Review of emerging temporomandibular joint total joint replacement systems.

Total temporomandibular joint (TMJ) replacement has been documented as a viable option for the management of end-stage TMJ disease, but data on long-term outcomes have been reported for only two established systems: TMJ Concepts, and Zimmer Biomet. Other devices are now emerging globally, but reports of preclinical laboratory and clinical outcomes are limited. We retrieved information on the design, material composition, preclinical laboratory tests, regulatory status, and clinical outcomes of new TMJ replacement systems from PubMed and Google, and from personal correspondence with surgeons worldwide. Fifteen countries have developed, or are developing, 27 TMJ replacement systems, of which 21 are custom-designed, but to date, only four have been given regulatory approval. All the devices are designed to have both a skull-based glenoid fossa component and a mandibular ramus or condyle, and 22/27 are similar to the designs of the two established systems. Twenty-one devices use an ultra-high-molecular-weight polyethylene (UHMWPE) fossa-bearing surface, and 10 have a titanium alloy condyle. Nineteen manufacturers report that a titanium alloy is used for the ramus portion of the condyle/ramus component. Preclinical laboratory tests on 12 of the systems have been reported but, to our knowledge, no outcomes have yet been reported on nine of the 27 reviewed. Not all systems are equal in terms of design, material composition, preclinical laboratory testing, manufacturing methods, regulatory status, and reports of clinical outcomes.

Mapping the centers performing endocrine neck surgery in Italy.

BACKGROUND: Quality of care and provider's experience seem to be strictly connected in any field of surgery. Aim of this study is to identify a method to classify the centers on the basis of the number of thyroidectomies and parathyroidectomies performed. METHODS: We listed 666 centers performing endocrine neck surgery in 2015, from the database of the Italian Health Ministry. We performed a descriptive statistic analysis with a dedicated software. We identified the outliers, according to a previous literature review, in those centers performing >1000 and < 10 thyroidectomies, >100 and < 3 parathyroidectomies and we excluded them to our analysis. The remaining centers were grouped in a box-plot. Third quartile, median, procedures performed/3rd quartile value ratio (Standardized Hospitalization Ratio, SHR, superior cut-off), Romamedian/3rd quartile values ratio (inferior cut-off) were calculated. These centers were charted in a bar graph and three zones were identified: "excellence" (SHR>1.1), "SHR", "alert" (between the two cut-offs) and "risk" (under the lower cut-off). RESULTS: 35743 thyroidectomies and 2306 parathyroidectomies were performed in Italy in 2015. After the outliers' exclusion, 407 and 157 centers performing respectively thyroidectomies and parathyroidectomies were analysed. A median value of respectively 37 thyroidectomies and 6 parathyroidectomies, and a 3rd quartile cut-off of respectively 85 and 12 were calculated. Concerning all the 666 centers, we found: 95 excellence centers for thyroidectomy and 33 for parathyroidectomy, respectively 18 and 17 falling into superior cut-off line, 100 and 29 in the alert zone, 453 and 587 in the risk zone. CONCLUSIONS: Our method, according to the literature data, highlighted a number of thyroidectomies and parathyroidectomies performed in low volume centers. Looking for an optimization in health organization, we can consider some measures such as a net of tutorship of the "alert" hospitals by the excellence ones and a discouragement of the "risk" hospitals in performing endocrine neck surgery.

Surgeon volume and hospital volume in endocrine neck surgery: how many procedures are needed for reaching a safety level and acceptable costs? A systematic narrative review.

The relationship between quality of care and provider's experience is well known in all fields of surgery. Even in thyroidectomies and parathyroidectomies, the emphasis on positive volume-outcome relationships is believed. It led us to an evaluation of volume activity's impact in terms of quality of care. A systematic narrative review was performed. According to the PRISMA criteria, we selected 87 paper and, after the study selection was performed, 22 studies were finally included in this review. All articles included were unanimous in attributing to activity volume of surgeons as well as centers a substantial importance. Some differences in outcomes between these investigated categories have been found: best results of the high volume surgeon is evident expecially in terms of complications, on the contrary best outcomes of a high volume center are mainly economics, such as hospital stay and general costs of the procedures. A cut-off of 35-40 thyroidectomies per year for single surgeon, and 90-100 thyroidectomies for single center appears reasonable for identifying an adequate activity. Concerning parathyroidectomy, we can consider reasonable a cut off at 10-12 operations/year. More studies are needed in a European or more circumscribed perspective.

UK temporomandibular joint replacement database: a report on one-year outcomes.

Alloplastic temporomandibular joint (TMJ) replacements are increasingly subspecialised, and supraregional centres that treat sufficient numbers to ensure high standards are emerging. Having recently reported the introduction of a national TMJ joint replacement database that is endorsed by the British Association of TMJ Surgeons (BATS), we now present the first-year outcomes. This was a review of all data in the BATS National Case Registration of TMJ Replacement as of June 2014. A total of 252 one-year outcome records were available. Key outcomes were median (IQR) improvements in interincisal distance of 9 (4-15) mm (p<0.001) and worst-sided pain score of 6 (4-8) (p<0.001). Pain scores improved or remained static at one year in all but 3 (2%) patients. There was a significant improvement in the proportion of patients who reported a good, very good, or outstanding quality of life at one year (38% at baseline to 87% at one year; p<0.001). While outcome reports from single centres for alloplastic TMJ replacements have already been published in the United Kingdom, this is the first dedicated national database in this country that will yield valuable longitudinal follow-up data. Outcomes were comparable with smaller published series and showed improvements in pain, dietary intake, quality of life, and function, with few outliers. The database has recently moved to a new software system and we hope to publish three-year and five-year outcomes in due course.

The coexistence of primary hyperparathyroidism and thyroid nodules: should the preoperative work-up of the parathyroid and the thyroid diseases be specifically adjusted?

INTRODUCTION AND OBJECTIVES: Primary hyperparathyroidism (PHPT) can be found in concomitance with thyroid disease (TD) in a high frequency of cases. In this context the diagnostic exams for localizing the enlarged parathyroid(s) gland(s) could be less reliable or nonconclusive. Moreover, the thyroid carcinoma seems to be more frequent compared to that isolated thyroid desease and, therefore, carefully investigated. The main goal of the present study is to evaluate which diagnostic tool (US, MIBI) is more reliable for localizing the site of the PTH hypersecretion and to confirm if it is always advantageous a combination of both exams. Besides, we evaluated the incidence of thyroid carcinoma in our series of patients. PATIENTS AND METHODS: A review of available data of 73 patients who underwent total thyroidectomy + parathyroidectomy from 2003 and 2014 was performed. The preoperative workup included systematically US and MIBI whose results were considered true positive when at least the side (left/right) of the parathyroid affected were concordant with the surgical report, settled as the gold standard, according to the Cox nonnested model. The connection between the diagnostic results of US versus MIBI was calculated with the Cohen K index for evaluating their overlap. The average of the thyroid carcinoma were also calculated. RESULTS: The difference between respectively US versus surgical report (p value=0.73) and MIBI versus surgical report (p value=0.81) were not significant. The low Cohen K index showed that both US and MIBI are complementary. In 23 patients (32,9%) a thyroid carcinoma was found. CONCLUSIONS: The association of MIBI and neck US is mandatory in the first evaluation of patients undergoing thyroidectomy and parathyroid excision simultaneously. The high prevalence of thyroid carcinoma in this specific context suggests a more aggressive diagnostic and surgical behaviour.

Training in surgery of the temporomandibular joint: perceptions of trainees in oral and maxillofacial surgery in the United Kingdom.

Surgery of the temporomandibular joint (TMJ) is emerging as a subspecialty in its own right within Oral and Maxillofacial Surgery (OMFS). Recent guidelines on training and practice within this area have laid down standards of competence in certain procedures, and asked for evidence of "exposure" to others at the point of completion of higher training in OMFS. Provision of surgery of the TMJ is becoming more centralised within tertiary referral centres, with resulting disparity in opportunities for clinical experience in different training regions. We sought to gain a national perspective about this, and establish whether all trainees are truly equal when it comes to exposure to surgery of the TMJ during higher surgical training. An electronic survey was distributed to all members of an online Yahoo! group forum reserved for specialty trainees in OMFS. From those surveyed, 25 (48%) stated they had no experience of arthroscopy, while 19 (37%) and 38 (75%) reported no exposure to operations for alloplastic and autogenous replacement of the TMJ, respectively. A mode score of 1 out of 5 (44%, n=22) was returned when they were asked to rate the likelihood of considering TMJ surgery as a subspecialty. The current survey highlights variable exposure to operating on the TMJ across geographical divides within the UK, and little interest among trainees in pursuing the subspecialty as a career.

Comparison of minimally invasive parathyroidectomy under local anaesthesia and minimally invasive video-assisted parathyroidectomy for primary hyperparathyroidism: a cost analysis.

BACKGROUND: Primary hyperparathyroidism (PHPT) origins from a solitary adenoma in 70- 95% of cases. Moreover, the advances in methods for localizing an abnormal parathyroid gland made minimally invasive techniques more prominent. This study presents a micro-cost analysis of two parathyroidectomy techniques. PATIENTS AND METHODS: 72 consecutive patients who underwent minimally invasive parathyroidectomy, video-assisted (MIVAP, group A, 52 patients) or "open" under local anaesthesia (OMIP, group B, 20 patients) for PHPT were reviewed. Operating room, consumable, anaesthesia, maintenance costs, equipment depreciation and surgeons/anaesthesiologists fees were evaluated. The patient's satisfaction and the rate of conversion to conventional parathyroidectomy were investigated. T-Student's, Kolmogorov-Smirnov tests and Odds Ratio were used for statistical analysis. RESULTS: 1 patient of the group A and 2 of the group B were excluded from the cost analysis because of the conversion to the conventional technique. Concerning the remnant patients, the overall average costs were: for Operative Room, 1186,69 € for the MIVAP group (51 patients) and 836,11 € for the OMIP group (p<0,001); for the Team, 122,93 € (group A) and 90,02 € (group B) (p<0,001); the other operative costs were 1388,32 € (group A) and 928,23 € (group B) (p<0,001). The patient's satisfaction was very strongly in favour of the group B (Odds Ratio 20,5 with a 95% confidence interval). CONCLUSIONS: MIVAP is more expensive compared to the "open" parathyroidectomy under local anaesthesia due to the costs of general anaesthesia and the longer operative time. Moreover, the patients generally prefer the local anaesthesia. Nevertheless, the rate of conversion to the conventional parathyroidectomy was relevant in the group of the local anaesthesia compared to the MIVAP, since the latter allows a four-gland exploration.

Paliperidone palmitate long-acting injection--prospective year-long follow-up of use in clinical practice.

OBJECTIVE: To follow-up patients prescribed paliperidone palmitate long-acting injection (PP) over 1 year to determine factors predicting continuation with PP treatment. METHOD: Naturalistic observation of patients registered as starting PP in a single healthcare unit in London, UK. Monovariate and multivariate (Cox regression) analysis of factors predicting continuation at 1 year. RESULTS: Data were available for 210 patients consecutively prescribed PP of whom 10 were lost to follow-up. At 1 year, 65% of 200 patients (176 with a diagnosis of schizophrenia or schizoaffective disorder) started on PP were still receiving it. The main reason for discontinuation was perceived ineffectiveness (52% of discontinuers); only 10 subjects (5% of total) discontinued because of adverse effects. Initiation as an out-patient [hazard ratio (HR) 0.39, 95%CI, 0.20, 0.67, P = 0.001]; being switched from risperidone (HR 0.56, 95%CI 0.32, 0.94, P = 0.026) and correct initiation (HR 0.56, 95%CI 0.34, 0.93, P = 0.024) were significantly associated with a lower likelihood of discontinuation. CONCLUSION: Paliperidone palmitate was effective and well tolerated in this naturalistic cohort. Optimising treatment by targeting PP for patients identified as having lower risk of discontinuation can give rise to continuation rates approaching 80% at 1 year.

Isolated liver metastasis from sacral chordoma. Case report and review of the literature.

Chordoma is a rare malignant tumor derived from remnants of the primitive notochord. It can occur anywhere along the scull base and spine. The most commonly involved area is the sacrococcygeal region. Although chordomas invade adjacent structures, they metastasize less often. We present a case of a sacrococcygeal chordoma with liver metastasis. The nature and origin of the liver lesion was proved with fine-needle aspiration (FNA) under computed tomographic (CT) guidance.

New Avirulence Genes in the Phytopathogenic Fungus Leptosphaeria maculans.

ABSTRACT Leptosphaeria maculans, the causal agent of stem canker of oilseed rape (Brassica napus), develops gene-for-gene interactions with oilseed rape, and four L. maculans avirulence (AVR) genes (AvrLm1, AvrLm2, AvrLm4, and alm1) were previously genetically characterized. Based on the analysis of progeny of numerous in vitro crosses between L. maculans isolates showing either already characterized or new differential interactions, this work aims to provide an overview of the AVR genes that may specify incompatibility toward B. napus and the related species B. juncea and B. rapa. Two novel differential interactions were thus identified between L. maculans and B. napus genotypes, one of them corresponding to a complete resistance to European races of L. maculans. In both cases, a single gene control of avirulence was established (genes AvrLm3 and AvrLm7). Similarly, a single gene control of avirulence toward a B. rapa genotype, also resistant to European L. maculans isolates, was demonstrated (gene AvrLm8). Finally, a digenic control of avirulence toward B. juncea was established (genes AvrLm5 and AvrLm6). Linkage analyses demonstrated that at least four unlinked L. maculans genomic regions, including at least one AVR gene cluster (AvrLm1-AvrLm2-AvrLm6), are involved in host specificity. The AvrLm3-AvrLm4-AvrLm7 region may correspond either to a second AVR gene cluster or to a multiallelic AVR gene.

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Genetic Control and Host Range of Avirulence Toward Brassica napus Cultivars Quinta and Jet Neuf in Leptosphaeria maculans.

ABSTRACT Leptosphaeria maculans causes blackleg of oilseed rape. Gene-for-gene interactions between race PG3 and Brassica napus cv. Quinta were related to interaction between the fungal avirulence (Avr) gene AvrLm1 and the corresponding resistance gene Rlm1. AvrLm1 isolates were aviru-lent on cvs. Doublol, Vivol, Columbus, and Capitol, and no recombinant phenotypes were observed in the progeny of two AvrLm1 x avrLm1 crosses, suggesting that all of these cultivars may possess Rlm1 or genes displaying the same recognition spectrum, or that a cluster of Avr genes is present at the Avrlm1 locus. In one cross, segregation distortion was observed at the AvrLm1 locus that could be explained by interaction between AvrLm1 and one unlinked deleterious gene, termed Del1. Incompatibility toward cvs. Jet Neuf and Darmor.bzh was governed by a single gene, unlinked to AvrLm1 or Del1. This avirulence gene was termed AvrLm4. Preliminary plant genetic analysis suggested the occurrence of a corresponding dominant resistance gene, termed Rlm4, present in the Quinta line analyzed and linked to Rlm1.

Analysis of an optically controlled photonic switch.

The principle that the coupling of light between two fiber waveguides can be controlled by the resonant interference of a third waveguide has been developed [Attard, Appl. Opt. 37, 2296-2302 (1998)]. Here significant details concerning the operation of a photonic switch are obtained, and a more complete analysis is presented. Multiple-resonant conditions are identified for slab and fiber control waveguides at large indices of refraction. Thus a selection of materials with an appropriate refractive index and a Kerr coefficient is rendered more easily. Furthermore it is shown that the light used to control the index of refraction in the control waveguide does not enter the output of the photonic switch but remains confined to the control waveguide, for either a slab or a multimode fiber control waveguide. Spatial fluctuations of the control light beam in the control waveguide do not affect the operation of the photonic switch. Tolerances have been determined for the spacing between the control waveguide and the photonic coupler and also for the index of refraction of the control waveguide.

Modulation of coupling in a photonic switch by resonant interference.

A novel photonic switch structure is described in which the coupling of light between two fiber waveguides is controlled by the resonant interference of a third waveguide. The switching action is controlled by a small variation of the index of refraction of the control waveguide by the application of either photo-optical (Kerr) techniques or electro-optical (Pockels) techniques. The control waveguide can be either a fiber waveguide or a slab waveguide. The equations for the waveguide coupling were obtained by analytical approximations from coupled-mode theory. A beam-propagation simulation was also used. The results of the two models were compared. Multiple resonant interferences were observed in the case of a slab waveguide.

Model based calculation for effective cancer radioimmunotherapy.

The major problem of tumour radioimmunotherapy remains the low tumour antibody uptake and this leads to inadequate tumour irradiation. The antibody characteristics which influence uptake have been identified and quantified previously using a non-linear compartmental model that simulates antibody distribution to tumour and body after intravenous injection. The model has now been extended, in combination with MIRD dosimetry tables, to calculate the integral tumour/body radiation dose for a range of antibody masses (1, 10 and 50 mg), sizes (binding site fragments and whole molecules) and affinities (K = 10(9)-10(13) mol-1). Antibody requirements for delivering 60 Gy to the tumour over 11.6 days were calculated for 131I and 90Y-labelled antibodies and included the effect of widely varying dose rates. The model predicted that intact antibodies of high affinity (10(11)-10(13) mol-1) produced effective tumour radiation doses with acceptable whole body radiation levels. By contrast, antibody fragments gave higher body radiation levels and required larger injected activity because of renal excretion. The model predicted higher therapeutic indices for 90Y-labelled antibody compared with 131I.

Extended preservation of the liver with UW solution--is it justifiable?

The outcome of 228 liver grafts in 208 elective adult recipients was assessed to identify any adverse effects of extending the length of cold preservation with UW solution beyond 12 hr. A total of 114 grafts had been preserved < 12 hr--median 9.5 (group I) and 114 > 12 hr--median 14.5 (group II). Intraoperative blood and blood product usage, graft function, hospital stay, and graft and patient survival were identical in the two groups. Biliary strictures occurred in 5.7% of grafts (8 anastomotic (3 group I, 5 group II; 5 hilar/nonanastomotic: 3 group I, 2 group II). There was no graft or patient loss due to the hilar strictures but 1 patient died following reconstruction of an anastomotic stricture (0.4%). It is concluded that extending the cold preservation to approximately 15 hr does not adversely affect outcome after liver transplantation.

Can effluent hyaluronic acid or creatine kinase predict sinusoidal injury severity after cold ischemia?

It is well recognized that current selection criteria used to assess liver grafts before implantation are inaccurate and correlate poorly with graft outcome. A bench or laboratory-based test that could indicate the extent of liver injury immediately before implantation would be a valuable adjunct to clinical assessment. Hyaluronic acid (HA) and creatine kinase (BB component; CK-BB) levels in the caval effluent after liver perfusion have been suggested as indicators of preservation injury. Our objective was to investigate the relevance of preserved liver effluent HA and CK-BB as a predictor of early graft function. Perfused liver effluent HA and CK-BB levels were measured. Graft function was measured in terms of peak serum aspartate transaminase and its level on day 5 postoperatively as well as peak bilirubin level and prothrombin time. The cold ischemia time (CIT) was recorded. Statistical comparisons were made among HA level, CK-BB level, CIT, and graft function parameters. The study was conducted at The Liver and Hepatobiliary Unit, Queen Elizabeth Hospital, Birmingham, United Kingdom. Fifty patients undergoing OLT were studied. HA level was measured in 50 patients and CK-BB level in 30 patients. The main outcome measures were graft function and graft outcome. The graft function data are grouped according to effluent HA levels above or below 400 micrograms/L. Thirteen patients (26%) had a level below 400 micrograms/L and the remaining 37 (74%) were above this threshold. There were no significant differences between the groups for these indicators of graft function. There was no difference between the 2 groups for CIT. The overall median HA level was 1212 micrograms/L (range 39-4000 micrograms/L). The median total CK activity in the perfusate was 302 IU/L (range 118-1155 IU/L). The proportion of CK-BB activity from this total was 146 IU/L (8-641 IU/L), or 48% of the total CK activity. In a multiple regression analysis with CK-BB activity as the dependent variable, there was no demonstrable numerical relationship to graft function. In a separate multiple regression analysis similar results were obtained for HA. We conclude that the level of HA or CK-BB levels should not be used in determining the suitability for implantation of a harvested hepatic allograft.

Reduction in incidence of glove perforation during laparotomy wound closure by 'no touch' technique.

Intact surgical gloves provide an efficient barrier against the HIV and Hepatitis B viruses but glove perforations are common, particularly during mass closure of laparotomy wounds. Attempts to develop gloves immune to perforation have failed. A series of 100 consecutive laparotomy wounds were randomised to mass closure by either the 'hand in' technique currently favoured by many surgeons, or a 'no touch' technique manipulating the wound edges with instruments only. The two groups were similar with regard to grade of surgeon and assistant, proportion of routine and emergency cases, and proportion of clean or dirty cases. The wound lengths in each group were similar, and the time taken to close the abdominal wall was similar in both groups. Although a similar number of perforated gloves occurred in each group while the operative procedure was being performed ('hand in', 9 of 50 vs 'no touch', 12 of 50; P = 0.62); a significantly reduced number of glove perforations occurred in the 'no touch' group during wound closure ('hand in', 16 of 50 vs 'no touch', 3 of 50, P = 0.0017). No touch closure of the abdominal wall may provide protection to surgeons against blood-borne viruses such as HIV and hepatitis B.