Evasion of wheat resistance gene Lr15 recognition by the leaf rust fungus is attributed to the coincidence of natural mutations and deletion in AvrLr15 gene.

Employing race-specific resistance genes remains an effective strategy to protect wheat from leaf rust caused by Puccinia triticina (Pt) worldwide, while the newly emerged Pt races, owing to rapid genetic evolution, frequently overcome the immune response delivered by race-specific resistance genes. The molecular mechanisms underlying the newly evolved virulence Pt pathogen remain unknown. Here, we identified an avirulence protein AvrLr15 from Pt that induced Lr15-dependent immune responses. Heterologously produced AvrLr15 triggered pronounced cell death in Lr15-isogenic wheat leaves. AvrLr15 contains a functional signal peptide, localized to the plant nucleus and cytosol and can suppress BAX-induced cell death. Evasion of Lr15-mediated resistance in wheat was associated with a deletion and point mutations of amino acids in AvrLr15 rather than AvrLr15 gene loss in the Lr15-breaking Pt races, implying that AvrLr15 is required for the virulence function of Pt. Our findings identified the first molecular determinant of wheat race-specific immunity and facilitated the identification of the first AVR/R gene pair in the Pt-wheat pathosystem, which will provide a molecular marker to monitor natural Pt populations and guide the deployment of Lr15-resistant wheat cultivars in the field.

Identification of a Novel Deletion Variant (c.2999_3005delTGTGTGT/p.Asn1000SerfsTer4) in NPHP4 Associated With Nephronophthisis-4.

BACKGROUND: Nephronophthisis-4 (NPHP4) is an inherited renal ciliopathy described by renal fibrosis and progressive impairment of kidney function. This study aimed to investigate the genetic basis and clinical manifestations of NPHP4 in two Iranian siblings. METHODS: The proband was a 27-year-old male with features of end-stage renal disease, including anemia, uremia, polyuria, and polydipsia. It is worth mentioning that he has a 22-year-old sister with a similar presentation. Clinical diagnosis procedures, such as renal biopsy, brain imaging, blood and urine tests, cardiac evaluation, ophthalmic inspection, and auditory function assessment, were carried out to evaluate organ involvement and potential comorbidities. Whole-exome sequencing (WES) and segregation analysis were performed to identify and confirm genetic variants associated with the condition. Computational variant analysis was conducted to evaluate the pathogenicity of the candidate variant. Furthermore, the SWISS-MODEL server was utilized for protein modeling. RESULTS: The brain, cardiac, ocular, and auditory functions were normal. Renal biopsy of the proband showed chronic interstitial inflammation and fibrosis. We found a novel homozygous 7-base pair deletion (c.2999_3005delTGTGTGT/ p.Asn1000SerfsTer4) in exon 21 of NPHP4 by WES. Segregation analysis confirmed homozygosity for the NPHP4 variant in affected individuals and heterozygous carrier status in parents, supporting autosomal recessive inheritance. 3D protein modeling indicated significant structural changes due to the variant. CONCLUSION: This study expands the genetic causes and phenotypic spectrum of nephronophthisis-4 and reveals the importance of genetic analysis in diagnosing and managing rare inherited kidney disorders, particularly those involving consanguinity.

Ancestry of the major long-range regulatory site of the α-globin genes in the Portuguese population with the common 3.7 kb α-thalassemia deletion.

BACKGROUND: The α-Major Regulatory Element (α-MRE), also known as HS-40, is located upstream of the α-globin gene cluster and has a crucial role in the long-range regulation of the α-globin gene expression. This enhancer is polymorphic and several haplotypes were identified in different populations, with haplotype D almost exclusively found in African populations. The purpose of this research was to identify the HS-40 haplotype associated with the 3.7 kb α-thalassemia deletion (-α3.7del) in the Portuguese population, and determine its ancestry and influence on patients' hematological phenotype. METHODS AND RESULTS: We selected 111 Portuguese individuals previously analyzed by Gap-PCR to detect the presence of the -α3.7del: 50 without the -α3.7del, 34 heterozygous and 27 homozygous for the -α3.7del. The HS-40 region was amplified by PCR followed by Sanger sequencing. Four HS-40 haplotypes were found (A to D). The distribution of HS-40 haplotypes and genotypes are significantly different between individuals with and without the -α3.7del, being haplotype D and genotype AD the most prevalent in patients with this deletion in homozygosity. Furthermore, multiple correspondence analysis revealed that individuals without the -α3.7del are grouped with other European populations, while samples with the -α3.7del are separated from these and found more closely related to the African population. CONCLUSION: This study revealed for the first time an association of the HS-40 haplotype D with the -α3.7del in the Portuguese population, and its likely African ancestry. These results may have clinical importance as in vitro analysis of haplotype D showed a decrease in its enhancer activity on α-globin gene.

Severe manifestation of Rauch-Azzarello syndrome associated with biallelic deletion of CTNND2.

CTNND2 encodes δ-catenin, a component of an adherens junction complex, and plays an important role in neuronal structure and function. To date, only heterozygous loss-of-function CTNND2 variants have been associated with mild neurodevelopmental delay and behavioral anomalies, a condition, which we named Rauch-Azzarello syndrome. Here, we report three siblings of a consanguineous family of Syrian descent with a homozygous deletion encompassing the last 19 exons of CTNND2 predicted to disrupt the transcript. All presented with severe neurodevelopmental delay with absent speech, profound motor delay, stereotypic behavior, microcephaly, short stature, muscular hypotonia with lower limb hypertonia, and variable eye anomalies. The parents and the fourth sibling were heterozygous carriers of the deletion and exhibited mild neurodevelopmental impairment resembling that of the previously described heterozygous individuals. The present study unveils a severe manifestation of CTNND2-associated Rauch-Azzarello syndrome attributed to biallelic loss-of-function aberrations, clinically distinct from the already described mild presentation of heterozygous individuals. Furthermore, we demonstrate novel clinical features in homozygous individuals that have not been reported in heterozygous cases to date.

Cryptic proteins translated from deletion-containing viral genomes dramatically expand the influenza virus proteome.

Productive infections by RNA viruses require faithful replication of the entire genome. Yet many RNA viruses also produce deletion-containing viral genomes (DelVGs), aberrant replication products with large internal deletions. DelVGs interfere with the replication of wild-type virus and their presence in patients is associated with better clinical outcomes. The DelVG RNA itself is hypothesized to confer this interfering activity. DelVGs antagonize replication by out-competing the full-length genome and triggering innate immune responses. Here, we identify an additionally inhibitory mechanism mediated by a new class of viral proteins encoded by DelVGs. We identified hundreds of cryptic viral proteins translated from DelVGs. These DelVG-encoded proteins (DPRs) include canonical viral proteins with large internal deletions, as well as proteins with novel C-termini translated from alternative reading frames. Many DPRs retain functional domains shared with their full-length counterparts, suggesting they may have activity during infection. Mechanistic studies of DPRs derived from the influenza virus protein PB2 showed that they poison replication of wild-type virus by acting as dominant-negative inhibitors of the viral polymerase. These findings reveal that DelVGs have a dual inhibitory mechanism, acting at both the RNA and protein level. They further show that DPRs have the potential to dramatically expand the functional proteomes of diverse RNA viruses.

A Novel Homozygous Deletion Including Exon 1 of FA2H Gene Causes Spastic Paraplegia-35: Genetic and Lipidomics Analysis of the Patients.

BACKGROUND: Fatty acid 2-hydroxylase (FA2H) is encoded by the FA2H gene, with mutations therein leading to the neurodegenerative condition, spastic paraplegia-35 (SPG35). We aim to elucidate the genetic underpinnings of a nonconsanguineous Chinese family diagnosed with SPG35 by examining the clinical manifestations, scrutinizing genetic variants, and establishing the role of FA2H mutation in lipid metabolism. METHODS: Using next-generation sequencing analysis to identify the pathogenic gene in this pedigree and family cosegregation verification. The use of lipidomics of patient pedigree peripheral blood mononuclear cells further substantiated alterations in lipid metabolism attributable to the FA2H exon 1 deletion. RESULTS: The proband exhibited gait disturbance from age 5 years; he developed further clinical manifestations such as scissor gait and dystonia. His younger sister also presented with a spastic gait from the same age. We identified a homozygous deletion in the region of FA2H exon 1, spanning from chr16:74807867 to chr16: 74810391 in the patients. Lipidomic analysis revealed significant differences in 102 metabolites compared with healthy controls, with 62 metabolites increased and 40 metabolites decreased. We specifically zeroed in on 19 different sphingolipid metabolites, which comprised ceramides, ganglioside, etc., with only three of these sphingolipids previously reported. CONCLUSIONS: This is the first study of lipid metabolism in the blood of patients with SPG35. The results broaden our understanding of the SPG35 gene spectrum, offering insights for future molecular mechanism research and laying groundwork for determining metabolic markers.

Homozygous deletion of the DSG3 terminal exon associated with acantholytic blistering of the oral and laryngeal mucosa.

We report a novel homozygous 49.6 kb deletion of chromosome 18q12.1 involving the last exon of DSG3 in dizygotic twins with phenotype consistent with acantholytic blistering of the oral and laryngeal mucosa (ABOLM). The twin siblings presented predominantly with friability of the laryngeal and respiratory mucosa. This is only the second report in the literature of this unusual autosomal recessive blistering disorder. The diagnosis explains the mucosal phenotype of a pemphigus-like disorder without evidence of autoimmune dysfunction. The exclusion of an autoimmune basis has management implications. The deletion also involved the DSG2 gene, which is associated with arrhythmogenic right ventricular dysplasia (ARVD). The affected siblings and heterozygous parents do not show any cardiac phenotype at this time. Functional studies would further clarify how deletions resulting in loss of function of DSG3 may cause the reported phenotypes of DSG3-related ABOLM.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Correlation between the insertion-deletion variant of the angiotensin-converting enzyme gene and various classes of heart failure.

The angiotensin-converting enzyme (ACE) genetic variation for insertion/deletion (I/D) is located at the 16th intron of the ACE gene. A number of studies investigated the homozygous deletion genotype of ACE and its association with cardiovascular diseases. However, ACE's genetic variation and its association with heart failure (HF) is yet to be confirmed. We examined the possibility of the association between the ACE I/D gene variant with the severity of HF. The ACE genotypes were determined by polymerase chain reactions using samples derived from 150 patients with HF and 90 healthy subjects which were age and gender-matched. These patients included those of all four of the New York Heart Association (NYHA) classes. Echocardiography was performed on all HF patients and ejection fraction (EF), left ventricular systolic and diastolic diameters were measured. The HF patients were redistributed to systolic where EF is equal and less than 45% and non-systolic HF where EF is more than 45%. We demonstrate a statistically significant difference in DD genotype in NYHA class IV in comparison to the control group. The values of odds ratio (OR) (95%CI) of the DD genotype (DD vs ID and II) were 3.37 (1.01-11.19) (p value = 0.039) and the OR (95%CI) of the D allele (D vs I) was 2.55 (0.98-6.65) (p value = 0.049). Higher frequencies of D allele compared to I allele is linked to severity of HF. DD variant of the ACE gene is associated with NYHA class IV heart failure. This could have a profound impact on risk stratification and prognosis of HF in the management of this condition.

Novel homozygous LAMB1 in-frame deletion in a pediatric patient with brain anomalies and cerebrovascular event.

Biallelic pathogenic variants in LAMB1 have been associated with autosomal recessive lissencephaly 5 (OMIM 615191), which is characterized by brain malformations (cobblestone lissencephaly, hydrocephalus), developmental delay, and epilepsy. Pathogenic variants in LAMB1 are rare, with only 11 pathogenic variants and 11 patients reported to date. Here, we report on a 6-year-old patient from a consanguineous family with profound developmental delay, microcephaly, and a history of a perinatal cerebrovascular event. Brain magnetic resonance imaging (MRI) showed cerebellar cystic defects, signal intensity abnormalities, and a hypoplastic corpus callosum. Trio-exome analysis revealed a homozygous in-frame deletion of Exons 23 and 24 of LAMB1 affecting 104 amino acids including the epidermal growth factor (EGF)-like units 11 and 12 in Domain III. To our knowledge, this is the first reported in-frame deletion in LAMB1. Our findings broaden the clinical and molecular spectrum of LAMB1-associated syndromes.

A Putative Zn(II)2Cys6-Type Transcription Factor FpUme18 Is Required for Development, Conidiation, Cell Wall Integrity, Endocytosis and Full Virulence in Fusarium pseudograminearum.

Fusarium pseudograminearum is one of the major fungal pathogens that cause Fusarium crown rot (FCR) worldwide and can lead to a substantially reduced grain yield and quality. Transcription factors play an important role in regulating growth and pathogenicity in plant pathogens. In this study, we identified a putative Zn(II)2Cys6 fungal-type domain-containing transcription factor and named it FpUme18. The expression of FpUME18 was induced during the infection of wheat by F. pseudograminearum. The ΔFpume18 deletion mutant showed defects in growth, conidial production, and conidial germination. In the responses to the cell wall, salt and oxidative stresses, the ΔFpume18 mutant inhibited the rate of mycelial growth at a higher rate compared with the wild type. The staining of conidia and mycelia with lipophilic dye FM4-64 revealed a delay in endocytosis when FpUME18 was deleted. FpUME18 also positively regulated the expression of phospholipid-related synthesis genes. The deletion of FpUME18 attenuated the pathogenicity of wheat coleoptiles. FpUME18 also participated in the production of the DON toxin by regulating the expression of TRI genes. Collectively, FpUme18 is required for vegetative growth, conidiation, stress response, endocytosis, and full virulence in F. pseudograminearum.

Whole-genome and Epigenomic Landscapes of Malignant Gastrointestinal Stromal Tumors Harboring KIT Exon 11 557-558 Deletion Mutations.

Gastrointestinal stromal tumors (GIST) with KIT exon 11 deletions involving in codons 557-558 (KIT Δ557-558) exhibit higher proliferation rates and shorter disease-free survival times compared with GISTs with other KIT exon 11 mutations. We analyzed 30 GIST cases and observed genomic instability and global DNA hypomethylation only in high-risk malignant GISTs with KIT Δ557-558. Whole-genome sequencing revealed that the high-risk malignant GISTs with KIT Δ557-558 (12 cases) had more structural variations (SV), single-nucleotide variants, and insertions and deletions compared with the low-risk, less malignant GISTs with KIT Δ557-558 (six cases) and the high-risk (six cases) or low-risk (6 cases) GISTs with other KIT exon 11 mutations. The malignant GISTs with KIT Δ557-558 showed higher frequency and significance in copy number (CN) reduction on chromosome arms 9p and 22q, and 50% of them had LOH or CN-dependent expression reduction in CDKN2A. In addition, SVs with driver potential were detected in 75% of them, in which AKT3 and MGMT were recurrently identified. Genome-wide DNA methylation and gene expression analyses showed global intergenic DNA hypomethylation, SNAI2 upregulation, and higher expression signatures, including p53 inactivation and chromosomal instability, as characteristics of malignant GISTs with KIT Δ557-558 that distinguished them from other GISTs. These genomic and epigenomic profiling results revealed that KIT Δ557-558 mutations are associated with increased genomic instability in malignant GISTs. Significance: We present genomic and epigenomic insights into the malignant progression of GISTs with KIT exon 11 deletions involving in 557-558, demonstrating their unique chromosomal instability and global intergenic DNA hypomethylation.

Autosomal recessive congenital cataract is associated with a novel 4-bp splicing deletion mutation in a novel C10orf71 human gene.

Congenital cataract is one of the most genetically heterogeneous ocular conditions with different genes involved in its etiology. Here, we describe the analysis of a new candidate gene of a congenital bilateral cataract associated with polymalformative syndrome, moderate global developmental delay, microcephaly, axial hypotonia, intrauterine growth restriction and facial dysmorphism for two affected siblings. Molecular analysis included exome sequencing and genome wide homozygosity mapping revealed a region of homozygosity shared by the two affected siblings at 10q11.23. The new C10orf71 gene was included in this interval and direct sequencing of this gene revealed an already described homozygous c. 2123T > G mutation (p. L708R) for the two affected subjects. Interestingly, we revealed in contrast a 4-bp deletion on the 3'-splicing acceptor site of intron 3-exon 4, namely defined as IVS3-5delGCAA. The C10Orf71 gene expression analysis using RT-PCR showed an expression pattern in different fetal organs and tissues as well as in leukocytes and confirmed that the IVS3-5delGCAA deletion of the C10orf71 gene is a splicing mutation responsible for the shortening of the C10orf71 protein in the two related patients. The C10orf71 gene has not been described to date as associated to the autosomal recessive phenotype.

Nanopore sequencing identifies a higher frequency and expanded spectrum of mitochondrial DNA deletion mutations in human aging.

Mitochondrial DNA (mtDNA) deletion mutations cause many human diseases and are linked to age-induced mitochondrial dysfunction. Mapping the mutation spectrum and quantifying mtDNA deletion mutation frequency is challenging with next-generation sequencing methods. We hypothesized that long-read sequencing of human mtDNA across the lifespan would detect a broader spectrum of mtDNA rearrangements and provide a more accurate measurement of their frequency. We employed nanopore Cas9-targeted sequencing (nCATS) to map and quantitate mtDNA deletion mutations and develop analyses that are fit-for-purpose. We analyzed total DNA from vastus lateralis muscle in 15 males ranging from 20 to 81 years of age and substantia nigra from three 20-year-old and three 79-year-old men. We found that mtDNA deletion mutations detected by nCATS increased exponentially with age and mapped to a wider region of the mitochondrial genome than previously reported. Using simulated data, we observed that large deletions are often reported as chimeric alignments. To address this, we developed two algorithms for deletion identification which yield consistent deletion mapping and identify both previously reported and novel mtDNA deletion breakpoints. The identified mtDNA deletion frequency measured by nCATS correlates strongly with chronological age and predicts the deletion frequency as measured by digital PCR approaches. In substantia nigra, we observed a similar frequency of age-related mtDNA deletions to those observed in muscle samples, but noted a distinct spectrum of deletion breakpoints. NCATS-mtDNA sequencing allows the identification of mtDNA deletions on a single-molecule level, characterizing the strong relationship between mtDNA deletion frequency and chronological aging.