Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

[Construction of recombinant adenovirus vector expressing shRNAs targeting COX-2, AKT1 and PIK3R1 gene and its inhibition effect on proliferation of human gastric adenocarcinoma].

OBJECTIVE: To construct a recombinant adenovirus vector that expresses small hairpin RNAs (shRNA) against COX-2, AKT1 and PIK3R1 gene and to evaluate its potential for suppressing the cell proliferation of human gastric adenocarcinoma SGC701 cell in vitro and in vivo, which will enable the development of a gene therapy protocol for the treatment of human gastric adenocarcinoma. METHODS: Three strips of shRNA targeting AKT1, COX-2 and PIK3R1, was subcloned into adenovirus expression vector. After verification, it was amplified and titered. The recombinant adenovirus expression vector was infected into human gastric adenocarcinoma SGC7901 cells in vitro and the infected cells were injected in nude mice. The mRNA and protein expression levels of AKT1, COX-2 and PIK3R1 were determined by real-time PCR and Western blot respectively. Cell proliferation in vitro was determined by methyl thiazolyltetrazolium (MTT) assay and flow cytometry, tumor growth in vivo was measured by volume of tumor in nude mice. RESULTS: Restriction digestion and sequencing analysis showed that the rAd5-C-A-P adenovirus expression vector was constructed successfully. It significantly inhibited the expression of AKT1, COX-2 and PIK3R1, and cell growth was inhibited over 70% as indicated by MTT assay and accompanied with G0/G1 phase arrest. Cell growth on matrigel matrix showed that the rAd5-C-A-P transfected cells were detached from the matrix or grew in a scattered clustering pattern, indicating poor cell growth activities in 2-D matrigel. Tumor growth in nude mice in the C + A + P group was inhibited (P<0.01). CONCLUSION: shRNA targeting COX-2, AKT1 and PIK3R1 down regulated significantly the expression of the three genes in a sequence-specific manner, exerted proliferation inhibition effect on SGC7901 cells in vitro and in vivo.

Inhibitory effects of adenovirus mediated COX-2, Akt1 and PIK3R1 shRNA on the growth of malignant tumor cells in vitro and in vivo.

Cyclooxygenase-2 (COX-2) and phosphatidylinositol 3-kinase (PI3K)/Akt play a critical role in the formation of many malignant tumors, and have been shown to be important therapeutic targets. In the present study, small hairpin RNA (shRNA) expression constructs that target sequences of human COX-2, Akt1 and PIK3R1 were used to examine the proliferation and invasion inhibition effects on SGC7901 gastric adenocarcinoma cells and U251 glioma cells. Cell growth was inhibited by over 70%, as indicated by a MTT assay, and was accompanied by G1/G0 phase arrest in the shRNA treated group, indicating poor cell growth activities. The number of cells invading through the matrigel in the shRNA treated group were significantly decreased (26.4+/-4.6) compared with that of the control group (105+/-4.0) and the nonsense sequence group (102.5+/-6.4). In addition, the tumor volumes in the SGC7901 subcutaneous nude mouse model treated with shRNA was significantly smaller than those of the control group and nonsense sequence group. When COX-2, Akt1 and PIK3R1 were dramatically downregulated, proliferating cell nuclear antigen (PCNA), CyclinD1 and matrix metalloproteinases (MMP-2, MMP-9) were downregulated, while tissue-inhibitor of metalloproteinase-2 (TIMP-2) and P53 were upregulated. Our results demonstrated that shRNA targeting COX-2, Akt1 and PIK3R1 downregulates their expression significantly in a sequence-specific manner, exerting proliferation and invasion inhibition effects on SGC7901 and U251 cells. In conclusion, our data suggest a novel mechanism for the regulation of malignant tumor cell growth and provide evidence for new combinatory gene therapy for malignant tumors.

Inhibitory effects of adenovirus mediated Akt1 and PIK3R1 shRNA on the growth of malignant tumor cells in vitro and in vivo.

Phosphatidylinositol 3-kinase (PI3K)/Akt plays a critical role in the formation of many malignant tumors, and has been shown to be an important therapeutic target. In the present study, small hairpin RNA (shRNA) expression constructs that target sequences of human Akt1 and PIK3R1 were used to examine the proliferation and invasion inhibition effects on SGC7901 gastric adenocarcinoma cells and U251 glioma cells. Cell growth was inhibited by over 60%, as indicated by a MTT assay, and was accompanied by G(1)/G(0) phase arrest in the shRNA treated group, indicating poor cell growth activities. The number of cells invading through the matrigel in the shRNA treated group were significantly decreased (51.6 +/- 3.9) compared with that of the control group (105 +/- 4.0) and the nonsense sequence group (102.5 +/- 6.4). In addition, the tumor volumes in the SGC7901 subcutaneous nude mouse model treated with shRNA were significantly smaller than those of the control group and nonsense sequence group. When Akt1 and PIK3R1 were dramatically downregulated, proliferating cell nuclear antigen (PCNA), CyclinD1 and matrix metalloproteinases (MMP-2, MMP-9) were downregulated, while tissue-Inhibitor of Metalloproteinase-2 (TIMP-2) and p53 were upregulated. Our results demonstrated that shRNA targeting Akt1 and PIK3R1 downregulates their expression significantly in a sequence-specific manner, exerting proliferation and invasion inhibition effects on SGC7901 and U251 cells. In conclusion, our data suggests a novel mechanism for the regulation of malignant tumor cell growth and provides evidence for new combinatory gene therapy for malignant tumors.

[Expression and significance of nrf2 and its target genes in pulmonary adenocarcinoma a549 cells resistant to Cisplatin.].

BACKGROUND: Nuclear factor erythroid-2 related factor 2 (Nrf2) is a key transcription factor in oxidation-reduction reaction. It has been proved that Nrf2 is relevant to cisplatin-resistance in ovarian cancer cells. Up to now, little is know whether Nrf2 and it's signal patheways play an important role in cisplatin-resistance in pulmonary adenocarcinoma cells or not. The aim of this study is to explore the expression levels of transcription factor Nrf2 and its target genes in A549 cells which are resistance to cisplatin and reveal the mechanism behind it. METHODS: A549/DDP and A549 were cultured in vitro. MTT was used to detect the drug resistance index of A549/DDP cells. Real-time PCR was used to evaluate the expression of transcription factor Nrf2 and its target genes mRNA. RESULTS: The drug resistance index of A549/DDP was 12.12, and its Keap1, Nrf2, NQO1, GSTP1, GCL, HO-1, MRP4 mRNA expressions were all significantly increased compared with A549 (P<0.01). On the other hand, MRP1, MRP2, MRP3 showd the crosscurrent (P<0.01). CONCLUSIONS: It proves that the transcription factor Nrf2 and it's signal pathways are closely related with drug resistance of tumors. Moreover, this provides a new direction to reverse drug resistance and have significance to avoid and overcome drug resistance of tumor.