Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 3 de 3
Filter
Add more filters










Database
Language
Publication year range
1.
Amino Acids ; 55(12): 1745-1764, 2023 Dec.
Article in English | MEDLINE | ID: mdl-37500789

ABSTRACT

About 30% of malignant tumors include KRAS mutations, which are frequently required for the development and maintenance of malignancies. KRAS is now a top-priority cancer target as a result. After years of research, it is now understood that the oncogenic KRAS-G12C can be targeted. However, many other forms, such as the G13D mutant, are yet to be addressed. Here, we used a receptor-based pharmacophore modeling technique to generate potential inhibitors of the KRAS-G13D oncogenic mutant. Using a comprehensive virtual screening workflow model, top hits were selected, out of which CSC01 was identified as a promising inhibitor of the oncogenic KRAS mutant (G13D). The stability of CSC01 upon binding the switch II pocket was evaluated through an exhaustive molecular dynamics simulation study. The several post-simulation analyses conducted suggest that CSC01 formed a stable complex with KRAS-G13D. CSC01, through a dynamic protein-ligand interaction profiling analysis, was also shown to maintain strong interactions with the mutated aspartic acid residue throughout the simulation. Although binding free energy analysis through the umbrella sampling approach suggested that the affinity of CSC01 with the switch II pocket of KRAS-G13D is moderate, our DFT analysis showed that the stable interaction of the compound might be facilitated by the existence of favorable molecular electrostatic potentials. Furthermore, based on ADMET predictions, CSC01 demonstrated a satisfactory drug likeness and toxicity profile, making it an exemplary candidate for consideration as a potential KRAS-G13D inhibitor.


Subject(s)
Colorectal Neoplasms , Proto-Oncogene Proteins p21(ras) , Humans , Proto-Oncogene Proteins p21(ras)/genetics , Colorectal Neoplasms/pathology , Mutation , Molecular Dynamics Simulation
2.
Int J Biol Macromol ; 220: 973-984, 2022 Nov 01.
Article in English | MEDLINE | ID: mdl-35977596

ABSTRACT

Tumor microenvironment (TME) is a crucial regulator of tumor progression and cells in the TME release a number of molecules that are responsible for anaplasticity, invasion, metastasis of tumor, establishing stem cell niches, up-regulation and down-regulation of various pathways in cancer cells, interfering with immune surveillance and immune escape. Moreover, they can serve as diagnostic markers, and determine effective therapies. Among them, CircRNAs have gained special attention due to their involvement in mutated pathways in cancers. By functioning as a molecular sponge for miRNAs, binding with proteins, and directing selective splicing. CircRNAs modify the immunological environment of cancers to promote their growth. Besides of critical role in tumor growth, circRNAs are emerging as potential candidates as biomarkers for diagnosis cancer therapy. Also, circRNAs vaccination even offers a novel approach to tumor immunotherapy. Over the recent years, studies are advocating that circRNAs have tissue specific tumor specific expression patterns, which indicates their potential clinical utility. Especially, circRNAs have emerged as potential predictive and prognostic biomarkers. Although, there has been significant progress in deciphering the role of circRNA in cancers, literature lacks comprehensive overview on this topic. Keeping in view of these significant discoveries, this review systematically discusses circRNA and their role in the tumor in different dimensions.


Subject(s)
MicroRNAs , Neoplasms , Biomarkers , Disease Progression , Humans , MicroRNAs/genetics , Neoplasms/diagnosis , Neoplasms/genetics , Neoplasms/therapy , RNA, Circular/genetics , Tumor Microenvironment/genetics
3.
ChemistrySelect ; 7(7): e202103903, 2022 Feb 18.
Article in English | MEDLINE | ID: mdl-35601809

ABSTRACT

The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.

SELECTION OF CITATIONS
SEARCH DETAIL
...