"Difficult" deoxyribonucleotide sequences in the solid-phase synthesis by the phosphoramidite chemistry.

This work catalogued oligonucleotide sequences and sequence compositions based on the overall yield of full-length product obtained by the phosphoramidite chemistry-based solid phase synthesis. In total, 76 sequences with different dinucleotide and trinucleotide repeats were synthesized, and the fully-deprotected products were analyzed by denaturing anion exchange HPLC. Overall, sequences containing more 2'-deoxyadenosine residues were obtained in relatively lower yields, likely due to the relative ease of 2'-deoxyadenosine to undergo depurination during the detritylation reaction. Furthermore, dinucleotide steps, such as d(CG)/d(GC) and d(AG)/d(GA), likely contribute the overall lower yields of full-length products as well.

Novel Escherichia coli active site dnaE alleles with altered base and sugar selectivity.

The Escherichia coli dnaE gene encodes the α-catalytic subunit (pol IIIα) of DNA polymerase III, the cell's main replicase. Like all high-fidelity DNA polymerases, pol III possesses stringent base and sugar discrimination. The latter is mediated by a so-called "steric gate" residue in the active site of the polymerase that physically clashes with the 2'-OH of an incoming ribonucleotide. Our structural modeling data suggest that H760 is the steric gate residue in E.coli pol IIIα. To understand how H760 and the adjacent S759 residue help maintain genome stability, we generated DNA fragments in which the codons for H760 or S759 were systematically changed to the other nineteen naturally occurring amino acids and attempted to clone them into a plasmid expressing pol III core (α-θ-ε subunits). Of the possible 38 mutants, only nine were successfully sub-cloned: three with substitutions at H760 and 6 with substitutions at S759. Three of the plasmid-encoded alleles, S759C, S759N, and S759T, exhibited mild to moderate mutator activity and were moved onto the chromosome for further characterization. These studies revealed altered phenotypes regarding deoxyribonucleotide base selectivity and ribonucleotide discrimination. We believe that these are the first dnaE mutants with such phenotypes to be reported in the literature.

Probing the Catalytic Mechanism and Inhibition of SAMHD1 Using the Differential Properties of Rp- and Sp-dNTPαS Diastereomers.

SAMHD1 is a fundamental regulator of cellular dNTPs that catalyzes their hydrolysis into 2'-deoxynucleoside and triphosphate, restricting the replication of viruses, including HIV-1, in CD4+ myeloid lineage and resting T-cells. SAMHD1 mutations are associated with the autoimmune disease Aicardi-Goutières syndrome (AGS) and certain cancers. More recently, SAMHD1 has been linked to anticancer drug resistance and the suppression of the interferon response to cytosolic nucleic acids after DNA damage. Here, we probe dNTP hydrolysis and inhibition of SAMHD1 using the Rp and Sp diastereomers of dNTPαS nucleotides. Our biochemical and enzymological data show that the α-phosphorothioate substitution in Sp-dNTPαS but not Rp-dNTPαS diastereomers prevents Mg2+ ion coordination at both the allosteric and catalytic sites, rendering SAMHD1 unable to form stable, catalytically active homotetramers or hydrolyze substrate dNTPs at the catalytic site. Furthermore, we find that Sp-dNTPαS diastereomers competitively inhibit dNTP hydrolysis, while Rp-dNTPαS nucleotides stabilize tetramerization and are hydrolyzed with similar kinetic parameters to cognate dNTPs. For the first time, we present a cocrystal structure of SAMHD1 with a substrate, Rp-dGTPαS, in which an Fe-Mg-bridging water species is poised for nucleophilic attack on the Pα. We conclude that it is the incompatibility of Mg2+, a hard Lewis acid, and the α-phosphorothioate thiol, a soft Lewis base, that prevents the Sp-dNTPαS nucleotides coordinating in a catalytically productive conformation. On the basis of these data, we present a model for SAMHD1 stereospecific hydrolysis of Rp-dNTPαS nucleotides and for a mode of competitive inhibition by Sp-dNTPαS nucleotides that competes with formation of the enzyme-substrate complex.

A unique arginine cluster in PolDIP2 enhances nucleotide binding and DNA synthesis by PrimPol.

Replication forks often stall at damaged DNA. To overcome these obstructions and complete the DNA duplication in a timely fashion, replication can be restarted downstream of the DNA lesion. In mammalian cells, this repriming of replication can be achieved through the activities of primase and polymerase PrimPol. PrimPol is stimulated in DNA synthesis through interaction with PolDIP2, however the exact mechanism of this PolDIP2-dependent stimulation is still unclear. Here, we show that PrimPol uses a flexible loop to interact with the C-terminal ApaG-like domain of PolDIP2, and that this contact is essential for PrimPol's enhanced processivity. PolDIP2 increases primer-template and dNTP binding affinities of PrimPol, which concomitantly enhances its nucleotide incorporation efficiency. This stimulation is dependent on a unique arginine cluster in PolDIP2. Since the polymerase activity of PrimPol alone is very limited, this mechanism, where the affinity for dNTPs gets increased by PolDIP2 binding, might be critical for the in vivo function of PrimPol in tolerating DNA lesions at physiological nucleotide concentrations.

Kinetic Effects of ß,γ-Modified Deoxynucleoside 5'-Triphosphate Analogues on RNA-Catalyzed Polymerization of DNA.

A recently described DNA polymerase ribozyme, obtained by in vitro evolution, provides the opportunity to investigate mechanistic features of RNA catalysis using methods that previously had only been applied to DNA polymerase proteins. Insight can be gained into the transition state of the DNA polymerization reaction by studying the behavior of various ß,γ-bridging substituted methylene (CXY; X, Y = H, halo, methyl) or imido (NH) dNTP analogues that differ with regard to the pKa4 of the bisphosphonate or imidodiphosphate leaving group. The apparent rate constant (kpol) of the polymerase ribozyme was determined for analogues of dGTP and dCTP that span a broad range of acidities for the leaving group, ranging from 7.8 for the CF2-bisphosphonate to 11.6 for the CHCH3-bisphosphonate. A Brønsted plot of log(kpol) versus pKa4 of the leaving group demonstrates linear free energy relationships (LFERs) for dihalo-, monohalo-, and non-halogen-substituted analogues of the dNTPs, with negative slopes, as has been observed for DNA polymerase proteins. The unsubstituted dNTPs have a faster catalytic rate than would be predicted from consideration of the linear free energy relationship alone, presumably due to a relatively more favorable interaction of the ß,γ-bridging oxygen within the active site. Although the DNA polymerase ribozyme is considerably slower than DNA polymerase proteins, it exhibits a similar LFER fingerprint, suggesting mechanistic commonality pertaining to the buildup of negative charge in the transition state, despite the very different chemical compositions of the two catalysts.

DNA Nucleobase under Ionizing Radiation: Unexpected Proton Transfer by Thymine Cation in Water Nanodroplets.

The effect of ionizing radiation on DNA constituents is a widely studied fundamental process using experimental and computational techniques. In particular, radiation effects on nucleobases are usually tackled by mass spectrometry in which the nucleobase is embedded in a water nanodroplet. Here, we present a multiscale theoretical study revealing the effects and the dynamics of water droplets towards neutral and ionized thymine. In particular, by using both hybrid quantum mechanics/molecular mechanics and full ab initio molecular dynamics, we reveal an unexpected proton transfer from thymine cation to a nearby water molecule. This leads to the formation of a neutral radical thymine and a Zundel structure, while the hydrated proton localizes at the interface between the deprotonated thymine and the water droplet. This observation opens entirely novel perspectives concerning the reactivity and further fragmentation of ionized nucleobases.

Quantitation of deoxynucleoside triphosphates by click reactions.

The levels of the four deoxynucleoside triphosphates (dNTPs) are under strict control in the cell, as improper or imbalanced dNTP pools may lead to growth defects and oncogenesis. Upon treatment of cancer cells with therapeutic agents, changes in the canonical dNTPs levels may provide critical information for evaluating drug response and mode of action. The radioisotope-labeling enzymatic assay has been commonly used for quantitation of cellular dNTP levels. However, the disadvantage of this method is the handling of biohazard materials. Here, we described the use of click chemistry to replace radioisotope-labeling in template-dependent DNA polymerization for quantitation of the four canonical dNTPs. Specific oligomers were designed for dCTP, dTTP, dATP and dGTP measurement, and the incorporation of 5-ethynyl-dUTP or C8-alkyne-dCTP during the polymerization reaction allowed for fluorophore conjugation on immobilized oligonucleotides. The four reactions gave a linear correlation coefficient >0.99 in the range of the concentration of dNTPs present in 106 cells, with little interference of cellular rNTPs. We present evidence indicating that data generated by this methodology is comparable to radioisotope-labeling data. Furthermore, the design and utilization of a robust microplate assay based on this technology evidenced the modulation of dNTPs in response to different chemotherapeutic agents in cancer cells.

A Model for the Emergence of RNA from a Prebiotically Plausible Mixture of Ribonucleotides, Arabinonucleotides, and 2'-Deoxynucleotides.

The abiotic synthesis of ribonucleotides is thought to have been an essential step toward the emergence of the RNA world. However, it is likely that the prebiotic synthesis of ribonucleotides was accompanied by the simultaneous synthesis of arabinonucleotides, 2'-deoxyribonucleotides, and other variations on the canonical nucleotides. In order to understand how relatively homogeneous RNA could have emerged from such complex mixtures, we have examined the properties of arabinonucleotides and 2'-deoxyribonucleotides in nonenzymatic template-directed primer extension reactions. We show that nonenzymatic primer extension with activated arabinonucleotides is much less efficient than with activated ribonucleotides, and furthermore that once an arabinonucleotide is incorporated, continued primer extension is strongly inhibited. As previously shown, 2'-deoxyribonucleotides are also less efficiently incorporated in primer extension reactions, but the difference is more modest. Experiments with mixtures of nucleotides suggest that the coexistence of ribo- and arabinonucleotides does not impede the copying of RNA templates. Moreover, chimeric oligoribonucleotides containing 2'-deoxy- or arabinonucleotides are effective templates for RNA synthesis. We propose that the initial genetic polymers were random sequence chimeric oligonucleotides formed by untemplated polymerization, but that template copying chemistry favored RNA synthesis; multiple rounds of replication may have led to pools of oligomers composed mainly of RNA.

The presence of ribonucleotides in DNA has an ambiguous impact on the maintenance of genetic stability / Obecnosc rybonukleotydów w DNA ma antagonistyczne znaczenie dla utrzymania stabilnosci genetycznej organizmów.

High replication fidelity, understood as the DNA polymerases' ability to select nucleotides with both correct base and sugar, is of critical importance for maintaining the genetic stability. Due to the fact that the cellular levels of ribonucleotides are much higher than the concentrations of deoxyribonucleotides, replicative polymerases are able to incorporate ribonucleotides with up to 1000-fold higher frequency than mismatched deoxyribonucleotides. The ability to discriminate against ribonucleotides by the DNA polymerases relies on the steric gate residue in the enzyme's catalytic centre. Despite the fact that ribonucleotides are the most abundantly inserted incorrect nucleotides in DNA, they are not observed in properly functioning cells. The major pathway responsible for the recognition and removal of ribonucleotides from DNA is called Ribonucleotide Excision Repair. The impairment of ribonucleotide removal pathways can cause increased mutation rate, replication stress, DNA breakage, problems with transcription, chromatin structure maintenance, genetic disorders and cell death. In spite of that, ribonucleotide incorporation into DNA may have some positive biological impact, stimulating mismatch repair and non-homologous end joining.

Absolute Quantification of RNA or DNA Using Acid Hydrolysis and Mass Spectrometry.

Accurate, traceable quantification of ribonucleotide or deoxyribonucleotide oligomers is achievable using acid hydrolysis and isotope dilution mass spectrometry (ID-MS). In this work, formic acid hydrolysis is demonstrated to generate stoichiometric release of nucleobases from intact oligonucleotides, which then can be measured by ID-MS, facilitating true and precise absolute quantification of RNA, short linearized DNA, or genomic DNA. Surrogate nucleobases are quantified with a liquid chromatography-tandem mass spectrometry (LC-MS/MS) workflow, using multiple reaction monitoring (MRM). Nucleobases were chromatographically resolved using a novel cation-exchange separation, incorporating a pH gradient. Trueness of this quantitative assay is estimated from agreement among the surrogate nucleobases and by comparison to concentrations provided for commercial materials or Standard Reference Materials (SRMs) from the National Institute of Standards and Technology (NIST). Comparable concentration estimates using NanoDrop spectrophotometry or established from droplet-digital polymerase chain reaction (ddPCR) techniques agree well with the results. Acid hydrolysis-ID-LC-MS/MS provides excellent quantitative selectivity and accuracy while enabling traceability to mass unit. Additionally, this approach can be uniquely useful for quantifying modified nucleobases or mixtures.

The role of dNTP metabolites in control of the embryonic cell cycle.

Deoxyribonucleotide metabolites (dNTPs) are the substrates for DNA synthesis. It has been proposed that their availability influences the progression of the cell cycle during development and pathological situations such as tumor growth. The mechanism has remained unclear for the link between cell cycle and dNTP levels beyond their role as substrates. Here, we review recent studies concerned with the dynamics of dNTP levels in early embryos and the role of DNA replication checkpoint as a sensor of dNTP levels.

Analysis of the Isolated and the Clustered DNA Damages by Single-Molecule Counting.

DNA damage seriously threats the genomic stability and is linked to mutagenesis, carcinogenesis, and cell death. DNA damage includes the isolated damage and the clustered damages, but few approaches are available for efficient detection of the clustered damage due to its spatial distribution. Herein, we present a single-molecule counting approach with the capability of detecting both the isolated and the clustered damages in genomic DNAs. We employed the repair enzymes to remove the DNA damage and used the terminal deoxynucleotidyl transferase (TdT) to incorporate biotinylated nucleotides and fluorescent nucleotides into the damage sites in a template-independent manner. The number of total oxidative damaged bases is quantified to be 7328-7406 in a single HeLa cell treated with 150 µM H2O2. This method in combination with special repair enzymes can detect a variety of DNA damage in different types of cells, holding great potential for early diagnosis of DNA damage-related human diseases.

Single-molecule detection of deoxyribonucleoside triphosphates in microdroplets.

A new approach to single-molecule DNA sequencing in which dNTPs, released by pyrophosphorolysis from the strand to be sequenced, are captured in microdroplets and read directly could have substantial advantages over current sequence-by-synthesis methods; however, there is no existing method sensitive enough to detect a single nucleotide in a microdroplet. We have developed a method for dNTP detection based on an enzymatic two-stage reaction which produces a robust fluorescent signal that is easy to detect and process. By taking advantage of the inherent specificity of DNA polymerases and ligases, coupled with volume restriction in microdroplets, this method allows us to simultaneously detect the presence of and distinguish between, the four natural dNTPs at the single-molecule level, with negligible cross-talk.

Optimization of Replication, Transcription, and Translation in a Semi-Synthetic Organism.

Previously, we reported the creation of a semi-synthetic organism (SSO) that stores and retrieves increased information by virtue of stably maintaining an unnatural base pair (UBP) in its DNA, transcribing the corresponding unnatural nucleotides into the codons and anticodons of mRNAs and tRNAs, and then using them to produce proteins containing noncanonical amino acids (ncAAs). Here we report a systematic extension of the effort to optimize the SSO by exploring a variety of deoxy- and ribonucleotide analogues. Importantly, this includes the first in vivo structure-activity relationship (SAR) analysis of unnatural ribonucleoside triphosphates. Similarities and differences between how DNA and RNA polymerases recognize the unnatural nucleotides were observed, and remarkably, we found that a wide variety of unnatural ribonucleotides can be efficiently transcribed into RNA and then productively and selectively paired at the ribosome to mediate the synthesis of proteins with ncAAs. The results extend previous studies, demonstrating that nucleotides bearing no significant structural or functional homology to the natural nucleotides can be efficiently and selectively paired during replication, to include each step of the entire process of information storage and retrieval. From a practical perspective, the results identify the most optimal UBP for replication and transcription, as well as the most optimal unnatural ribonucleoside triphosphates for transcription and translation. The optimized SSO is now, for the first time, able to efficiently produce proteins containing multiple, proximal ncAAs.

A Molecular Sensor Reveals Differences in Macromolecular Crowding between the Cytoplasm and Nucleoplasm.

We describe a molecular sensor that reports, using fluorescence resonance energy transfer (FRET), on the degree of macromolecular crowding in different cellular compartments. The oligonucleotide-based sensor is sensitive to changes in the volume fraction of macromolecules over a wide range in vitro and, when introduced in cells, rapidly distributes and shows a striking contrast between the cytosol and the nucleus. This contrast can be modulated by osmotic stress or by using a number of drugs that alter chromatin organization within the nucleus. These findings suggest that the sensor can be used as a tool to probe chromosome organization. Further, our finding that the cell maintains different degrees of macromolecular crowding in the cytoplasm and nucleoplasm has implications on molecular mechanisms since crowding can alter protein conformations, binding rates, reaction kinetics, and therefore protein function.

Crystal structures of phage NrS-1 N300-dNTPs-Mg2+ complex provide molecular mechanisms for substrate specificity.

A novel DNA polymerase from the deep-sea vent phage NrS-1, was characterized as a primase-polymerase (referred to as prim-pol), which works as a self-priming DNA polymerase to synthesize de novo long DNA strands. Functional research on the NrS-1 prim-pol illustrated that the N-terminal 300 residues (referred to as N300) have de novo synthesis activity similar to that of the full-length enzyme. Just like other prim-pols, NrS-1 prim-pol was able to initiate DNA synthesis, proficiently discriminating against ribonucleotides (NTPs), exclusively using deoxynucleotides (dNTPs). However, the structural basis for this discrimination is not well understood. Here, the three kinds of crystal structures of N300-dNTPs-Mg2+ complex were determined. These complex structures shared the identical steric architecture and hydrogen-bond interactions in the catalytic center. The results of biochemical studies indicated that R145 possibly plays an indispensable role in the primer extension. Mutagenesis and structural simulation showed that the backbone carboxyl group of Y146, as a potential sugar selector, was involved in steric clashing with the incoming 2'-OH group of NTPs. However, the mechanism of substrate discrimination probably was different from that of other prim-pols, according to the structural analyses and sequence comparison.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Structures of Class Id Ribonucleotide Reductase Catalytic Subunits Reveal a Minimal Architecture for Deoxynucleotide Biosynthesis.

Class I ribonucleotide reductases (RNRs) share a common mechanism of nucleotide reduction in a catalytic α subunit. All RNRs initiate catalysis with a thiyl radical, generated in class I enzymes by a metallocofactor in a separate ß subunit. Class Id RNRs use a simple mechanism of cofactor activation involving oxidation of a MnII2 cluster by free superoxide to yield a metal-based MnIIIMnIV oxidant. This simple cofactor assembly pathway suggests that class Id RNRs may be representative of the evolutionary precursors to more complex class Ia-c enzymes. X-ray crystal structures of two class Id α proteins from Flavobacterium johnsoniae ( Fj) and Actinobacillus ureae ( Au) reveal that this subunit is distinctly small. The enzyme completely lacks common N-terminal ATP-cone allosteric motifs that regulate overall activity, a process that normally occurs by dATP-induced formation of inhibitory quaternary structures to prevent productive ß subunit association. Class Id RNR activity is insensitive to dATP in the Fj and Au enzymes evaluated here, as expected. However, the class Id α protein from Fj adopts higher-order structures, detected crystallographically and in solution. The Au enzyme does not exhibit these quaternary forms. Our study reveals structural similarity between bacterial class Id and eukaryotic class Ia α subunits in conservation of an internal auxiliary domain. Our findings with the Fj enzyme illustrate that nucleotide-independent higher-order quaternary structures can form in simple RNRs with truncated or missing allosteric motifs.

Safety evaluation of 2'-deoxy-2'-fluoro nucleotides in GalNAc-siRNA conjugates.

For oligonucleotide therapeutics, chemical modifications of the sugar-phosphate backbone are frequently used to confer drug-like properties. Because 2'-deoxy-2'-fluoro (2'-F) nucleotides are not known to occur naturally, their safety profile was assessed when used in revusiran and ALN-TTRSC02, two short interfering RNAs (siRNAs), of the same sequence but different chemical modification pattern and metabolic stability, conjugated to an N-acetylgalactosamine (GalNAc) ligand for targeted delivery to hepatocytes. Exposure to 2'-F-monomer metabolites was low and transient in rats and humans. In vitro, 2'-F-nucleoside 5'-triphosphates were neither inhibitors nor preferred substrates for human polymerases, and no obligate or non-obligate chain termination was observed. Modest effects on cell viability and mitochondrial DNA were observed in vitro in a subset of cell types at high concentrations of 2'-F-nucleosides, typically not attained in vivo. No apparent functional impact on mitochondria and no significant accumulation of 2'-F-monomers were observed after weekly administration of two GalNAc-siRNA conjugates in rats for ∼2 years. Taken together, the results support the conclusion that 2'-F nucleotides can be safely applied for the design of metabolically stabilized therapeutic GalNAc-siRNAs with favorable potency and prolonged duration of activity allowing for low dose and infrequent dosing.

NOVEL ANALYTICAL STUDY FOR REACTION INTERMEDIATES IN THE PRIMARY RADIATION INTERACTION OF DNA USING A SYNCHROTRON RADIATION-INDUCED LUMINESCENCE SPECTROSCOPY.

To identify the precise molecular processes to induce DNA lesions, we attempt a novel spectroscopy of X-ray induced luminescence (XIL) using soft X-ray synchrotron radiation, which is a non-destructive analysis of the reaction intermediates in the elementary reaction pathway of damage induction and self-organized restoration. Using a liquid micro-jet technique to introduce aqueous samples in a vacuum chamber, we measure UV-visible luminescence from nucleotide solution as a function of the soft X-ray energy from the nitrogen to oxygen K-edge region. The XIL intensities for the nucleotide solutions are significantly enhanced in the soft X-ray region (410-530 eV) which is ascribed to the K-shell excitation/ionization of nitrogen atoms in the nucleobases. Furthermore, the XIL spectra do not show any signature of X-ray absorption near-edge structure (XANES) of the nucleobases. This is because the luminescence intensities collected from the integral area of the micro-jet only reflect the quantum yield of luminescence of the absorbed X-ray into UV-visible light irrespective of the absorption cross sections, i.e. of XANES. Thus the present result is the first evidence of luminescence as a result of X-ray absorption of aqueous nucleotides.