Gut microbiota: a potential influencer of insomnia occurring after COVID-19 infection.

The prevalence of insomnia has increased in recent years, significantly affecting the lives of many individuals. Coronavirus disease 2019 (COVID-19) infection has been found to have a substantial impact on the human gut microbiota (GM). Clinical studies have shown that the high prevalence, prolonged duration, and refractory treatment of insomnia symptoms following the COVID-19 pandemic may be related to the effect of COVID-19 infection on the GM. Therefore, the GM may be a potential target for the treatment of insomnia following COVID-19 infection. However, relevant studies have not been well-documented, and the GM has not been sufficiently analyzed in the context of insomnia treatment. Herein, we review the interaction between sleep and the GM, summarize the characteristics of COVID-19-induced abnormal changes in the GM and metabolites in patients with insomnia, and discuss potential mechanisms, including metabolic, immune, and neural pathways, by which these abnormal changes in the GM cause insomnia as well as the factors affecting the GM. Finally, we discuss the prospect of modulating the host GM community for the effective treatment of insomnia after COVID-19 infection and the need for further clinical studies.

3D Printing Properties of Heat-Induced Sodium Alginate-Whey Protein Isolate Edible Gel.

The objective of this study was to develop a food 3D printing gel and investigate the effects of whey protein isolate (WPI), sodium alginate (SA), and water-bath heating time on the 3D printing performance of the gel. Initially, the influence of these three factors on the rheological properties of the gel was examined to determine the suitable formulation ranges for 3D printing. Subsequently, the formulation was optimized using response surface methodology, and texture analysis, scanning electron microscopy (SEM), and Fourier-transform infrared (FTIR) spectroscopy were conducted. The rheological results indicated that gels with WPI concentrations of 6-7 g, SA concentrations of 0.8-1.2 g, and water-bath heating times of 10-12 min exhibited lower yield stress and better self-supporting properties. The optimized formulation, determined through response surface methodology, consisted of 1.2 g SA, 6.5 g WPI, and a heating time of 12 min. This optimized formulation demonstrated enhanced extrusion capability and superior printing performance. SEM analysis revealed that the optimized gel possessed good mechanical strength, and FTIR spectroscopy confirmed the successful composite formation of the gel. Overall, the results indicate that the optimized gel formulation can be successfully printed and exhibits excellent 3D printing performance.

A non-canonical role for a small nucleolar RNA in ribosome biogenesis and senescence.

Cellular senescence is an irreversible state of cell-cycle arrest induced by various stresses, including aberrant oncogene activation, telomere shortening, and DNA damage. Through a genome-wide screen, we discovered a conserved small nucleolar RNA (snoRNA), SNORA13, that is required for multiple forms of senescence in human cells and mice. Although SNORA13 guides the pseudouridylation of a conserved nucleotide in the ribosomal decoding center, loss of this snoRNA minimally impacts translation. Instead, we found that SNORA13 negatively regulates ribosome biogenesis. Senescence-inducing stress perturbs ribosome biogenesis, resulting in the accumulation of free ribosomal proteins (RPs) that trigger p53 activation. SNORA13 interacts directly with RPL23, decreasing its incorporation into maturing 60S subunits and, consequently, increasing the pool of free RPs, thereby promoting p53-mediated senescence. Thus, SNORA13 regulates ribosome biogenesis and the p53 pathway through a non-canonical mechanism distinct from its role in guiding RNA modification. These findings expand our understanding of snoRNA functions and their roles in cellular signaling.

Association between COVID-19 vaccination and menstruation: a state of the science review.

INTRODUCTION: Menstrual health is a key patient-reported outcome beyond its importance as a general indicator of health and fertility. However, menstrual function was not measured in the clinical trials of COVID-19 vaccines. The purpose of this review was to synthesise the existing literature on the relationship between COVID-19 vaccination and menstrual health outcomes. METHODS: A PubMed search to 31 October 2023 identified a total of 53 publications: 11 prospective cohort studies, 11 retrospective cohort studies or registry-based cohort studies, and 31 cross-sectional or retrospective case-control studies. RESULTS: Identified studies were generally at moderate-to-high risk of bias due to retrospective design, interviewer bias, and failure to include a non-vaccinated control group. Nonetheless, the bulk of the literature demonstrates that COVID-19 vaccine is associated with temporary changes in menstrual characteristics (cycle length and flow) and menstrual pain. Follicular phase (at the time of vaccination) is associated with greater increases in cycle length. Evidence suggests temporary post-vaccine menstrual changes in adolescents, abnormal vaginal bleeding in postmenopausal individuals, and a potential protective effect of using hormonal contraception. CONCLUSIONS: In this review we found evidence supporting an association between the COVID-19 vaccine and menstrual health outcomes. Given the importance of menstrual function to overall health, we recommend that all future vaccine trials include menstruation as a study outcome. Future vaccine studies should include rigorous assessment of the menstrual cycle as an outcome variable to limit sources of bias, identify biological mechanisms, and elucidate the impact of stress.

Lifetime History of Low Birth Weight Delivery and Cognitive Function in Middle-Aged Parous Women.

BACKGROUND AND OBJECTIVES: Pregnancy outcomes such as low birth weight (LBW) delivery may reflect vascular or metabolic dysfunction in mothers and presage future cognitive impairment and dementia. However, the evidence is currently limited. Our objective was to examine the extent to which a lifetime history of LBW delivery was associated with cognitive function in parous middle-aged women. METHODS: We studied participants from the Nurses' Health Study II, an ongoing longitudinal cohort of female nurses enrolled in 1989. In 2009, participants completed a reproductive history questionnaire. Participants who completed at least one of 2 post-traumatic stress disorder questionnaires were invited to participate in a cognition substudy with 2 waves of baseline data collection (2014 or 2018). We restricted the analysis to participants with one valid cognitive assessment who reported ≥1 birth at 18 years and older. We defined LBW delivery history as having delivered offspring with a birth weight <2,500 g (<5.5 lbs) in any pregnancy. The outcome was a single assessment of cognitive function evaluated with the self-administered Cogstate Brief Battery. The battery comprises 4 tasks, which we used to create 2 composite z-scores measuring psychomotor speed/attention and learning/working memory (higher z-scores = better cognitive function). We used multivariable linear regression models. RESULTS: The analysis included 15,323 participants with a mean age of 62 (standard deviation: 4.9 years) at cognitive assessment. Among them, 1,224 (8%) had a history of LBW delivery. After adjusting for age at cognitive assessment, race, and ethnicity, participants' education, wave of baseline cognitive assessment, socioeconomic status, and prepregnancy characteristics, women with a history of LBW delivery had lower z-scores in the psychomotor speed/attention (ß, -0.06; 95% CI -0.12 to -0.01) and learning/working memory (ß, -0.05; 95% CI -0.09 to -0.01) composites than parous women without a history of LBW delivery. We observed a gradient of lower z-scores with an increasing number of LBW deliveries. DISCUSSION: History of LBW delivery may be marker of future poorer cognition. If confirmed, our findings support future investigations into the value of early preventive efforts targeting women with a history of LBW delivery to reduce the burden of cognitive impairment in women.

BMI status and weight trajectories across females' reproductive years and risk of adverse pregnancy outcomes: a prospective cohort study.

BACKGROUND: Prepregnancy body mass index (BMI) is a well-established risk factor of adverse pregnancy outcomes (APOs). The associations of long-term and short-term weight trajectories with APOs are less clear. OBJECTIVES: This study aimed to determine the associations of weight trajectories during females' reproductive years, before and between pregnancies, with risk of APOs. METHODS: We followed 16,241 females (25,386 singleton pregnancies) participating in a prospective cohort, the Nurses' Health Study II. Weight at age 18 y, current weight, and height were assessed at baseline (1989), and weight was updated biennially. Pregnancy history was self-reported in 2009. The primary outcome was a composite of hypertensive disorders of pregnancy (HDP), gestational diabetes (GDM), preterm birth, and stillbirth. Secondary outcomes were individual APOs. The associations of weight change with APOs were estimated using log-binomial regression, adjusting for demographic, lifestyle, reproductive factors, and baseline BMI (in kg/m2). RESULTS: The mean (standard deviation [SD]) age at first in-study pregnancy was 33.7 (4.1) y. The mean (SD) time from age 18 y to pregnancy, baseline to pregnancy, and between pregnancies was 16.3 (4.0), 6.1 (3.0), and 2.9 (1.6) y, with a corresponding weight change of 6.4 (9.1), 3.1 (5.8), and 2.3 (4.8) kg, respectively. Of the pregnancies, 4628 (18.2%) were complicated by ≥1 APOs. Absolute weight change since age 18 y was most strongly associated with APOs. Compared with females whose weight remained stable (0-2 kg) since age 18, females who gained >2 kg had higher risk of APO (2.1-9.9 kg, relative risk [RR]: 1.12; 95% confidence interval [CI]: 1.02, 1.23; 10.0-14.9 kg, RR: 1.43; 95% CI: 1.29, 1.60; ≥15 kg, RR: 1.87; 95% CI: 1.69, 2.08), primarily driven by HDP and GDM. The associations of per 1 kg weight gain before and between pregnancies with HDP were nearly identical. CONCLUSIONS: Weight trajectories prior to and between pregnancies were associated with the risk of APOs, particularly HDP. Longer periods of weight gain, corresponding to greater absolute weight gain, were most strongly associated with higher risk of APOs.

On-Site and Visual Detection of the H5 Subtype Avian Influenza Virus Based on RT-RPA and CRISPR/Cas12a.

Avian influenza viruses (AIVs) of the H5 subtype rank among the most serious pathogens, leading to significant economic losses in the global poultry industry and posing risks to human health. Therefore, rapid and accurate virus detection is crucial for the prevention and control of H5 AIVs. In this study, we established a novel detection method for H5 viruses by utilizing the precision of CRISPR/Cas12a and the efficiency of RT-RPA technologies. This assay facilitates the direct visualization of detection results through blue light and lateral flow strips, accurately identifying H5 viruses with high specificity and without cross-reactivity against other AIV subtypes, NDV, IBV, and IBDV. With detection thresholds of 1.9 copies/µL (blue light) and 1.9 × 103 copies/µL (lateral flow strips), our method not only competes with but also slightly surpasses RT-qPCR, demonstrating an 80.70% positive detection rate across 81 clinical samples. The RT-RPA/CRISPR-based detection method is characterized by high sensitivity, specificity, and independence from specialized equipment. The immediate field applicability of the RT-RPA/CRISPR approach underscores its importance as an effective tool for the early detection and management of outbreaks caused by the H5 subtype of AIVs.

Neutrophils in glioma microenvironment: from immune function to immunotherapy.

Glioma is a malignant tumor of the central nervous system (CNS). Currently, effective treatment options for gliomas are still lacking. Neutrophils, as an important member of the tumor microenvironment (TME), are widely distributed in circulation. Recently, the discovery of cranial-meningeal channels and intracranial lymphatic vessels has provided new insights into the origins of neutrophils in the CNS. Neutrophils in the brain may originate more from the skull and adjacent vertebral bone marrow. They cross the blood-brain barrier (BBB) under the action of chemokines and enter the brain parenchyma, subsequently migrating to the glioma TME and undergoing phenotypic changes upon contact with tumor cells. Under glycolytic metabolism model, neutrophils show complex and dual functions in different stages of cancer progression, including participation in the malignant progression, immune suppression, and anti-tumor effects of gliomas. Additionally, neutrophils in the TME interact with other immune cells, playing a crucial role in cancer immunotherapy. Targeting neutrophils may be a novel generation of immunotherapy and improve the efficacy of cancer treatments. This article reviews the molecular mechanisms of neutrophils infiltrating the central nervous system from the external environment, detailing the origin, functions, classifications, and targeted therapies of neutrophils in the context of glioma.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Streamlining social media information retrieval for public health research with deep learning.

OBJECTIVE: Social media-based public health research is crucial for epidemic surveillance, but most studies identify relevant corpora with keyword-matching. This study develops a system to streamline the process of curating colloquial medical dictionaries. We demonstrate the pipeline by curating a Unified Medical Language System (UMLS)-colloquial symptom dictionary from COVID-19-related tweets as proof of concept. METHODS: COVID-19-related tweets from February 1, 2020, to April 30, 2022 were used. The pipeline includes three modules: a named entity recognition module to detect symptoms in tweets; an entity normalization module to aggregate detected entities; and a mapping module that iteratively maps entities to Unified Medical Language System concepts. A random 500 entity samples were drawn from the final dictionary for accuracy validation. Additionally, we conducted a symptom frequency distribution analysis to compare our dictionary to a pre-defined lexicon from previous research. RESULTS: We identified 498 480 unique symptom entity expressions from the tweets. Pre-processing reduces the number to 18 226. The final dictionary contains 38 175 unique expressions of symptoms that can be mapped to 966 UMLS concepts (accuracy = 95%). Symptom distribution analysis found that our dictionary detects more symptoms and is effective at identifying psychiatric disorders like anxiety and depression, often missed by pre-defined lexicons. CONCLUSIONS: This study advances public health research by implementing a novel, systematic pipeline for curating symptom lexicons from social media data. The final lexicon's high accuracy, validated by medical professionals, underscores the potential of this methodology to reliably interpret, and categorize vast amounts of unstructured social media data into actionable medical insights across diverse linguistic and regional landscapes.

Investigation of Additive-Manufactured Carbon Fiber-Reinforced Polyethylene Terephthalate Honeycomb for Application as Non-Pneumatic Tire Support Structure.

A non-pneumatic tire (NPT) overcomes the shortcomings of a traditional pneumatic tire such as wear, punctures and blowouts. In this respect, it shows great potential in improving driving safety, and has received great attention in recent years. In this paper, a carbon fiber-reinforced polyethylene terephthalate (PET/CF) honeycomb is proposed as a support structure for NPTs, which can be easily prepared using 3D printing technology. The experimental results showed that the PET/CF has high strength and modulus and provides excellent mechanical properties. Then, a finite element (FE) model was established to predict the compression performance of auxetic honeycombs. Good agreement was achieved between the experimental data and FE analysis. The influence of the cell parameters on the compressive performance of the support structure were further analyzed. Both the wall thickness and the vertically inclined angle could modulate the mechanical performance of the NPT. Finally, the application of vertical force is used to analyze the static load of the structure. The PET/CF honeycomb as the support structure of the NPT showed outstanding bearing capacity and stiffness in contrast with elastomer counterparts. Consequently, this study broadens the material selection for NPTs and proposes a strategy for manufacturing a prototype, which provides a reference for the design and development of non-pneumatic tires.

Associations of anti-Müllerian hormone levels among women in their mid-30s with menopausal symptoms ~14 years later.

OBJECTIVE: The aim of this study was to examine associations of anti-Müllerian hormone (AMH) levels in gravid women in their mid-30s with menopausal symptoms ~14 years later and age at natural menopause. METHODS: In this prospective analysis, 474 participants in Project Viva, a longitudinal cohort, were enrolled during pregnancy between 1999 and 2002. AMH levels were determined using plasma samples collected 3 years postpartum. Participants completed the Menopause Rating Scale (MRS) and self-reported age at and reason for menopause at the 17 years postpartum visit (Mid-Life Visit). Primary outcomes were individual MRS item responses and total MRS score. To examine associations between AMH levels and menopausal outcomes, we performed linear and logistic regressions, and survival analyses, adjusting for confounding variables. RESULTS: Mean (SD) AMH level was 2.80 (2.74) ng/mL, measured at 38.2 (3.9) years. At the Mid-Life Visit, mean (SD) age was 52.3 (3.9) years and total MRS score was 8.0 (5.7). During follow-up, 50% had experienced natural menopause, and self-reported mean (SD) age at natural menopause was 50.4 (3.6) years. AMH in the lowest tertile (mean [SD]: 0.47 [0.32] ng/mL) was associated with higher odds of moderate to severe vaginal dryness (adjusted odds ratio: 2.58; 95% CI: 1.16 to 5.73), a lower MRS psychological subscale (adjusted ß: -0.71; 95% CI: -1.35 to -0.07), and earlier attainment of natural menopause (adjusted hazards ratio: 7.1; 95% CI: 4.6 to 11.0) compared with AMH in the highest tertile (mean [SD]: 6.01 [2.37] ng/mL). CONCLUSIONS: Lower AMH in the mid-30s was associated with earlier menopause and increased odds of vaginal dryness but fewer psychological symptoms ~14 years later.

Simulation of Starch Gel Printing and Deformation Process Using COMSOL.

The food industry holds immense promise for 3D printing technology. Current research focuses mainly on optimizing food material composition, molding characteristics, and printing parameters. However, there is a notable lack of comprehensive studies on the shape changes of food products, especially in modeling and simulating deformations. This study addresses this gap by conducting a detailed simulation of the starch gel printing and deformation process using COMSOL Multiphysics 6.2 software. Additive manufacturing (AM) technology is widely acclaimed for its user-friendly operation and cost-effectiveness. The 3D printing process may lead to changes in part dimensions and mechanical properties, attributable to the accumulation of residual stresses. Studies require a significant amount of time and effort to discover the optimal composition of the printed material and the most effective deformed 3D structure. There is a risk of failure, which can lead to wasted resources and research delays. To tackle this issue, this study thoroughly analyzes the physical properties of the gel material through COMSOL Multiphysics 6.2 software, It simulates the heat distribution during the 3D printing process, providing important insights into how materials melt and solidify. Three-part models with varying aspect ratios were meticulously designed to explore shape changes during both the printing process and exposure to an 80 °C environment, employing NMR and rheological characterization. Using the generalized Maxwell model for material simulation in COMSOL Multiphysics, the study predicted stress and deformation of the parts by analyzing solid heat transfer and solid mechanics physical fields. Simulation results showed that among three models utilizing a gel-PET plastic membrane bilayer structure, Model No. 1, with the largest aspect ratio, exhibited the most favorable deformation under an 80 °C baking environment. It displayed uniform bending in the transverse direction without significant excess warpage in the edge direction. In contrast, Models No. 2 and No. 3 showed varying degrees of excess warpage at the edges, with Model No. 3 exhibiting a more pronounced warpage. These findings closely aligned with the actual printing outcomes.

Biodegradation of the strobilurin fungicide pyraclostrobin by Burkholderia sp. Pyr-1: Characteristics, degradation pathway, water remediation, and toxicity assessment.

Pyraclostrobin, a widely used fungicide, poses significant risks to both the environment and human health. However, research on the microbial degradation process of pyraclostrobin was scarce. Here, a pyraclostrobin-degrading strain, identified as Burkholderia sp. Pyr-1, was isolated from activated sludge. Pyraclostrobin was efficiently degraded by strain Pyr-1, and completely eliminated within 6 d in the presence of glucose. Additionally, pyraclostrobin degradation was significantly enhanced by the addition of divalent metal cations (Mn2+ and Cu2+). The degradation pathway involving ether bond and N-O bond cleavage was proposed by metabolite identification. The sodium alginate-immobilized strain Pyr-1 had a higher pyraclostrobin removal rate from contaminated lake water than the free cells. Moreover, the toxicity evaluation demonstrated that the metabolite 1-(4-chlorophenyl)-1H-pyrazol-3-ol significantly more effectively inhibited Chlorella ellipsoidea than pyraclostrobin, while its degradation products by strain Pyr-1 alleviated the growth inhibition of C. ellipsoidea, which confirmed that the low-toxic metabolites were generated from pyraclostrobin by strain Pyr-1. The study provides a potential strain Pyr-1 for the bioremediation in pyraclostrobin-contaminated aquatic environments.

High-throughput sequencing and characterization of potentially pathogenic fungi from the vaginal mycobiome of giant panda (Ailuropoda melanoleuca) in estrus and non-estrus.

Introduction: The giant panda (Ailuropoda melanoleuca) reproduction is of worldwide attention, and the vaginal microbiome is one of the most important factors affecting the reproductive rate of giant pandas. The aim of this study is to investigate the diversity of vaginal mycobiota structure, and potential pathogenic fungi in female giant pandas during estrus and non-estrus. Methods: This study combined with high-throughput sequencing and laboratory testing to compare the diversity of the vaginal mycobiota in giant pandas during estrus and non-estrus, and to investigate the presence of potentially pathogenic fungi. Potentially pathogenic fungi were studied in mice to explore their pathogenicity. Results and discussion: The results revealed that during estrus, the vaginal secretions of giant pandas play a crucial role in fungal colonization. Moreover, the diversity of the vaginal mycobiota is reduced and specificity is enhanced. The abundance of Trichosporon and Cutaneotrichosporon in the vaginal mycobiota of giant pandas during estrus was significantly higher than that during non-estrus periods. Apiotrichum and Cutaneotrichosporon were considered the most important genera, and they primarily originate from the environment owing to marking behavior exhibited during the estrous period of giant pandas. Trichosporon is considered a resident mycobiota of the vagina and is an important pathogen that causes infection when immune system is suppressed. Potentially pathogenic fungi were further isolated and identified from the vaginal secretions of giant pandas during estrus, and seven strains of Apiotrichum (A. brassicae), one strain of Cutaneotrichosporon (C. moniliiforme), and nine strains of Trichosporon (two strains of T. asteroides, one strain of T. inkin, one strain of T. insectorum, and five strains of T. japonicum) were identified. Pathogenicity results showed that T. asteroides was the most pathogenic strain, as it is associated with extensive connective tissue replacement and inflammatory cell infiltration in both liver and kidney tissues. The results of this study improve our understanding of the diversity of the vaginal fungi present in giant pandas and will significantly contribute to improving the reproductive health of giant pandas in the future.

Database of emission factors of volatile organic compound (VOC) species in motor vehicle exhaust in China.

The synergistic strategy for fine particulate matter (PM2.5) and O3 pollution prevention and control has emerged as a pivotal approach in combating air pollution. Volatile organic compounds (VOCs) serve as crucial precursors to both O3 and secondary organic aerosols (SOAs), with motor vehicles representing one of their significant sources. In this study, a standard for establishing a database of VOC species emission factors for motor vehicles was developed, and a database containing 134 VOC species was constructed through field tests and literature surveys. The VOC emissions of light-duty gasoline passenger vehicles (LDGPVs) comprised primarily alkanes and aromatics. The VOC emissions of light-duty diesel trucks (LDDTs) comprised mostly alkanes. Regarding low-speed trucks, 3-wheel vehicles, medium-duty diesel trucks (MDDTs) and heavy-duty diesel trucks (HDDTs), their VOC emissions comprised mainly oxygenated volatile organic compounds (OVOCs). The update of emission standards resulted in a reduction in VOC species emission factors while altering the composition of VOCs. Attention should be directed toward isopentane, benzene and dichloromethane emitted by LDGPVs, dodecane, undecane, ethene and propene emitted by LDDTs, and acetaldehyde emitted by HDDTs. VOC species originating from LDGPVs were more dispersed than those originating from LDDTs and HDDTs. In addition, variations in VOC species were observed among motor vehicles with different fuel types. Toluene, ethene, benzene, m,p-xylene, isopentane, hexanal, ethyne and 1,2,4-trimethylbenzene were the predominant VOC species emitted by gasoline vehicles. Diesel vehicles emitted mainly dodecane, formaldehyde, propene, undecane, acetaldehyde, ethene, decane and benzene. The results could enhance our comprehension of the emission characteristics of VOC species originating from motor vehicles and provide data support and a scientific foundation for achieving synergistic PM2.5 and O3 pollution prevention and control.

Proteomic screens of SEL1L-HRD1 ER-associated degradation substrates reveal its role in glycosylphosphatidylinositol-anchored protein biogenesis.

Endoplasmic reticulum-associated degradation (ERAD) plays indispensable roles in many physiological processes; however, the nature of endogenous substrates remains largely elusive. Here we report a proteomics strategy based on the intrinsic property of the SEL1L-HRD1 ERAD complex to identify endogenous ERAD substrates both in vitro and in vivo. Following stringent filtering using a machine learning algorithm, over 100 high-confidence potential substrates are identified in human HEK293T and mouse brown adipose tissue, among which ~88% are cell type-specific. One of the top shared hits is the catalytic subunit of the glycosylphosphatidylinositol (GPI)-transamidase complex, PIGK. Indeed, SEL1L-HRD1 ERAD attenuates the biogenesis of GPI-anchored proteins by specifically targeting PIGK for proteasomal degradation. Lastly, several PIGK disease variants in inherited GPI deficiency disorders are also SEL1L-HRD1 ERAD substrates. This study provides a platform and resources for future effort to identify proteome-wide endogenous substrates in vivo, and implicates SEL1L-HRD1 ERAD in many cellular processes including the biogenesis of GPI-anchored proteins.

MYC-Targeting Inhibitors Generated from a Stereodiversified Bicyclic Peptide Library.

Here, we present the second generation of our bicyclic peptide library (NTB), featuring a stereodiversified structure and a simplified construction strategy. We utilized a tandem ring-opening metathesis and ring-closing metathesis reaction (ROM-RCM) to cyclize the linear peptide library in a single step, representing the first reported instance of this reaction being applied to the preparation of macrocyclic peptides. Moreover, the resulting bicyclic peptide can be easily linearized for MS/MS sequencing with a one-step deallylation process. We employed this library to screen against the E363-R378 epitope of MYC and identified several MYC-targeting bicyclic peptides. Subsequent in vitro cell studies demonstrated that one candidate, NT-B2R, effectively suppressed MYC transcription activities and cell proliferation.

Associations between parental adherence to healthy lifestyles and cognitive performance in offspring: A prospective cohort study in China.

BACKGROUND: Previous studies have reported associations of specific maternal and paternal lifestyle factors with offspring's cognitive development during early childhood. This study aimed to investigate the prospective associations between overall parental lifestyle and offspring's cognitive performance during adolescence and young adulthood in China. METHODS: We included 2531 adolescents aged 10-15 years at baseline in 2010 from the China Family Panel Studies. A healthy parental lifestyle score (ranged 0-5) was constructed based on the following five modifiable lifestyle factors: Smoking, drinking, exercise, sleep, and diet. Generalized estimating equation models were used to examine the association between baseline parental healthy lifestyle scores and offspring's fluid and crystallized intelligence in subsequent years (2012, 2014, 2016, and 2018). RESULTS: Offspring in the top tertile of parental healthy lifestyle scores performed better in overall fluid intelligence (multivariable-adjusted ß = 0.53, 95% confidence interval [CI]: 0.29-0.77) and overall crystallized intelligence (multivariable-adjusted ß = 0.35, 95% CI: 0.16-0.54) than those in the bottom tertile of parental healthy lifestyle scores. The results were similar after further adjustment for the offspring's healthy lifestyle scores and persisted across the subgroups of parental socioeconomic status. Additionally, maternal and paternal healthy lifestyle scores were independently associated with better offspring's cognitive performance, with significant contribution observed for paternal never-smoking, weekly exercise, and diversified diet. When both parents and offspring adhered to a healthier lifestyle, we observed the highest level of the offspring's overall crystallized intelligence. CONCLUSIONS: Our study indicates that parental adherence to a healthier lifestyle is associated with significantly better offspring's cognitive performance during adolescence and early adulthood, regardless of socioeconomic status. These findings highlight the potential cognitive benefits of promoting healthy lifestyles among parents of adolescents.