration of P. anserine alcohol extract, 1.8, 3.6 g x kg(-1) dose groups showed notable decrease in Caspase-9 mRNA (P < 0.05), while the 0.9 g x kg(-1) dose group showed no significant difference with the model group. Alcohol extract of P. anserina in all dosages showed inhibitory effect on the expression of Caspase-3 mRNA in myocardial cells compared with model group (P < 0.05). Immunohistochemistry showed that administration of all dosages of alcohol extract of P. anserina could significantly reduce Caspase-3 and Caspase-9 protein expressions after I/R injury (P < 0.05).</p><p><b>CONCLUSION</b>The administration with alcohol extract of P. anserina can protect the myocardial tissue from apoptosis after acute myocardial ischemia and reperfusion injury in rats and inhibit the expressions of Caspase-9 and Caspase-3 mRNA and proteins.</p>
Animals , Male , Rats , Apoptosis , Caspase 3 , Metabolism , Caspase 9 , Metabolism , Ethanol , Chemistry , Myocardial Reperfusion Injury , Drug Therapy , Plant Extracts , Chemistry , Therapeutic Uses , Potentilla , Rats, Sprague-Dawley