Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

Food-Grade Expression of Two Laccases in Pichia pastoris and Study on Their Enzymatic Degradation Characteristics for Mycotoxins.

Mycotoxin contamination poses substantial health risks to humans and animals. In this study, the two laccases PpLac1 and AoLac2 from Pleurotus pulmonarius and Aspergillus oryzae were selected and heterologously expressed in Pichia pastoris in a food-grade manner to detoxify aflatoxin B1 (AFB1), zearalenone (ZEN), and deoxynivalenol (DON). Both laccases exhibited degradation activity toward these three mycotoxins, while the efficiency of these for DON was relatively low. Therefore, molecular docking between these laccases and DON was conducted to analyze their potential interaction mechanisms. Furthermore, the degradation conditions of AFB1 and ZEN by the two laccases were optimized, and the optimal degradation rates for AFB1 and ZEN by PpLac1 reached 78.51 and 78.90%, while those for AFB1 and ZEN by AoLac2 reached 72.27 and 80.60%, respectively. The laccases PpLac1 and AoLac2 successfully transformed AFB1 and ZEN into the compounds AFQ1 and 15-OH-ZEN, which were 90 and 98% less toxic than the original compounds, respectively. Moreover, the culture supernatants demonstrated effective mycotoxin degradation results for AFB1 and ZEN in contaminated feed samples. The residual levels of AFB1 and ZEN in all samples ranged from 6.61 to 8.72 µg/kg and 3.44 to 98.15 µg/kg, respectively, and these levels were below the limit set by the European Union standards. All of the results in this study indicated that the two laccases have excellent application potential in the feed industry.

Ratiometric Fluorescence Aptasensor of Allergen Protein Based on Multivalent Aptamer-Encoded DNA Flowers as Fluorescence Resonance Energy Transfer Platform.

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.

Highly Efficient Fabrication of Fluorescent "Turn-On" Lateral Flow Strips for Highly Sensitive Detection of Small Molecules Based on Self-Assembly of AuAg Nanoclusters.

Currently, fluorescent "turn-on" lateral flow assay (FONLFA) has shown enhanced "naked eye" detection sensitivity for small molecules, while it is urgent to adopt biocompatible fluorescent nanomaterials and needs new strategies to simplify the preparation process. In this study, a highly effective method was proposed to produce FONLFA strips for the detection of small molecules. The gold-silver nanoclusters (AuAgNCs) were immobilized onto the nitrocellulose membrane of the strips by the self-assembly of poly(sodium 4-styrenesulfonate), antigen, and AuAgNCs. The immobilization process entails a straightforward mixing of the three components, taking merely 1 min, thereby bypassing the necessity for chemical modification of fluorescent nanomaterials. The strategy offers a significantly simplified process, which substantially enhances the efficiency of the strip fabrication. Utilizing this method, a FONLFA was developed for carbendazim with a visual limit of detection (vLOD) reduced by 40-fold compared with the conventional colorimetric lateral flow assay (LFA). Furthermore, the approach demonstrates versatility by enabling the immobilization of AuAgNCs and streptavidin, which facilitates the development of aptamer-based FONLFAs. The designed aptamer-based FONLFA for kanamycin exhibited a 50-fold reduction in the vLOD compared with conventional colorimetric LFAs. Therefore, FONLFA holds promising potential for widespread applications in the analysis of small molecules.

A facile dual-mode SERS/fluorescence aptasensor for AFB1 detection based on gold nanoparticles and magnetic nanoparticles.

Aflatoxin B1 (AFB1) is a virulent metabolite secreted by Aspergillus fungi, impacting crop quality and posing health risks to human. Herein, a dual-mode Raman/fluorescence aptasensor was constructed to detect AFB1. The aptasensor was assembled by gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs), while the surface-enhanced Raman scattering (SERS) and fluorescence resonance energy transfer (FRET) effects were both realized. AuNPs were modified with the Raman signal molecule 4-MBA and the complementary chain of AFB1 aptamer (cDNA). MNPs were modified with the fluorescence signal molecule Cy5 and the AFB1 aptamer (AFB1 apt). Through base pairing, AuNPs aggregated on the surface of MNPs, forming a satellite-like nanocomposite, boosting SERS signal via increased "hot spots" but reducing fluorescence signal due to the proximity of AuNPs to Cy5. Upon exposure to AFB1, AFB1 apt specifically bound to AFB1, causing AuNPs detachment from MNPs, weakening the SERS signal while restoring the fluorescence signal. AFB1 concentration displayed a good linear relationship with SERS/fluorescence signal in the range of 0.01 ng/mL-100 ng/mL, with a detection limit as low as 5.81 pg/mL. The use of aptamer assured the high selectivity toward AFB1. Furthermore, the spiked recovery in peanut samples ranged from 91.4 % to 95.6 %, indicating the applicability of real sample detection. Compared to single-signal sensor, this dual-signal sensor exhibited enhanced accuracy, robust anti-interference capability, and increased flexibility, promising for toxin detection in food safety applications.

Cuticle properties, wax composition, and crystal morphology of Hami melon cultivars (Cucumis melo L.) with differential resistance to fruit softening.

Cuticle wax chemicals are cultivar-dependent and contribute to storage quality. Few research reported on wax analysis between melting flesh-type (MF; 'Jinhuami 25') and nonmelting flesh-type (NMF; 'Xizhoumi 17' and 'Chougua') Hami melons. Chemicals and crystal structures of Hami melon cuticular wax, cell wall metabolism related to fruit melting, and fruit physiology were analyzed to observe wax functions. Results showed that Hami melon cuticle wax predominantly consists of esters, alkanes, alcohols, aldehydes, and terpenoids. MF-type has a lower alkane/terpenoid ratio, concomitant to its higher weight loss and cuticle permeability. Micromorphology of wax crystals appears as numerous platelets with irregular crystals, and the transformation of wax structure in NMF Hami melon is delayed. Waxy components affect cell wall metabolism and physiological quality, which results in the pulp texture difference between MF-type and NMF-type during storage. Results provide a reference for the regulation of wax synthesis in both types of melons.

Spatiotemporal ATF3 Expression Determines VSMC Fate in Abdominal Aortic Aneurysm.

BACKGROUND: Abdominal aortic aneurysm (AAA) is a catastrophic disease with little effective therapy, likely due to the limited understanding of the mechanisms underlying AAA development and progression. ATF3 (activating transcription factor 3) has been increasingly recognized as a key regulator of cardiovascular diseases. However, the role of ATF3 in AAA development and progression remains elusive. METHODS: Genome-wide RNA sequencing analysis was performed on the aorta isolated from saline or Ang II (angiotensin II)-induced AAA mice, and ATF3 was identified as the potential key gene for AAA development. To examine the role of ATF3 in AAA development, vascular smooth muscle cell-specific ATF3 knockdown or overexpressed mice by recombinant adeno-associated virus serotype 9 vectors carrying ATF3, or shRNA-ATF3 with SM22α (smooth muscle protein 22-α) promoter were used in Ang II-induced AAA mice. In human and murine vascular smooth muscle cells, gain or loss of function experiments were performed to investigate the role of ATF3 in vascular smooth muscle cell proliferation and apoptosis. RESULTS: In both Ang II-induced AAA mice and patients with AAA, the expression of ATF3 was reduced in aneurysm tissues but increased in aortic lesion tissues. The deficiency of ATF3 in vascular smooth muscle cell promoted AAA formation in Ang II-induced AAA mice. PDGFRB (platelet-derived growth factor receptor ß) was identified as the target of ATF3, which mediated vascular smooth muscle cell proliferation in response to TNF-alpha (tumor necrosis factor-α) at the early stage of AAA. ATF3 suppressed the mitochondria-dependent apoptosis at the advanced stage by upregulating its direct target BCL2. Our chromatin immunoprecipitation results also demonstrated that the recruitment of NFκB1 and P300/BAF/H3K27ac complex to the ATF3 promoter induces ATF3 transcription via enhancer activation. NFKB1 inhibitor (andrographolide) inhibits the expression of ATF3 by blocking the recruiters NFKB1 and ATF3-enhancer to the ATF3-promoter region, ultimately leading to AAA development. CONCLUSIONS: Our results demonstrate a previously unrecognized role of ATF3 in AAA development and progression, and ATF3 may serve as a novel therapeutic and prognostic marker for AAA.

Sensitive colorimetric and fluorescence dual-mode detection of thiophanate-methyl based on spherical Fe3O4/GONRs composite nanozyme.

Pesticide detection based on nanozyme is largely limited in terms of the variety of pesticides. Herein, a spherical and well-dispersed Fe3O4/graphene oxide nanoribbons (Fe3O4/GONRs) composite nanozyme was applied to firstly develop an enzyme-free and sensitive colorimetric and fluorescence dual-mode detection of thiophanate-methyl (TM). The synthesized Fe3O4/GONRs possess excellent dual enzyme-like activities (peroxidase and catalase) and can catalyze H2O2 to oxidize 3,3',5,5'-tetramethylbenzidine (TMB) into oxidized TMB (oxTMB). We found that Fe3O4/GONRs can adsorb TM through the synergistic effect of multiple forces, thereby inhibiting the catalytic activities of nanozyme. This inhibition can modulate the transformation of TMB to oxTMB, producing dual responses of absorbance decrease (oxTMB) and fluorescence enhancement (TMB). The limits of detection (LODs) of TM were 28.1 ng/mL (colorimetric) and 8.81 ng/mL (fluorescence), respectively. Moreover, the developed method with the recoveries of 94.8-100.8% also exhibited a good potential application in the detection of pesticides residues in water and food samples.

A highly-sensitive electrochemical sensor based on Ni nanoparticles modified carbon nanotubes/sulfonated reduced graphene oxide for the detection of capsaicinoids in leisure sauced meat products.

Unclear labeling of spiciness degrees on leisure sauced meat products is prone to resulting in customer complaints and commercial disputes. The content of capsaicinoids is the basis for evaluating the spiciness of food. In this work, an electrochemical sensor based on nickel nanoparticles modified carbon nanotubes (Ni-CNTs) and sulfonated reduced graphene oxide (S-rGO) was developed for the rapid detection of capsaicinoids content in leisure sauced meat products. The linear ranges of capsaicins are 0.01-100 µmol/L with ultra-low detection limits of 1 nmol/L. The outstanding performances are primarily due to the synergistic effect between Ni-CNTs and S-rGO. This effect not only created a three-dimensional stacked structure that improved the electrochemically active surface area, but also generated an internal electric field that improved the charge transfer rate. This work provides a basis for standardized evaluation of spiciness.

Dual-mode aptasensor based on P-CeO2NR@Mxene and exonuclease I-assisted target recycling for malachite green detection.

Malachite green (MG) has been illicitly employed in aquaculture as a parasiticide, however, its teratogenic and carcinogenic effects pose a significant human health threat. Herein, a dual-mode colorimetric and electrochemical aptasensor was fabricated for MG detection, capitalizing on the robust catalytic and peroxidase-like activity of P-CeO2NR@Mxene and good capture efficiency of a tetrahedral DNA nanostructure (TDN) designed with multiple aptamers (m-TDN). P-CeO2NR@Mxene-modified complementary DNA (cDNA) served as both colorimetric and electrochemical probe. m-TDN was attached to AuE to capture MG and P-CeO2NR@Mxene/cDNA. The superior aptamer and MG binding to cDNA regulated signals and enabled precise MG quantification. The further introduced Exo I enabled aptamer hydrolysis, releasing MG for further binding rounds, allowing target recycling amplification. Under the optimal conditions, the aptasensor reached an impressively low detection limit 95.4 pM in colorimetric mode and 83.6 fM in electrochemical mode. We believe this dual-mode approach holds promise for veterinary drug residue detection.

Susceptibility of TSPAN5 polymorphisms to Kawasaki disease and immunoglobulin therapy resistance in southern Chinese children.

Kawasaki disease (KD) is a condition characterized by acute multi-system vasculitis and high fever in infants and children. Intravenous immunoglobulin (IVIG) is the established therapeutic approach of KD,foralleviating inflammation and mitigate the risk of arterial wall dilation and the development of coronary artery aneurysms (CAA). But almost 20% of the patients developed resistance to IVIG and displayed persistent fever after standard primary treatment. TSPAN5, belonging to the Tetraspanin family, has been demonstrated to modulate innate immunity in a range of human diseases. It accomplishes this by engaging with integrins and actively participating in the process of infection recognition. However, its relevance to susceptibility and IVIG therapy response of KD was unexposed. In the present study, our Integrative analysis of KD transcriptomic data and GTEx data revealed that the eQTL rs12504972 might modify the downregulation of TSPAN5 in KD patients. Moreover, our findings suggest a potential association between TSPAN5/rs12504972 and an elevated susceptibility as well as IVIG resistance among patients with Kawasaki disease in southern China. The results provided a new insight that TSPAN5 triggered KD susceptibility and resistance of IVIG therapy on the genomic level.

Fluorescent DNA-Silver nanoclusters in food safety detection: From synthesis to application.

In recent years, the conventional preparation of silver nanoclusters (AgNCs) has attracted much attention due to their ultra-small size, tunable fluorescence, easy-to-engineer, as well as biocompatible material. Moreover, its great affinity towards cytosine bases on single-stranded DNA has led to the construction of biosensors, especially aptamers, for a broad variety of applications in food safety and environmental protection. In past years, numerous researchers paid attention to the construction of AgNCs aptasensor. Therefore, this review will be an effort to summarize the synthetic strategy along with the influences of factors on synthesis, categorize the sensing mechanism of aptamer-functionalized AgNCs biosensors, as well as their specific applications in food safety detection including heavy metal, toxin, and foodborne pathogenic bacteria. Furthermore, a brief conclusion and outlook regarding the prospects and challenges of their applications in food safety were drawn in line with the developments in DNA-AgNCs.

Rational Design of a Robust G-Quadruplex Aptamer as an Inhibitor to Alleviate Listeria monocytogenes Infection.

Listeria monocytogenes (LM) is one of the most invasive foodborne pathogens that cause listeriosis, making it imperative to explore novel inhibiting strategies for alleviating its infection. The adhesion and invasion of LM within host cells are partly orchestrated by an invasin protein internalin A (InlA), which facilitates bacterial passage by interacting with the host cell E-cadherin (E-Cad). Hence, in this work, we proposed an aptamer blocking strategy by binding to the region on InlA that directly mediated E-Cad receptor engagement, thereby alleviating LM infection. An aptamer GA8 with a robust G-quadruplex (G4) structural feature was designed through truncation and base mutation from the original aptamer A8. The molecular docking and dynamics analysis showed that the InlA/aptamer GA8 binding interface was highly overlapping with the natural InlA/E-Cad binding interface, which confirmed that GA8 can tightly and stably bind InlA and block more distinct epitopes on InlA that involved the interaction with E-Cad. On the cellular level, it was confirmed that GA8 effectively blocked LM adhesion with an inhibition rate of 78%. Overall, the robust G4 aptamer-mediated design provides a new direction for the development of inhibitors against other wide-ranging and emerging pathogens.

Deep learning-assisted flavonoid-based fluorescent sensor array for the nondestructive detection of meat freshness.

Gas sensors containing indicators have been widely used in meat freshness testing. However, concerns about the toxicity of indicators have prevented their commercialization. Here, we prepared three fluorescent sensors by complexing each flavonoid (fisetin, puerarin, daidzein) with a flexible film, forming a fluorescent sensor array. The fluorescent sensor array was used as a freshness indication label for packaged meat. Then, the images of the indication labels on the packaged meat under different freshness levels were collected by smartphones. A deep convolutional neural network (DCNN) model was built using the collected indicator label images and freshness labels as the dataset. Finally, the model was used to detect the freshness of meat samples, and the overall accuracy of the prediction model was as high as 97.1%. Unlike the TVB-N measurement, this method provides a nondestructive, real-time measurement of meat freshness.

Covalent modification of γ-cyclodextrin with geraniol: An antibacterial agent with good thermal stability, solubility and biocompatibility.

Geraniol (Ger) is an essential oil molecule with excellent biological activity. High hydrophobicity and volatility limit its practical application. Cyclodextrins (CDs) are water-soluble cyclic oligosaccharides with hydrophobic cavities. Physical encapsulation of CDs to improve the solubility and stability of essential oil molecules is not satisfactory. Therefore, this study synthesized the γ-CD derivative (γ-CD-Ger) by grafting Ger onto γ-CD using a bromide-mediated method. Compared to the inclusion complexes (γ-CD/Ger) formed by both, the derivatives exhibit better solubility and thermal stability. The derivative has better antibacterial activity when the ratio of γ-CD to Ger was 1:2. In addition, the derivatives did not exhibit cytotoxic and hemolytic properties. These results indicate that this research provides a water-soluble antibacterial agent with a wide range of promising applications and offers new ideas for the application of alcohol hydrophobic molecules in aqueous systems.

Different dose aspirin plus immunoglobulin (DAPI) for prevention of coronary artery abnormalities in Kawasaki disease: Study protocol for a multi-center, prospective, randomized, open-label, blinded end-point, non-inferiority trial.

BACKGROUND: Kawasaki disease is a pediatric acute systemic vasculitis that specifically involves the coronary arteries. Timely initiation of immunoglobulin plus aspirin is necessary for diminishing the incidence of coronary artery abnormalities (CAAs). The optimal dose of aspirin, however, remains controversial. The trial aims to evaluate if low-dose aspirin is noninferior to moderate-dose in reducing the risk of CAAs during the initial treatment of Kawasaki disease. METHODS: This is a multi-center, prospective, randomized, open-label, blinded endpoint, noninferiority trial to be conducted in China. The planned study duration is from 2023 to 2026. Data will be analyzed according to intention-to-treat principles. Participants are children and adolescents under the age of 18 with Kawasaki disease, recruited from the inpatient units. A sample size of 1,346 participants will provide 80% power with a one-sided significance level of 0.025. Qualifying children will be randomized (1:1) to receive either intravenous immunoglobulin (2 g/kg) plus oral moderate-dose aspirin (30-50 mg·kg-1·d-1) until the patient is afebrile for at least 48 hours, or immunoglobulin plus low-dose aspirin (3-5 mg·kg-1·d-1) as initial treatment. The primary outcome will be the occurrence of CAAs at 8 weeks after immunoglobulin infusion. Independent blinded pediatric cardiologists will assess the primary endpoint using echocardiography. CONCLUSIONS: There is a shortage of consensus on the dose of aspirin therapy for Kawasaki disease due to the lack of evidence. The results of our randomized trial will provide more concrete evidence for the efficacy and adverse events of low- or moderate-dose aspirin in the acute phase of Kawasaki disease. TRIAL REGISTRATION: www.chictr.org.cn: ChiCTR2300072686.

A fluorescent nanoprobe and paper-based nanofiber platform for detection and imaging of Fe3+ in actual samples and living cells.

In this study, a novel fluorescent nanoprobe (ZIF-90@FSS) was constructed using a zeolite imidazolium ester skeleton (ZIF-90) incorporating sodium fluorescein within its porous structure. Notably, this nanoprobe exhibited regular fluorescence "off" detection performance of Fe3+ in actual samples and living cells. The concentration range of 0-150 ng/mL exhibited a lowest detection limit of 0.26 ng/mL. A nanofiber paper-based platform (VL78/ZIF-90@FSS) was further developed by coupling the prepared nanoprobe to a multi-dimensional fiber paper via CN bonds, enabling rapid visual white light colorimetric and fluorescence imaging of Fe3+ within 2 min. The constructed nanoprobe and its paper-based detection platforms demonstrated a stable recovery range in tap water, beer, and soy sauce samples during spiking-recovery assessments. The recovery rates ranged from 98.46 % to 108.24 % for the nanoprobe and from 91.75 % to 108.71 % for the nanofiber paper-based platform. Therefore, the developed nano-fluorescent sensor and paper-based nanofiber sensing platform offer a promising strategy for the visual detection of Fe3+, while also presenting novel and valuable methods to investigate the regulatory mechanisms of Fe3+ in living cells.