ABSTRACT
Successful crop production depends initially on the availability of high-quality seed. By 2050 global climate change will have influenced crop yields, but will these changes affect seed quality? The present review examines the effects of elevated carbon dioxide (CO2) and temperature during seed production on three seed quality components: seed mass, germination and seed vigour. In response to elevated CO2, seed mass has been reported to both increase and decrease in C3 plants, but not change in C4 plants. Increases are greater in legumes than non-legumes, and there is considerable variation among species. Seed mass increases may result in a decrease of seed nitrogen (N) concentration in non-legumes. Increasing temperature may decrease seed mass because of an accelerated growth rate and reduced seed filling duration, but lower seed mass does not necessarily reduce seed germination or vigour. Like seed mass, reported seed germination responses to elevated CO2 have been variable. The reported changes in seed C/N ratio can decrease seed protein content which may eventually lead to reduced viability. Conversely, increased ethylene production may stimulate germination in some species. High-temperature stress before developing seeds reach physiological maturity (PM) can reduce germination by inhibiting the ability of the plant to supply the assimilates necessary to synthesize the storage compounds required for germination. Nothing is known concerning the effects of elevated CO2 on seed vigour. However, seed vigour can be reduced by high-temperature stress both before and after PM. High temperatures induce or increase the physiological deterioration of seeds. Limited evidence suggests that only short periods of high-temperature stress at critical seed development stages are required to reduce seed vigour, but further research is required. The predicted environmental changes will lead to losses of seed quality, particularly for seed vigour and possibly germination. The seed industry will need to consider management changes to minimize the risk of this occurring.
ABSTRACT
Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 µm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the ß-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with ß-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.
ABSTRACT
School-based health centers are critical resources for providing and coordinating health and medical services for children and adolescents. As such, they are an increasingly important component in a strategy to meet the comprehensive health, social, and educational needs of students and families. We show how educators and health professionals, using the language, methods and principles of continuous improvement, can collaborate effectively in addressing the specific concerns of school attendance and teen smoking.