Prevalence of crimean Congo hemorrhagic fever in Khyber Pakhtunkhwa, Pakistan.

BACKGROUND: CCHFV is well recognized as a major public health threat and its prevalence and epidemiological distribution in Pakistan and specifically in KP province is not well documented. METHODS: We used a gold-standard PCR-based diagnostic assay for confirmation of CCHFV among suspected patients. A total of 150 patients were enrolled from June 2022 to September 2022 and their blood samples were collected for PCR confirmation. RESULTS: The overall positivity rate for CCHFV was 26.67 %, with the virus mostly prevalent in the middle-aged group (21-40 years). In the July of 2022, a significant spike in the prevalence of CCHFV was observed in provincial capital Peshawar with the highest burden (31.57 %). CONCLUSION: Our findings indicate the necessity of strengthening CCHFV monitoring programs and intensifying efforts to identify hotspot regions for effective surveillance and control of CCHFV. The months before the Eid-ul-Adha are crucial in the context of CCHFV control.

Epidemiologic Survey of Crimean-Congo Hemorrhagic Fever Virus in Suids, Spain.

We conducted a cross-sectional study in wild boar and extensively managed Iberian pig populations in a hotspot area of Crimean-Congo hemorrhagic fever virus (CCHFV) in Spain. We tested for antibodies against CCHFV by using 2 ELISAs in parallel. We assessed the presence of CCHFV RNA by means of reverse transcription quantitative PCR protocol, which detects all genotypes. A total of 113 (21.8%) of 518 suids sampled showed antibodies against CCHFV by ELISA. By species, 106 (39.7%) of 267 wild boars and 7 (2.8%) of 251 Iberian pigs analyzed were seropositive. Of the 231 Iberian pigs and 231 wild boars analyzed, none tested positive for CCHFV RNA. These findings indicate high CCHFV exposure in wild boar populations in endemic areas and confirm the susceptibility of extensively reared pigs to CCHFV, even though they may only play a limited role in the enzootic cycle.

Crimean-Congo Hemorrhagic Fever Virus in Ticks Collected from Cattle, Corsica, France, 2023.

We report the detection of Crimean-Congo hemorrhagic fever virus (CCHFV) in Corsica, France. We identified CCHFV African genotype I in ticks collected from cattle at 2 different sites in southeastern and central-western Corsica, indicating an established CCHFV circulation. Healthcare professionals and at-risk groups should be alerted to CCHFV circulation in Corsica.

Ticks infected with Crimean-Congo hemorrhagic fever virus (CCHFV): A decision approach systematic review and meta-analysis regarding their role as vectors.

BACKGROUND: There are many studies present in literature performed to isolate CCHFV from ticks. However, gaps in knowledge for estimating global annual CCHFV infection rates; global CCHFV infection rates and records; CCHFV infection trend in ticks and ticks infested animals; and lack a decision regarding the role of ticks as CCHFV vectors caused to conduct this review. METHODS: From 605 papers identified, 150 papers were selected to become the study meta-analysis (57 papers), detailed CCHFV infected ticks (63 papers), and systematic review (99 papers) parts. RESULTS: Since there are no significant differences between the annual tick CCHFV infection rates; tick CCHFV infection rates between continents; and CCHFV infection rates between tick species and gender of ticks, and ticks and tick species infested animals. Given that ticks are considered both as CCHFV reservoirs and vectors. It is possible a little burden of CCHFV in infected ticks in natural enzootic cycles to maintain and disseminate CCHFV in humans. The decision regarding the role of ticks as CCHFV vectors administrated based on the study and a separately literature search regarding the role of ticks as CCHFV vectors; CCHFV infection rates and records; and trend of CCHFV infection records in 31 tick species. The trend of CCHFV infection records in 31 tick species exhibited a decreasing trend indicating the degree and importance of their roles as CCHFV vectors. CONCLUSIONS: Among 31 CCHFV infected tick species, 15 species have been enrolled as proven vectors and 16 species are suspected as potential vectors.

Clinical and Molecular Epidemiology of Crimean-Congo Hemorrhagic Fever in Humans in Uganda, 2013-2019.

Crimean-Congo Hemorrhagic Fever (CCHF) is endemic in Uganda, yet its epidemiology remains largely uncharacterized. To better understand its occurrence within Uganda, case reports of patients hospitalized with CCHF between 2013 and 2019 were reviewed. Further, genome sequences of CCHF-positive RNA obtained during this period were determined for phylogenetic comparisons. We found that a total of 32 cases (75% males; CFR, 31.2%), aged between 9 to 68 years, were reported during the study period. Most cases were detected during July to December of each outbreak year (81.2%; P < 0.01) and were located along the "cattle corridor" (68.7%, P = 0.03). The most common presenting symptoms were fever (93.8%), hemorrhage (81.3%), headache (78.1%), fatigue (68.8%), vomiting (68.8%), and myalgia (65.6%). In five patients for whom hematological data were available, varied abnormalities were observed including thrombocytopenia, leukopenia, anemia, lymphopenia, lymphocytosis, polycythemia, and microcytosis. About 56.3% (P = 0.47) of patients reported tick bites or exposure to livestock as their potential source of infection. Person-to-person transmission was suspected for two cases. Using unbiased metagenomics, we found that the viral S- and L- segments have remained conserved in Africa 2 clade since the 1950s. In contrast, the M segment split into two geographically interspersed clades; one that belongs to Africa 2 and another that is ancestral to Africa 1 and 2. Overall, this data summarizes information on the history and clinical presentation of human CCHF in Uganda. Importantly, it identifies vulnerable populations as well as temporal and geographic regions in Uganda where surveillance and control interventions could be focused.

Sequential determination of viral load, humoral responses and phylogenetic analysis in fatal and non-fatal cases of Crimean-Congo hemorrhagic fever patients from Gujarat, India, 2019.

BACKGROUND: Thirty-four CCHF cases (17 fatal; 17 survived) were confirmed from Gujarat state, India during the year 2019. We aimed to find out the viral load, antibody kinetics, cytokine profile and phylogenetic analysis between fatal and non- fatal cases. METHODS: Thirty four cases were included in this study. Blood and urine samples were collected from all the cases on the day of admission to hospital. Non-fatal cases were followed weekly for understanding the profile of viral kinetics, anti-CCHFV IgM and IgG antibodies. We also quantified the cytokines in both fatal and non-fatal cases. For epidemiological correlation, livestock were screened for anti-CCHF IgG antibodies and the tick pool specimens were tested by real time RT-PCR. Virus isolation was attempted on tick pools and human specimens and phylogenetic analysis performed on human and ticks complete genome sequences. RESULTS: CCHF cases were detected throughout year in 2019 with the peak in August. Out of 34 cases, eight secondary CCHF cases were reported. Cases were predominantly detected in males and in 19-45 years age group (55.88%). The persistence of viremia was observed till 76th POD (post onset date) in one case whereas anti-CCHFV IgM and IgG was detected amongst these cases from the 2nd and 20th POD respectively. Positivity observed amongst livestock and tick pools were was 21.57% and 7.4% respectively. The cytokine analysis revealed a significant increase in the level of serum IL-6, IL-10 and IFN-γ during the acute phase of the infection, but interestingly IL-10 lowered to normal upon clearance of the virus in the clinically recovered case. Fatal cases had high viral RNA copy numbers. Bleeding from one or two mucosal sites was significantly associated with fatality (OR-16.47;p-0.0034 at 95% CI). We could do CCHF virus isolation from two cases. Phylogenetic analysis revealed circulation of re-assortment of Asian-West African genotypes in humans and ticks. CONCLUSIONS: The persistence of CCHF viral RNA was detected till 76th POD in one of the survivors. The circulation of a re-assortment Asian-West African genotype in a CCHF case is also reported first time from India.

Detection of Crimean-Congo hemorrhagic fever virus in blood-fed Hyalomma ticks collected from Mauritanian livestock.

BACKGROUND: Crimean-Congo hemorrhagic fever virus (CCHFV) belongs to the genus Orthonairovirus (Nairovididae) and is a (re)emerging tick-borne pathogen. It is endemic in most parts of Africa, Asia and southern Europe, and can cause severe hemorrhagic symptoms in humans, with high fatality rates (5-30%). METHODS: Hyalomma ticks were collected from four different livestock herds (cattle and camels) in Mauritania in 2018. The tick species were determined morphologically and confirmed molecularly by using the cytochrome oxidase 1 gene marker. For the detection of CCHFV, ticks were tested individually by one-step multiplex real-time reverse-transcriptase quantitative polymerase chain reaction. The small segment of all positive samples was sequenced to determine the CCHFV genotype. RESULTS: In total, 39 of the 1523 ticks (2.56%) collected from 63 cattles and 28 camels tested positive for CCHFV. Three Hyalomma species were identified. Hyalomma rufipes had the largest proportion of positivity (5.67%; 16/282), followed by Hyalomma dromedarii (1.89%; 23/1214). No Hyalomma impeltatum tested positive (0%; 0/21). Positive ticks were found in only six out of 91 host animals. Viral sequence analysis revealed the presence of two different CCHFV lineages (Africa I and Africa III). CONCLUSIONS: In this study, 2.56% of Hyalomma ticks collected from camels and cattle in Mauritania tested positive for CCHFV. However, the true prevalence of CCHFV in unfed ticks may be lower, as a considerable number of ticks may have been passively infected during blood-feeding by co-feeding ticks or due to viremia of the host. The results indicate the need to track the actual area of circulation of this virus.

Serologic and molecular evidence for circulation of Crimean-Congo hemorrhagic fever virus in ticks and cattle in Zambia.

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonosis with a high case fatality rate in humans. Although the disease is widely found in Africa, Europe, and Asia, the distribution and genetic diversity of CCHF virus (CCHFV) are poorly understood in African countries. To assess the risks of CCHF in Zambia, where CCHF has never been reported, epidemiologic studies in cattle and ticks were conducted. Through an indirect immunofluorescence assay, CCHFV nucleoprotein-specific serum IgG was detected in 8.4% (88/1,047) of cattle. Among 290 Hyalomma ticks, the principal vector of CCHFV, the viral genome was detected in 11 ticks. Phylogenetic analyses of the CCHFV S and M genome segments revealed that one of the detected viruses was a genetic reassortant between African and Asian strains. This study provides compelling evidence for the presence of CCHFV in Zambia and its transmission to vertebrate hosts.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Risk factors associated with exposure to Crimean-Congo haemorrhagic fever virus in animal workers and cattle, and molecular detection in ticks, South Africa.

Crimean-Congo haemorrhagic fever (CCHF) is a severe tick-borne viral zoonosis endemic to parts of Africa, Europe, the Middle East and Central Asia. Human cases are reported annually in South Africa, with a 25% case fatality rate since the first case was recognized in 1981. We investigated CCHF virus (CCHFV) seroprevalence and risk factors associated with infection in cattle and humans, and the presence of CCHFV in Hyalomma spp. ticks in central South Africa in 2017-18. CCHFV IgG seroprevalence was 74.2% (95%CI: 64.2-82.1%) in 700 cattle and 3.9% (95%CI: 2.6-5.8%) in 541 farm and wildlife workers. No veterinary personnel (117) or abattoir workers (382) were seropositive. The prevalence of CCHFV RNA was significantly higher in Hyalomma truncatum (1.6%) than in H. rufipes (0.2%) (P = 0.002). Seroprevalence in cattle increased with age and was greater in animals on which ticks were found. Seroprevalence in cattle also showed significant geographic variation. Seroprevalence in humans increased with age and was greater in workers who handled livestock for injection and collection of samples. Our findings support previous evidence of widespread high CCHFV seroprevalence in cattle and show significant occupational exposure amongst farm and wildlife workers. Our seroprevalence estimate suggests that CCHFV infections are five times more frequent than the 215 confirmed CCHF cases diagnosed in South Africa in the last four decades (1981-2019). With many cases undiagnosed, the potential seriousness of CCHF in people, and the lack of an effective vaccine or treatment, there is a need to improve public health awareness, prevention and disease control.

Crimean-Congo hemorrhagic fever virus antibody prevalence in Mauritanian livestock (cattle, goats, sheep and camels) is stratified by the animal's age.

Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most widespread zoonotic arthropod-borne viruses in many parts of Africa, Europe and Asia. It belongs to the family of Nairoviridae in the genus of Orthonairovirus. The main reservoir and vector are ticks of the genus Hyalomma. Livestock animals (such as cattle, small ruminants and camels) develop a viremias lasting up to two weeks with absence of clinical symptoms, followed by seroconversion. This study was carried out to assess risk factors that affect seroprevalence rates in different species. In total, 928 livestock animal samples (cattle = 201; sheep = 247; goats = 233; camels = 247) from 11 out of 13 regions in Mauritania were assayed for CCHFV-specific immunoglobulin G (IgG) antibodies using enzyme-linked immunosorbent assays (ELISA) (including a novel indirect camel-IgG-specific CCHFV ELISA). Inconclusive results were resolved by an immunofluorescence assay (IFA). A generalized linear mixed-effects model (GLMM) was used to draw conclusions about the impact of certain factors (age, species, sex and region) which might have influenced the CCHFV antibody status of surveyed animals. In goats and sheep, about 15% of the animals were seropositive, whereas in cattle (69%) and camels (81%), the prevalence rate was significantly higher. On average, cattle and camels were up to twice to four times older than small ruminants. Interestingly, the seroprevalence in all species was directly linked to the age of the animals, i.e. older animals had significantly higher seroprevalence rates than younger animals. The highest CCHFV seroprevalence in Mauritania was found in camels and cattle, followed by small ruminants. The large proportion of positive animals in cattle and camels might be explained by the high ages of the animals. Future CCHFV prevalence studies should at least consider the age of surveyed animals in order to avoid misinterpretations.

Update on prevalence and distribution pattern of tick-borne diseases among humans in India: a review.

In the present scenario, tick-borne diseases (TBDs) are well known for their negative impacts on humans as well as animal health in India. The reason lies in their increased incidences due to global warming, environmental and ecological changes, and availability of suitable habitats. On a global basis, they are now considered a serious threat to human as well as livestock health. The major tick-borne diseases in India include Kyasanur forest disease (KFD), Crimean-congo hemorrhagic fever (CCHF), Lyme disease (LD), Q fever (also known as coxiellosis), and Rickettsial infections. In recent years, other tick-borne diseases such as Babesiosis, Ganjam virus (GANV), and Bhanja virus (BHAV) infections have also been reported in India. The purpose of this paper is to review the history and the current state of knowledge of tick-borne diseases in the country. The conclusion of this review is extending the requirement of greater efforts in research and government management for the diagnosis and treatment and as well as prevention of these diseases so that tick-borne disease burden should be minimizing in India.

Evaluation of seroprevalence and clinical and laboratory findings of patients admitted to health institutions in Gümüshane with suspicion of Crimean-Congo hemorrhagic fever

Background/aim: To determine the seroprevalence and evaluate clinical findings and laboratory results of patients prediagnosed with Crimean-Congo hemorrhagic fever (CCHF) in Gümüshane. Materials and methods: Included in the cross-sectional study were 362 patients (162 female, 200 male) between 0 and 94 years of age, who were followed up after receiving a preliminary diagnosis of CCHF between January 2011 and December 2019. Anamnesis, age, sex, clinical findings, laboratory results, epidemiological and clinical evaluations, severity criteria, risk factor reviews, and a comparison of the suspected negative cases with positive cases were analyzed retrospectively. Patients included in the study were evaluated as RNA- positive by polymerase chain reaction (PCR) or IgM-positive by ELISA. Results: Of the 362 patients admitted to health institutions with a preliminary diagnosis of CCHF, 242 were diagnosed as CCHF- positive (66.9%). Moreover, 196 of those CCHF-positive patients (81%) were admitted to health institutions during the summer months. Statistical analyses revealed a significant relationship between the incidence of CCHF and patients who had been in contact with animals, lived in rural areas, and had engaged in farming and animal husbandry. In addition, fever, headache, diffuse bodily pain, nausea and vomiting, diarrhea, fever of 38 °C or higher, tachycardia, elevated ALT/AST, creatine kinase (CK), and lactate dehydrogenase (LDH) levels, leukopenia, and thrombocytopenia were detected in the CCHF-positive patients. Significant relations were found between this disease and these symptoms. However, there was no significant relationship between the statistical evaluation of the disease and bloody diarrhea, bodily bruises, rash, unconsciousness, gingival bleeding, hypotension, epistaxis, petechiae, splenomegaly, ecchymosis, hematuria, maculopapular rash, gastrointestinal system complaints, anemia, or elevation of the international normalized ratio and activated partial thromboplastin time duration, separately. Conclusion: Of the 362 patients, 66.9% (242) of those who received a preliminary diagnosis of CCHF were indeed CCHF-positive in Gümüshane. It was concluded that CCHF remains an important endemic disease in Gümüshane. In addition, elevated ALT/AST, CK, and LDH levels, leukopenia, and thrombocytopenia in patients presenting with headache, fever, fever of 38 °C or higher, generalized body pain, nausea/vomiting, diarrhea, and tachycardia will play a pivotal role in the preliminary diagnosis of CCHF.

New circulation of genotype V of Crimean-Congo haemorrhagic fever virus in humans from Spain.

BACKGROUND: Crimean-Congo haemorrhagic fever (CCHF) is a widespread tick-borne viral disease caused by the Crimean-Congo haemorrhagic fever virus (CCHFV). CCHFV has been implicated in severe viral haemorrhagic fever outbreaks. During the summer of 2016, the first two cases with genotype III (Africa 3) were reported in Spain. The first objective of our study was to determine the presence of CCHFV among patients with febrile illness during the spring and summer periods in 2017 and 2018. Finally, we perform a phylogenetic analysis to determine the genotype of the virus. METHODOLOGY: We prospectively evaluated patients aged 18 years and older who came to the emergency department at the Salamanca's University Hospital (HUS) with fever. Specific IgM and IgG antibodies against CCHFV by ELISA and one immunofluorescence assay against two different proteins (nucleoprotein and glycoprotein C) was done. Moreover, molecular detection by Real Time PCR was performed in all collected samples. A phylogenetic analysis was carried out to genetically characterize CCHFV detected in this study. PRINCIPAL FINDINGS: A total of 133 patients were selected. The mean age was 67.63 years and 60.9% were male. One-third of the patients presented an acute undifferentiated febrile illness. Three patients had anti-CCHFV IgG antibodies, suggesting a previous infection. One patient had anti-CCHFV IgM antibodies and a confirmatory RT-PCR. Phylogenetic analysis indicated that the virus corresponds to the European genotype V. This patient came to the emergency department at HUS in August 2018 presenting an acute febrile syndrome with thrombopenia and liver impairment. CONCLUSIONS: We describe a new circulation of European genotype V CCHFV in Spain. Moreover, this study suggests that CCHFV is an identifiable cause of febrile illness of unknown origin in Spain. Thus, CCHF could be suspected in patients with fever, liver damage, and/or haemorrhagic disorders, particularly in people with risk activities who present in the spring or summer.

Utility of a Sequence-Independent, Single-Primer-Amplification (SISPA) and Nanopore Sequencing Approach for Detection and Characterization of Tick-Borne Viral Pathogens.

Currently, next generation sequencing (NGS) is the mainly used approach for identification and monitorization of viruses with a potential public health threat in clinical and environmental samples. To facilitate detection in NGS, the sequence-independent, single-primer-amplification (SISPA) is an effective tool for enriching virus sequences. We performed a preliminary assessment of SISPA-nanopore sequencing as a potential approach for screening tick-borne viruses in six specimens with detectable Crimean-Congo hemorrhagic fever virus (CCHFV) and Jingmen tick virus (JMTV) sequences. A comparison of unbiased NGS and SISPA followed by nanopore sequencing was carried out in 4 specimens with single and pooled ticks. The approach was further used for genome sequencing in culture-grown viruses. Overall, total/virus-specific read counts were significantly elevated in cell culture supernatants in comparison to single or pooled ticks. Virus genomes could be successfully characterized by SISPA with identities over 99%. Genome coverage varied according to the segment and total read count. Base calling errors were mainly observed in tick specimens and more frequent in lower viral loads. Culture-grown viruses were phylogenetically-related to previously-reported local viruses. In conclusion, the SISPA + nanopore sequencing was successful in generating data comparable to NGS and will provide an effective tool for broad-range virus detection in ticks.

Arboviruses in the Astrakhan region of Russia for 2018 season: The development of multiplex PCR assays and analysis of mosquitoes, ticks, and human blood sera.

The Astrakhan region of Russia is endemic for the number of arboviruses. In this paper, we describe the results of the detection of the list of neglected arboviruses in the Astrakhan region for the 2018 season. For the purpose of the study in-house PCR assays for detection of 18 arboviruses have been developed and validated using arboviruses obtained from Russian State Collection of Viruses. Pools of ticks (n = 463) and mosquitoes (n = 312) as well as 420 samples of human patients sera have been collected and analyzed. Using developed multiplex real-time PCR assays we were able to detect RNA of eight arboviruses (Crimean-Congo hemorrhagic fever virus, Dhori (Batken strain) virus, Batai virus, Tahyna virus, Uukuniemi virus, Inkoo virus, Sindbis virus and West Nile fever virus). All discovered viruses are capable of infecting humans causing fever and in some cases severe forms with hemorrhagic or neurologic symptoms. From PCR-positive samples, we were able to recover one isolate each of Dhori (Batken strain) virus and Crimean-Congo hemorrhagic fever virus which were further characterized by next-generation sequencing. The genomic sequences of identified Dhori (Batken strain) virus strain represent the most complete genome of Batken virus strain among previously reported.

Detection of Hyalomma rufipes in a recently arrived asylum seeker to the EU.

The importation of novel tick species to Europe and the emergence of tick-borne diseases have been of rising concern over the last decades. In May 2019, a total of 349 asylum seekers arrived in Malta by boat. Public health syndromic surveillance was conducted on all migrant boat arrivals. The incidental finding of a tick with anomalous morphology in a newly arrived migrant in Malta prompted an epidemiological investigation. Morphological identification of the tick followed by species identification using keys specific to North Africa was conducted and molecular testing for Crimean Congo haemorrhagic fever virus (CCHFV) was performed. Detailed interview and clinical examination of the case were conducted on arrival and follow-up interviews were undertaken 1- and 4-weeks post-arrival. A Hyalomma rufipes tick was identified on the chest of a 28-year-old male from Sudan. The patient reported malaise and headache on arrival. No further symptoms were reported during follow-up. There was no evidence of previous CCHFV infection or the presence of other ticks or pathogens on the patient. The investigation revealed that the H. rufipes tick had likely been acquired in Libya. This is the first report of the presence of a H. rufipes tick, the main vector for CCHFV, on a recently arrived migrant in Europe. This event highlights the importance of increasing awareness on the risk of tick-borne infections among recently arrived migrants in the Mediterranean countries and the need to consider tick screening as part of the health screening offered in the EU.

Detection of new Crimean-Congo haemorrhagic fever virus genotypes in ticks feeding on deer and wild boar, Spain.

Crimean-Congo haemorrhagic fever virus (CCHFV) is the causative agent of the severe tick-borne, often fatal, zoonotic Crimean-Congo haemorrhagic fever (CCHF), which is widely distributed worldwide. The CCHFV transmission to humans occurs through tick bite, crushing of engorged ticks or contact with infected host blood. Previously, CCHFV genotype Africa III was reported in Spain. Given the emergence of CCHF and the role of ticks in pathogen maintenance and transmission, we investigated the presence and genotype identity of the virus in tick species parasitizing abundant wild host species in south-western Spain. A total of 613 adult ticks were collected from hunter-harvested wild ungulates in twenty locations throughout south-western Spain. Ticks were identified, nucleic acids were extracted, RNA was analysed by a nested RT-PCR targeting CCHFV S segment, and the amplicons were sequenced. According to the 212-bp sequence amplified, the presence of CCHFV human genotype Europe V was detected in Hyalomma lusitanicum and Dermacentor marginatus ticks collected from red deer, fallow deer and Eurasian wild boar in different locations from south-western Spain. Genotype Africa IV was also detected in a H. lusitanicum tick collected from a red deer. The detection of CCHFV in different tick species collected from various wild hosts and localities provided strong evidence of widespread CCHFV presence in the region, suggesting that the circulation of the virus in Spain requires more attention. Additionally, the identification of the CCHFV genotype Europe V in ticks suggested that its introduction in Spain was probably from Eastern Europe.

New geographical area on the map of Crimean-Congo hemorrhagic fever virus: First serological evidence in the Hungarian population.

Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne disease that is endemic in Africa, Asia, the Middle East, and the Balkan region of Europe; the disease is spreading northwards following widespread distribution of the main vector, Hyalomma marginatum, which was first found in Hungary in 2011. The aim of this pilot sero-surveillance study was to assess CCHF seroprevalence in Hungary. A total of 2700 serum samples obtained from healthy volunteer blood donors were screened using an in-house immunofluorescence assay and a commercially available ELISA kit. We found ten (0.37 %) seropositive donors. The western and central regions proved to be the most affected areas, with a prevalence of 2.97 %. Higher positivity was found among male donors (0.55 %) and younger donors (18-34 years; 0.78 %). Based on these results, a more extended surveillance focusing on specific at-risk populations and animals is advised. The results should also raise the awareness of clinicians and other high-risk populations, such as foresters and hunters, about the emerging threat of CCHF in Hungary.

Epidemiological investigation of Crimean-Congo haemorrhagic fever virus infection among the one-humped camels (Camelus dromedarius) in southern Tunisia.

Crimean-Congo haemorrhagic fever is a viral tick-borne zoonotic disease caused by a Nairovirus, Crimean-Congo haemorrhagic fever virus (CCHFV). The present survey aimed to determine the exposure of one-humped camels (Camelus dromedarius) from southern Tunisia to CCHFV. A total of 273 sera from extensively reared camels were collected from Tataouine district, Tunisia, and tested by CCHFV-specific enzyme linked immunosorbent assays. By combining the results of three serological tests, the overall seroprevalence of CCHFV was estimated as 89.7% (245/273). No viral RNA was detected from camel sera using quantitative real-time PCR (RT-qPCR). A total of 165 ticks were collected from camels and tested with RT-qPCR, and only one Hyalomma impeltatum tick was positive for virus RNA.