Colorimetric sensor array for versatile detection and discrimination of model analytes with environmental relevance.

In the current work, a rapid, simple, low-cost, and sensitive smartphone-based colorimetric sensor array coupled with pattern-recognition methods was proposed for the determination and differentiation of some organic and inorganic bases (i.e., OH-, CO32-, PO43-, NH3, ClO-, diethanolamine, triethanolamine) as model compounds. The sensing system has been designed based on color-sensitive dyes (Fuchsine, Giemsa, Thionine, and CoCl2) which were used as sensor elements. The color changes of a sensor array were observed by the naked eye. The color patterns were recorded using digital imaging in a three-dimensional (red, green, and blue) space and quantitatively analyzed with color calibration techniques. Distinctive colorimetric patterns for target bases via linear discriminant analysis (LDA) and hierarchical clustering analysis (HCA) were observed. The results indicated that the analytes related to each class (at the different concentration levels in the range of 0.001-1.0 mol L-1) were clustered together in the canonical discriminant plot and HCA dendrogram with high sensitivity and an overall precision of 85%. Furthermore, the first function factor of LDA correlated with the concentration of each target analyte in a correlation coefficient (R2) range of 0.864-0.996. These described procedures based on the colorimetric sensor array technique could be a promising candidate for practical applications in package technology and facile detection of pollutants.

Fluorimetric detection of DNA methylation by cerium oxide nanoparticles for early cancer diagnosis.

In this study, a very sensitive fluorescence nano-biosensor was developed using CeO2 nanoparticles for the rapid detection of DNA methylation. The characteristics of CeO2 nanoparticles were determined by transmission electron microscopy (TEM), scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), X-ray diffraction (XRD) spectroscopy, UV-visible spectroscopy, and fluorescence spectroscopy. The CeO2 nanoparticles were reacted with a single-stranded DNA (ssDNA) probe, and then methylated and unmethylated target DNAs hybridized with an ssDNA probe, and the fluorescence emission was measured. Upon adding the target unmethylated and methylated ssDNA, the fluorescence intensity increased in the linear range of concentration from 2 × 10-13 - 10-18 M. The limit of detection (LOD) was 1.597 × 10-6 M for methylated DNA and 1.043 × 10-6 M for unmethylated DNA. The fluorescence emission intensity of methylated sequences was higher than of that unmethylated sequences. The fabricated DNA nanobiosensor showed a fluorescence emission at 420 nm with an excitation wavelength of 280 nm. The impact of CeO2 binding on methylated and unmethylated DNA was further demonstrated by agarose gel electrophoresis. Finally, the actual sample analysis suggested that the nanobiosensor could have practical applications for detecting methylation in the human plasma samples.

Iron/iron oxide-based magneto-electrochemical sensors/biosensors for ensuring food safety: recent progress and challenges in environmental protection.

Foodborne diseases have arisen due to the globalization of industry and the increase in urban population, which has led to increased demand for food and has ultimately endangered the quality of food. Foodborne diseases have caused some of the most common public health problems and led to significant social and economic issues worldwide. Food quality and safety are affected by microbial contaminants, growth-promoting feed additives (ß-agonists and antibiotics), food allergens, and toxins in different stages from harvesting to storage and marketing of products. Electrochemical biosensors, due to their reduced size and portability, low cost, and low consumption of reagents and samples, can quickly provide valuable quantitative and qualitative information about food contamination. In this regard, using nanomaterials can increase the sensitivity of the assessment. Magnetic nanoparticle (MNP)-based biosensors, especially, are receiving significant attention due to their low-cost production, physicochemical stability, biocompatibility, and eco-friendly catalytic characteristics, along with magnetic, biological, chemical and electronic sensing features. Here, we provide a review on the application of iron-based magnetic nanoparticles in the electrochemical sensing of food contamination. The types of nanomaterials used in order to improve the methods and increase the sensitivity of the methods have been discussed. Then, we stated the advantages and limitations of each method and tried to state the research gaps for each platform/method. Finally, the role of microfluidic and smartphone-based methods in the rapid detection of food contamination is stated. Then, various techniques like label-free and labelled regimes for the sensitive monitoring of food contamination were surveyed. Next, the critical role of antibody, aptamer, peptide, enzyme, DNA, cells and so on for the construction of specific bioreceptors for individual and simultaneous recognition by electrochemical methods for food contamination were discussed. Finally, integration of novel technologies such as microfluidic and smartphones for the identification of food contaminations were investigated. It is important to point out that, in the last part of each sub-section, attained results of different reports for each strategy were compared and advantages/limitations were mentioned.

Optical bio-sensing of DNA methylation analysis: an overview of recent progress and future prospects.

DNA methylation as one of the most important epigenetic modifications has a critical role in regulating gene expression and drug resistance in treating diseases such as cancer. Therefore, the detection of DNA methylation in the early stages of cancer plays an essential role in disease diagnosis. The majority of routine methods to detect DNA methylation are very tedious and costly. Therefore, designing easy and sensitive methods to detect DNA methylation directly and without the need for molecular methods is a hot topic issue in bioscience. Here we provide an overview on the optical biosensors (including fluorescence, FRET, SERs, colorimetric) that have been applied to detect the DNA methylation. In addition, various types of labeled and label-free reactions along with the application of molecular methods and optical biosensors have been surveyed. Also, the effect of nanomaterials on the sensitivity of detection methods is discussed. Furthermore, a comprehensive overview of the advantages and disadvantages of each method are provided. Finally, the use of microfluidic devices in the evaluation of DNA methylation and DNA damage analysis based on smartphone detection has been discussed.

Microfluidic assisted recognition of miRNAs towards point-of-care diagnosis: Technical and analytical overview towards biosensing of short stranded single non-coding oligonucleotides.

MiRNAs are short stranded single non-coding oligonucleotides that play an important role in regulating gene expression. MiRNAs are stable in RNase enriched environments such as human body fluids and their dysregulation or abnormal abundance in human body fluids as a diagnostic biomarker has been associated with several diseases. Due to the low concentration of miRNAs, it is difficult to detect using interactive methods (ideal detection limit is femtomolar range). However, clinicians lack sensitive and reliable methods for quantifying miRNA. Microfluidic devices integrated with electrochemical, optical (fluorometric, SERs, FRET, colorimetric), electrochemiluminescence and photoelectrochemical signal readout led to development innovative diagnostic device test, can probably overcome the limitations of the traditional methods. In the present review, microfluid methods for the sensitive and selective recognition of miRNA in various biological matrices are surveyed. Also, advantages and limitation of recognition methods on the performance and efficiency of microfluidic based biosensing of miRNAs are critically investigated. Finally, the future perspectives on the diagnosis of disease based on microfluidic analysis of miRNAs are provided.

An innovative fluorometric bioanalysis strategy towards recognition of DNA methylation using opto-active polymer: A new platform for DNA damage studies by genosensor technology.

Efficient pharmacotherapy of cancer is related to accurate recognition of genetic mutations and epigenetic alterations in the early-stage diagnosis. In the present study, a novel optical genosensor based on toluidine blue as photonic probe was developed to detection of DNA methylation using hybridization of pDNA with cDNA. Biomedical analysis was performed using UV-vis and fluorometric methods. For the first time, this strategy was applied for the distinction of methylated DNA from unmethylated-DNA-based on the interaction of optical probe with methylated-DNA and unmethylated DNA. Fluorescence spectroscopic data showed that poly-toluidine blue could be bind to DNA sequences and lead to different fluorescence patterns and could be used as an efficient geno-platform for the sensitive bioassay of mutation. The excitation and emission wavelengths were 580 and 630 nm, respectively. Non-binding of mismatch sequences with the optical probe was used as negative control. Under optimal conditions, linear range was 1 zM to 0.2 pm and the lower limit of quantitation was obtained as target concentrations ranging 1 zM. The designed genosensor showed high capability to distinct methylation from un-methylated. Therefore, the designed DNA-based bioassay could detect DNA methylation significantly. Finally, bioanalysis of real samples showed that the designed genosensor could use to detect DNA methylation which is a new platform for point of care analysis.

Reliable recognition of DNA methylation using bioanalysis of hybridization on the surface of Ag/GQD nanocomposite stabilized on poly (ß-cyclodextrin): A new platform for DNA damage studies using genosensor technology.

Due to the role of DNA methylation in causing cancer in the present study, an innovative and inexpensive method was designed for the sensitive detection of DNA methylation. The silver-graphene quantum dots (Ag/GQDs) nano ink with high electrical conductivity was used as a substrate for genosensor fabrication toward identification of DNA hybridization. Also, poly (ß-cyclodextrin) (p[ß-CD]) has been used as a biointerface for the stabilization of Ag/GQD nano ink. The thiolated pDNA strand (5'-SH-TCCGCTTCCCGACCCGCACTCCGC-3') (as bioreceptor element) was fixed on the substrate and hybridized with methylated (5'-GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA-3') and unmethylated (5'-GCGGAGTGCGGGTCGGGAAGCGGA-3') cDNAs, as target sequences were studied using electroanalysis methods. Under optimal conditions and using electrochemical techniques, the linear range was 1 am to 1 pm with LLOQ of 1aM. Finally, the designed DNA genosensor was used for detection of DNA methylation in human plasma samples and can be used to detect methylation in patient samples. It is expected that the designed DNA-based biodevice will be used to early stage diagnosis of cancer using monitoring of DNA methylation. Also, this type of genosensor can be used for epigenetic studies in the near future.

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis.

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label-free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer). Hybridization of pDNA (TCCGCTTCCCGACCCGCACTCCGC) with various types of cDNA sequences was studied by UV-visible and fluorescence spectroscopy. Also, some of the mismatch sequences {(GC(M)GGAGTAC(M)GGGTC(M)GGGAAGC(M)GGA) and (GCGGAGTACGGGTCGGGAAGCGGA)} were applied as negative control. For this purpose, The synthesized optical probe was characterized by transmission electron microscopy, atomic force microscopy, dynamic light scattering, zeta potential, energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, UV-Vis, and fluorescence spectroscopy. Under optimal conditions, the analytical performance of engineered DNA-based assay was studied and exhibited excellent dynamic range (1 zM to 3 pM) with low limit of quantitation (LLOQ) of 1 zM. The designed DNA-based assay showed a high capability of discriminating methylation, unmethylated and mismatched sequences. The engineered genosensor is simple and inexpensive and can detect DNA methylation with high sensitivity. Therefore, the designed geno-assay could detect DNA methylation significantly and discriminate from unmethylated DNA. It is expected that the proposed geno-assay could be used for the detection of DNA methylation, genetic mutations, epigenetic alterations, and early stage diagnosis of various cancer toward efficient clinical pharmacotherapy.

Application of lateral flow and microfluidic bio-assay and biosensing towards identification of DNA-methylation and cancer detection: Recent progress and challenges in biomedicine.

DNA methylation is an important epigenetic alteration that results from the covalent transfer of a methyl group to the fifth carbon of a cytosine residue in CpG dinucleotides by DNA methyltransferase. This modification mostly happens in the promoter region and the first exon of most genes and suppresses gene expression. Therefore, aberrant DNA methylation cause tumor progression, metastasis, and resistance to current anti-cancer therapies. So, the detection of DNA methylation is an important issue in diagnosis and therapy of most diseases. Conventional methods for the assay of DNA methylation and activity of DNA methyltransferases are time consuming. So, we need to multiplex operations and expensive instrumentation. To overcome the limitations of conventional methods, new methods such as microfluidic platforms and lateral flow tests have been developed to evaluate DNA methylation. The microfluidic tests are based on optical and electrical biosensing. These tests able us to can analyze DNA methylation with high efficiency and sensitivity without the need for expensive equipment and skilled people. Lateral flow strip tests are another type of rapid, simple, and sensitive test with advanced technology used to assess DNA methylation. Lateral flow strip tests are based on optical biosensors. This review attempts to evaluate new methods for assessing DNA extraction, DNA methylation and DNA methyltransferase activity as well as recent developments in microfluidic technology application for bisulfite treatment and restriction enzyme (bisulfite free), and lateral flow relying on their application in the field of recognition of DNA methylation in blood and body fluids. Also, the advantages and disadvantages of each test are reviewed. Finally, future prospects for the development of the microfluidics biodevices for the detection of DNA methylation is briefly discussed.

The TP53 intron 6 G13964C polymorphism and risk of thyroid and breast cancer development in the Iranian Azeri population.

BACKGROUND: TP53 mutations are the most common genetic alterations in human cancers. There are also several polymorphisms in both exons and introns of TP53 that may influence its anti-tumor functions and increase the risk of cancer development. Associations of the TP53 intron 6 G13964C polymorphism with increased risk of development of several cancers have been investigated in numerous studies, but the results were controversial and conflicting. In this study, we aimed to investigate the probable association of this polymorphism with risk of both thyroid and breast cancers among the Iranian-Azeri population. MATERIALS AND METHODS: We performed two separate case control studies on associations of the intron 6 polymorphism with two different kinds of cancer. In one case-control study, a total of 75 patients with thyroid carcinoma and 180 controls were analyzed and the other study included 170 patients with breast cancer and 135 healthy women. The intron 6 genotype was determined by RFLP-PCR and the SPSS 16 program was applied for data analysis. RESULTS: For thyroid cancer, the frequencies of GG genotype were 96.0% in patients and 93.3% in controls. The GC genotype had a frequency of 4.0% in patients and 6.7% in controls. In the study on breast cancer, the frequency of GG and GC genotypes in patients were 95.3% and 4.7%, respectively. In breast related control group, the frequency of GG genotype was 93.3% and the frequency of GC genotype was 6.7%. None of the cases and controls had the CC genotype. CONCLUSIONS: There was no significant association between the TP53 intron 6 G13964C polymorphism and risk of development of both thyroid and breast cancer in Iranian-Azeri patients.