Stabilizing High-Voltage Performance of Nickel-Rich Cathodes via Facile Solvothermally Synthesized Niobium-Doped Strontium Titanate.

Ni-rich layered ternary cathodes are promising candidates thanks to their low toxic Co-content and high energy density (∼800 Wh/kg). However, a critical challenge in developing Ni-rich cathodes is to improve cyclic stability, especially under high voltage (>4.3 V), which directly affects the performance and lifespan of the battery. In this study, niobium-doped strontium titanate (Nb-STO) is successfully synthesized via a facile solvothermal method and used as a surface modification layer onto the LiNi0.8Co0.1Mn0.1O2 (NCM811) cathode. The results exhibited that the Nb-STO modification significantly improved the cycling stability of the cathode material even under high-voltage (4.5 V) operational conditions. In particular, the best sample in our work could provide a high discharge capacity of ∼190 mAh/g after 100 cycles under 1 C with capacity retention over 84% in the voltage range of 3.0-4.5 V, superior to the pristine NCM811 (∼61%) and pure STO modified STO-811-600 (∼76%) samples under the same conditions. The improved electrochemical performance and stability of NCM811 under high voltage should be attributed to not only preventing the dissolution of the transition metals, further reducing the electrolyte's degradation by the end of charge, but also alleviating the internal resistance growth from uncontrollable cathode-electrolyte interface (CEI) evolution. These findings suggest that the as-synthesized STO with an optimized Nb-doping ratio could be a promising candidate for stabilizing Ni-rich cathode materials to facilitate the widespread commercialization of Ni-rich cathodes in modern LIBs.

Comparison of the use of a spiral nasojejunal tube and transendoscopic enteral tubing in washed microbiota transplantation via the mid-gut route.

Background: Methods for washed microbiota transplantation (WMT) through the mid-gut include transendoscopic enteral tubing (TET) and manual spiral nasojejunal tube (SNT) placement have not been studied. Methods: This prospective interventional study was performed at a single centre. Patients were divided into the SNT and mid-gut TET groups based on their conditions and wishes. In the SNT group, an SNT was passively inserted into the stomach, and abdominal X-rays were taken within 24 h to confirm tube placement in the small intestine. In the mid-gut TET group, mid-gut TET was placed in the small intestine for gastroscopy. Data on the clinical efficacy of WMT, intubation time, cost, overall comfort score, adverse reactions, etc., were collected from the two groups. Results: Sixty-three patients were included in the study (SNT group (n = 40) and mid-gut TET group (n = 23)). The clinical efficacy of WMT in the SNT and mid-gut TET groups was 90 % and 95.7 %, respectively (P = 0.644). Compared with the mid-gut TET group, the SNT group showed a shorter operation time (120 s vs. 258 s, P = 0.001) and a lower average cost (641.7 yuan vs. 1702.1 yuan, P = 0.001). There was no significant difference in the overall comfort score or the incidence of common discomfort symptoms between the two groups. Conclusion: The different implantation methods have different advantages; compared with mid-gut TET placement, manual SNT placement provides some benefits.

Identification of differentially expressed mRNAs as novel predictive biomarkers for gastric cancer diagnosis and prognosis.

BACKGROUND: Gastric cancer (GC) has a high mortality rate worldwide. Despite significant progress in GC diagnosis and treatment, the prognosis for affected patients still remains unfavorable. AIM: To identify important candidate genes related to the development of GC and identify potential pathogenic mechanisms through comprehensive bioinformatics analysis. METHODS: The Gene Expression Omnibus database was used to obtain the GSE183136 dataset, which includes a total of 135 GC samples. The limma package in R software was employed to identify differentially expressed genes (DEGs). Thereafter, enrichment analyses of Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed for the gene modules using the clusterProfile package in R software. The protein-protein interaction (PPI) networks of target genes were constructed using STRING and visualized by Cytoscape software. The common hub genes that emerged in the cohort of DEGs that was retrieved from the GEPIA database were then screened using a Venn Diagram. The expression levels of these overlapping genes in stomach adenocarcinoma samples and non-tumor samples and their association with prognosis in GC patients were also obtained from the GEPIA database and Kaplan-Meier curves. Moreover, real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting were performed to determine the mRNA and protein levels of glutamic-pyruvic transaminase (GPT) in GC and normal immortalized cell lines. In addition, cell viability, cell cycle distribution, migration and invasion were evaluated by cell counting kit-8, flow cytometry and transwell assays. Furthermore, we also conducted a retrospective analysis on 70 GC patients diagnosed and surgically treated in Wenzhou Central Hospital, Dingli Clinical College of Wenzhou Medical University, The Second Affiliated Hospital of Shanghai University between January 2017 to December 2020. The tumor and adjacent normal samples were collected from the patients to determine the potential association between the expression level of GPT and the clinical as well as pathological features of GC patients. RESULTS: We selected 19214 genes from the GSE183136 dataset, among which there were 250 downregulated genes and 401 upregulated genes in the tumor samples of stage III-IV in comparison to those in tumor samples of stage I-II with a P-value < 0.05. In addition, GO and KEGG results revealed that the various upregulated DEGs were mainly enriched in plasma membrane and neuroactive ligand-receptor interaction, whereas the downregulated DEGs were primarily enriched in cytosol and pancreatic secretion, vascular smooth muscle contraction and biosynthesis of the different cofactors. Furthermore, PPI networks were constructed based on the various upregulated and downregulated genes, and there were a total 15 upregulated and 10 downregulated hub genes. After a comprehensive analysis, several hub genes, including runt-related transcription factor 2 (RUNX2), salmonella pathogenicity island 1 (SPI1), lysyl oxidase (LOX), fibrillin 1 (FBN1) and GPT, displayed prognostic values. Interestingly, it was observed that GPT was downregulated in GC cells and its upregulation could suppress the malignant phenotypes of GC cells. Furthermore, the expression level of GPT was found to be associated with age, lymph node metastasis, pathological staging and distant metastasis (P < 0.05). CONCLUSION: RUNX2, SPI1, LOX, FBN1 and GPT were identified key hub genes in GC by bioinformatics analysis. GPT was significantly associated with the prognosis of GC, and its upregulation can effectively inhibit the proliferative, migrative and invasive capabilities of GC cells.

Combination of androgen and estrogen improves asthma by mediating Runx3 expression.

Objective: Asthma is a chronic heterogeneous airway disease, and imbalanced T-helper type 1 (Th1) and Th2 cell-mediated inflammation contribute to its pathogenesis. Although it has been suggested that androgen and estrogen were involved in development of asthma, the underlying mechanisms remained largely unclear. Studies have demonstrated that Runx3 could promote naive CD4+ T cells to differentiate into Th1 cells. Hence, our study aimed to explore the potential regulatory mechanism of androgen and estrogen on asthma via modulating Runx3. Methods: First, clinical assessments and pulmonary function tests were conducted on 35 asthma patients and 24 healthy controls. The concentrations of androgen, estrogen, and androgen estrogen ratios were assessed in peripheral blood samples of asthma patients and healthy controls. Then, a murine asthma model was established to explore the effects of estrogen and androgen (alone or in combination) on asthma. Third, an in vitro assay was used to explore the mechanism of combination of androgen and estrogen in asthma. Results: We observed decreased androgen and increased estrogen levels in asthma patients compared with healthy controls. In mice with experimental asthma, there were increased serum concentrations of estrogen and decreased serum concentrations of androgen, intervention with combination of androgen and estrogen alleviated airway inflammations, increased Runx3 expressions and elevated Th1 differentiation. In CD4+ T cells co-cultured with bronchial epithelial cells (BECs), treatment with androgen plus estrogen combination promoted Th1 differentiation, which was mitigated by Runx3 knockdown in BECs and enhanced by Runx3 overexpression. Conclusion: These findings suggest that androgen estrogen combination modulate the Th1/Th2 balance via regulating the expression of Runx3 in BECs, thereby providing experimental evidence supporting androgen and estrogen combination as a novel therapy for asthma.

Genome editing: An insight into disease resistance, production efficiency, and biomedical applications in livestock.

One of the primary concerns for the survival of the human species is the growing demand for food brought on by an increasing global population. New developments in genome-editing technology present promising opportunities for the growth of wholesome and prolific farm animals. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. Genome editing entails modifying genetic material by removing, adding, or manipulating particular DNA sequences from a particular locus in a way that does not happen naturally. The three primary genome editors are CRISPR/Cas 9, TALENs, and ZFNs. Each of these enzymes is capable of precisely severing nuclear DNA at a predetermined location. One of the most effective inventions is base editing, which enables single base conversions without the requirement for a DNA double-strand break (DSB). As reliable methods for precise genome editing in studies involving animals, cytosine and adenine base editing are now well-established. Effective zygote editing with both cytosine and adenine base editors (ABE) has resulted in the production of animal models. Both base editors produced comparable outcomes for the precise editing of point mutations in somatic cells, advancing the field of gene therapy. This review focused on the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of ZFNs, TALENs, and CRISPR/Cas9 base editors, and prime editing in diverse lab and farm animals. Additionally, we address the methodologies that can be used for gene regulation, base editing, and epigenetic alterations, as well as the significance of genome editing in animal models to better reflect real disease. We also look at methods designed to increase the effectiveness and precision of gene editing tools. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. This review is an overview of the existing knowledge of the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of zinc finger nucleases (ZFNs), transcription-activator-like endonucleases (TALENs), and clustered regularly interspaced short palindromic repeats associated protein 9 (CRISPR/Cas 9), base editors and prime editing in diverse lab and farm animals, which will offer better and healthier products for the entire human race.

S100a8/9 (S100 Calcium Binding Protein a8/9) Promotes Cardiac Hypertrophy Via Upregulation of FGF23 (Fibroblast Growth Factor 23) in Mice.

BACKGROUND: S100a8/9 (S100 calcium binding protein a8/9) belongs to the S100 family and has gained a lot of interest as a critical regulator of inflammatory response. Our previous study found that S100a8/9 homolog promoted aortic valve sclerosis in mice with chronic kidney disease. However, the role of S100a8/9 in pressure overload-induced cardiac hypertrophy remains unclear. The present study was to explore the role of S100a8/9 in cardiac hypertrophy. METHODS AND RESULTS: Cardiomyocyte-specific S100a9 loss or gain of function was achieved using an adeno-associated virus system, and the model of cardiac hypertrophy was established by aortic banding-induced pressure overload. The results indicate that S100a8/9 expression was increased in response to pressure overload. S100a9 deficiency alleviated pressure overload-induced hypertrophic response, whereas S100a9 overexpression accelerated cardiac hypertrophy. S100a9-overexpressed mice showed increased FGF23 (fibroblast growth factor 23) expression in the hearts after exposure to pressure overload, which activated calcineurin/NFAT (nuclear factor of activated T cells) signaling in cardiac myocytes and thus promoted hypertrophic response. A specific antibody that blocks FGFR4 (FGF receptor 4) largely abolished the prohypertrophic response of S100a9 in mice. CONCLUSIONS: In conclusion, S100a8/9 promoted the development of cardiac hypertrophy in mice. Targeting S100a8/9 may be a promising therapeutic approach to treat cardiac hypertrophy.

Changes in sleep score and leisure-time physical activity, their combination, and all-cause mortality in middle-aged and older Chinese adults: The Dongfeng-Tongji cohort study.

OBJECTIVES: To prospectively investigate the associations of longitudinal changes in sleep score and LTPA and their combination with all-cause mortality. METHODS: Among 12,543 participants (mean age: 66.1 years) from the Dongfeng-Tongji cohort, we calculated sleep score (range, 0-4, integrating bedtime, sleep duration, sleep quality, and midday napping, higher score indicating healthier sleep) and LTPA at baseline (2008-2010) and the first follow-up (2013) surveys and their 5-year changes (defining stable sleep score as no change and stable LTPA as change within 150 min/week). We prospectively documented deaths from the first follow-up survey (2013) through December 31, 2018. RESULTS: During a mean 5.5-year follow-up, 792 deaths occurred. The 5-year changes in sleep score and LTPA were inversely associated with all-cause mortality risk, regardless of their initial values. When assessing 5-year changes in sleep score and LTPA jointly, compared with the stable sleep score-stable LTPA group, the decreased sleep score-decreased LTPA group had a 40 % (5-85 %) higher all-cause mortality risk, whereas the increased sleep score-increased LTPA group had a 34 % (9-52 %) lower risk. The direction of the joint association was mainly driven by sleep score change. Participants maintaining sleep scores ≥ 3 and LTPA ≥ 150 min/week over 5 years had a 44 % (28-56 %) lower all-cause mortality risk. CONCLUSIONS: Promoting sleep hygiene and LTPA together may benefit efforts in reducing mortality risk, with particular attention to monitoring long-term sleep health.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Multifaceted roles of lymphatic and blood endothelial cells in the tumor microenvironment of hepatocellular carcinoma: A comprehensive review.

The tumor microenvironment is a complex network of cells, extracellular matrix, and signaling molecules that plays a critical role in tumor progression and metastasis. Lymphatic and blood vessels are major routes for solid tumor metastasis and essential parts of tumor drainage conduits. However, recent studies have shown that lymphatic endothelial cells (LECs) and blood endothelial cells (BECs) also play multifaceted roles in the tumor microenvironment beyond their structural functions, particularly in hepatocellular carcinoma (HCC). This comprehensive review summarizes the diverse roles played by LECs and BECs in HCC, including their involvement in angiogenesis, immune modulation, lymphangiogenesis, and metastasis. By providing a detailed account of the complex interplay between LECs, BECs, and tumor cells, this review aims to shed light on future research directions regarding the immune regulatory function of LECs and potential therapeutic targets for HCC.

Construction of the underlying circRNA-miRNA-mRNA regulatory network and a new diagnostic model in ulcerative colitis by bioinformatics analysis.

BACKGROUND: Circular RNAs (circRNAs) are involved in the pathogenesis of many diseases through competing endogenous RNA (ceRNA) regulatory mechanisms. AIM: To investigate a circRNA-related ceRNA regulatory network and a new predictive model by circRNA to understand the diagnostic mechanism of circRNAs in ulcerative colitis (UC). METHODS: We obtained gene expression profiles of circRNAs, miRNAs, and mRNAs in UC from the Gene Expression Omnibus dataset. The circRNA-miRNA-mRNA network was constructed based on circRNA-miRNA and miRNA-mRNA interactions. Functional enrichment analysis was performed to identify the biological mechanisms involved in circRNAs. We identified the most relevant differential circRNAs for diagnosing UC and constructed a new predictive nomogram, whose efficacy was tested with the C-index, receiver operating characteristic curve (ROC), and decision curve analysis (DCA). RESULTS: A circRNA-miRNA-mRNA regulatory network was obtained, containing 12 circRNAs, three miRNAs, and 38 mRNAs. Two optimal prognostic-related differentially expressed circRNAs, hsa_circ_0085323 and hsa_circ_0036906, were included to construct a predictive nomogram. The model showed good discrimination, with a C-index of 1(> 0.9, high accuracy). ROC and DCA suggested that the nomogram had a beneficial diagnostic ability. CONCLUSION: This novel predictive nomogram incorporating hsa_circ_0085323 and hsa_circ_0036906 can be conveniently used to predict the risk of UC. The circRNa-miRNA-mRNA network in UC could be more clinically significant.

A combined pre- and intra-operative nomogram in evaluation of degrees of liver cirrhosis predicts post-hepatectomy liver failure: a multicenter prospective study.

Background: Adequate evaluation of degrees of liver cirrhosis is essential in surgical treatment of hepatocellular carcinoma (HCC) patients. The impact of the degrees of cirrhosis on prediction of post-hepatectomy liver failure (PHLF) remains poorly defined. This study aimed to construct and validate a combined pre- and intra-operative nomogram based on the degrees of cirrhosis in predicting PHLF in HCC patients using prospective multi-center's data. Methods: Consecutive HCC patients who underwent hepatectomy between May 18, 2019 and Dec 19, 2020 were enrolled at five tertiary hospitals. Preoperative cirrhotic severity scoring (CSS) and intra-operative direct liver stiffness measurement (DSM) were performed to correlate with the Laennec histopathological grading system. The performances of the pre-operative nomogram and combined pre- and intra-operative nomogram in predicting PHLF were compared with conventional predictive models of PHLF. Results: For 327 patients in this study, histopathological studies showed the rates of HCC patients with no, mild, moderate, and severe cirrhosis were 41.9%, 29.1%, 22.9%, and 6.1%, respectively. Either CSS or DSM was closely correlated with histopathological stages of cirrhosis. Thirty-three (10.1%) patients developed PHLF. The 30- and 90-day mortality rates were 0.9%. Multivariate regression analysis showed four pre-operative variables [HBV-DNA level, ICG-R15, prothrombin time (PT), and CSS], and one intra-operative variable (DSM) to be independent risk factors of PHLF. The pre-operative nomogram was constructed based on these four pre-operative variables together with total bilirubin. The combined pre- and intra-operative nomogram was constructed by adding the intra-operative DSM. The pre-operative nomogram was better than the conventional models in predicting PHLF. The prediction was further improved with the combined pre- and intra-operative nomogram. Conclusions: The combined pre- and intra-operative nomogram further improved prediction of PHLF when compared with the pre-operative nomogram. Trial Registration: Clinicaltrials.gov Identifier: NCT04076631.

Exploring Bile-Acid Changes and Microflora Profiles in Chicken Fatty Liver Disease Model.

Excessive liver fat causes non-alcoholic fatty liver disease (NAFLD) in laying hens, reducing egg production. Addressing NAFLD via bile-acid metabolism is gaining attention. We induced NAFLD in 7-week-old ISA female chickens with a high-cholesterol, low-choline diet (CLC) for 6 weeks. LC/MS was used to analyze serum and cecal bile acids, while cecal digesta DNA underwent 16S rRNA sequencing. The distribution of bile acid varied in healthy (CON) and CLC-fed chickens. CLC increased secondary bile acids (TLCA, TUDCA, THDCA, TDCA) in serum and primary bile acids (CDCA, TCDCA, isoDCA) in serum, as well as glycochenodeoxycholic acid (GCDCA) in cecal contents. CLC upregulated bile-acid synthesis enzymes (CYP7A1, CYP8B1) in the liver. Bile-acid receptor gene expression (HNF4A, FXR, LXR) was similar between groups. Microbiota abundance was richer in CON (alpha-diversity), with distinct separation (beta-diversity) between CON and CLC. The Firmicutes/Bacteroidetes ratio slightly decreased in CLC. Taxonomic analysis revealed higher Bacteroides, Alistipes, Megamonas in CLC but lower Barnesiella. CLC had more Mucispirillum, Eubacterium_coprostanoligenes_group, Shuttleworthia, and Olsenella, while CON had more Enterococcus, Ruminococcaceae_UCG_014, and Faecalibacterium. This study unveils bile-acid and microflora changes in a chicken NAFLD model, enhancing our understanding of fatty liver disease metabolism and aiding targeted interventions.

Coordinating activation of endo-lysosomal two-pore channels and TRP mucolipins.

Two-pore channels and TRP mucolipins are ubiquitous endo-lysosomal cation channels of pathophysiological relevance. Both are Ca2+-permeable and regulated by phosphoinositides, principally PI(3,5)P2. Accumulating evidence has uncovered synergistic channel activation by PI(3,5)P2 and endogenous metabolites such as the Ca2+ mobilizing messenger NAADP, synthetic agonists including approved drugs and physical cues such as voltage and osmotic pressure. Here, we provide an overview of this coordination.

Endothelial progenitor cells control remodeling of uterine spiral arteries for the establishment of utero-placental circulation.

Placental ischemia, resulting from inadequate remodeling of uterine spiral arteries, is a factor in the development of preeclampsia. However, the effect of endothelial progenitor cells that play a role in the vascular injury-repair program is largely unexplored during remodeling. Here, we observe that preeclampsia-afflicted uterine spiral arteries transition to a synthetic phenotype in vascular smooth muscle cells and characterize the regulatory axis in endothelial progenitor cells during remodeling in human decidua basalis. Excessive sEng, secreted by AMP-activated protein kinase (AMPK)-deficient endothelial progenitor cells through the inhibition of HO-1, damages residual endothelium and leads to the accumulation of extracellular matrix produced by vascular smooth muscle cells during remodeling, which is further confirmed by animal models. Collectively, our findings suggest that the impaired functionality of endothelial progenitor cells contributes to the narrowing of remodeled uterine spiral arteries, leading to reduced utero-placental perfusion. This mechanism holds promise in elucidating the pathogenesis of preeclampsia.

Changes in Sleep Patterns, Genetic Susceptibility, and Incident Cardiovascular Disease in China.

Importance: The associations of changes in sleep patterns with incident cardiovascular disease (CVD) are not fully elucidated, and whether these associations are modified by genetic susceptibility remains unknown. Objectives: To investigate the associations of 5-year changes in sleep patterns with incident CVD and whether genetic susceptibility modifies these associations. Design, Setting, and Participants: This prospective cohort study of the Dongfeng-Tongji cohort was conducted from 2008 to 2018 in China. Eligible participants included those with complete sleep information at baseline survey (2008-2010) and the first follow-up survey (2013); participants who had no CVD or cancer in 2013 were prospectively assessed until 2018. Statistical analysis was performed in November 2023. Exposures: Five-year changes in sleep patterns (determined by bedtime, sleep duration, sleep quality, and midday napping) between 2008 and 2013, and polygenic risk scores (PRS) for coronary heart disease (CHD) and stroke. Main Outcomes and Measures: Incident CVD, CHD, and stroke were identified from 2013 to 2018. Cox proportional hazards regression models were applied to estimate hazard ratios (HRs) and 95% CIs. Results: Among 15 306 individuals (mean [SD] age, 65.8 [7.4] years; 8858 [57.9%] female and 6448 male [42.1%]), 5474 (35.78%) had persistent unfavorable sleep patterns and 3946 (25.8%) had persistent favorable sleep patterns. A total of 3669 incident CVD cases were documented, including 2986 CHD cases and 683 stroke cases, over a mean (SD) follow-up of 4.9 (1.5) years. Compared with those with persistent unfavorable sleep patterns, individuals with persistent favorable sleep patterns over 5 years had lower risks of incident CVD (HR, 0.80; 95% CI, 0.73-0.87), CHD (HR, 0.84; 95% CI, 0.76-0.92), and stroke (HR, 0.66; 95% CI, 0.54-0.82) in the subsequent 5-year period. No significant effect modification by PRS was observed for sleep pattern change and CHD or stroke risk. However, sleep pattern changes and PRS were jointly associated with the CHD and stroke risk in a dose-dependent manner, with the lowest risk being among those with persistent favorable sleep patterns combined with low PRS (HR for CHD, 0.65; 95% CI, 0.52-0.82 and HR for stroke, 0.48; 95% CI, 0.29-0.79). Conclusions and Relevance: In this cohort study of middle-aged and older Chinese adults, individuals with persistent favorable sleep patterns had a lower CVD risk, even among those with higher genetic risk. These findings highlight the importance of maintaining favorable sleep patterns for CVD prevention.