First Report of Stemphylium vesicarium Causing Onion Stemphylium Leaf Blight in Mauritius.

In August 2021, severe leaf blight symptoms were observed on onion (Allium cepa L. cvs Francia and Askari F1 hybrid) in commercial fields located in Mauritius, namely La Forêt (20°19'56.1"S57°30'04.9"E), St Aubin (20°29'47.0"S57°32'29.4"E) and Chapiron (20°20'46.8"S 57°29'12.8"E). Infected leaves displayed small circular to oblong yellow-pale-brown and spindle shaped lesions which later coalesced and formed necrotic areas with black sporulation. Three fields were selected from each region, and along a W-pattern across the fields a disease incidence ranging 53-93% and a severity of 9-28% were recorded. Ten symptomatic leaves were collected in each region and small pieces of infected tissue were surface disinfected using 1% NaOCl for 2 min, rinsed with sterile distilled water, air-dried, transferred to potato dextrose agar (PDA) and incubated for 7 days at 20°C under a 12-h light/dark cycle. Fungal cultures with uniform appearance forming multi-septated conidia typical of the genus Stemphylium (Simmons 1969) were consistently isolated. Monosporic colony of isolates SVCWLF24/3, SVSSA23/1 and SVCWLMC26/1 developed similar olivaceous green to light and dark grey mycelium with an average daily growth rate of 6.5 mm at 25°C in the dark. Conidiophores were straight, light brown with a distinct swollen apex on which olive brown to dark brown, oblong to ovoid, septate conidia formed with dimensions 16.2-44.7 × 8.0-22.9 µm (av. 29.5 x 14.7 µm; n = 50) typical of Stemphylium vesicarium (Wallr) E.G. Simmons 1969 (Woudenberg et al. 2017). Genomic DNA of the three isolates was extracted from fungal mycelium (Ranghoo and Hyde 2000).. The ITS, cmdA and gapdh genes of the isolates were amplified with primers ITS4/ITS5 (White et al. 1990), CALDF1/CALDR1 (Lawrence et al. 2013) and Gpd1/Gpd2 (Beerbee et al. 1999) and sequenced. Sequences were submitted to GenBank under accession numbers OR131271, ON620213, OR188702 (ITS), OR350623, OR350622, OR166368 (cmdA) and OR684516, OR684517, OR684518 (Gapdh). The BLAST search of the sequences showed 100% similarity with S. vesicarium strain CBS 155.24 under accession numbers KU850555 (ITS), KU850702 (Gapdh) and KU850845 (cmdA) (Woudenberg et al. 2017). Phylogenetic trees inferred from the ITS, cmdA and Gapdh concatenated datasets with the maximum-likelihood algorithm allowed clustering of the isolates within S. vesicarium clade, confirming the morphological identification. Pathogenicity tests were performed using all three isolates, cultured on PDA at 25°C in a 12-h dark/light cycle. Ten 60-day-old onion plants (cv. Francia) were spray inoculated each with 10 ml of conidial suspension (1 × 104/ml) of each isolate while 10 healthy plants sprayed with sterile distilled water served as control. They were incubated in a greenhouse at 25°C with a 12-h photoperiod and > 80% humidity. Necrotic circular lesions appeared on leaves after 7-10 days while control plants remained symptomless. Re-isolations made from symptomatic leaf tissues on PDA consistently yielded cultures with similar morphology as the original isolates, thus fulfilling Koch's postulates. This is the first report of S. vesicarium as the causal agent of leaf blight of onion in Mauritius. It is a re-emerging fungal disease (Hay et al. 2021) with a wide host range threatening local onion production. This finding will contribute to early detection of leaf blight, implementation of surveillance and integrated disease management in affected regions.

First report of Head blight of wheat caused by Fusarium vorosii in Serbia.

The cosmopolitan species Fusarium graminearum Schwabe directly reduces yield, as well as grain quality of cereals, due to its ability to synthesize mycotoxins. Previously it was considered to be one species occurring on all continents. However, phylogenetic analysis employing the GCPSR method (Genealogical Concordance Phylogenetic Species Recognition) revealed the existence of 15 phylogenetic species within what is now recognised as the Fusarium graminearum Species Complex (FGSC) (Sarver et al. 2011). During 1996-2008, a MRIZP collection of FGSC isolates was established and isolates originating from wheat (5), maize (3) and barely (2) were selected for further study. Morphological features including the appearance of colonies and macroconidia (average size 38.5-53.1 × 4.6-5.4 µm, No 50) of all 10 isolates on PDA were consistent with descriptions of F. graminearum (O'Donnell et al. 2004, Leslie and Summerell 2006). Total DNA was isolated from mycelium removed from 7-day old colonies of single-spore isolates grown on PDA using the DNeasy Plant Mini Kit (Qiagen, Hilden). Further identification was based on amplification and sequencing of elongation factor TEF-1α, histone H3 and ß-tubulin in both directions, with primers ef1/ef2, H3-1a/H3-1b and T1/T22, respectively (Jacobs et al. 2010). The sequences were deposited in NCBI under accession numbers MF974399 - MF974408 (TEF-1α), MG063783 - MG063792 (ß-tubulin) and MF999139 - MF999148 (histone H3). Sequence analysis was performed using BLAST while genetic similarity was calculated using MEGA 6.0 software. Isolate 1339 originating from wheat (collected at the locality of Kikinda in 2006), shared 100% nucleotide identity with TEF-1α (DQ459745), histone H3 (DQ459728) and ß-tubulin (DQ459643) of F. vorosii isolate NRRL37605 (Starkey et al. 2007). The remaining nine isolates were identified as F. graminearum as they shared 99% to 100% nucleotide similarity with F. graminearum NRRL 28439 (O'Donnell et al. 2004). Pathogenicity was tested using artificial inoculations of spikes during wheat flowering (Mesterhazy et al. 1999). Thirty classes were inoculated with each isolate, in three replicates. Inoculum was prepared from 7-day colonies on PDA, and 30 ml of a conidia suspension (1x105 conidia/ml) was used. Control plants were inoculated with sterile water. Three weeks after inoculation, typical Fusarium head blight symptoms were visible on inoculated plants, from which all 10 isolates were successfully reisolated. Control spikes remained symptomless. Disease severity was estimated on the 1-7 scale (Blandino et al. 2012). Average pathogenicity of the F. vorosii isolate 1339 was 1.9, and 2.4 -5.1 of F. graminearum isolates. Toxin production was determined using gas chromatography-tandem mass spectrometry. Kernels inoculated with the 10 isolates were ground and tested for the presence of deoxynivalenol (DON) and its acetyl derivatives 3ADON, 15ADON and NIV. F. vorosii isolate 1339 possessed the 15ADON chemotype, as well as eight F. graminearum isolates, while only one F. graminearum isolate was 3ADON chemotype. To date, F. vorosii has only been detected in Hungary on wheat (Toth et al. 2005) and Korea on barley, corn and rice (Lee et al. 2016). This is the first report of F. vorosii in Serbia, which is of great importance, because it indicates the spread of this toxigenic species. Further studies should be focused on determining the distribution, aggressiveness and toxicological profile of F. vorosii.

Detection of Four New Tomato Viruses in Serbia Using Post Hoc High-Throughput Sequencing Analysis of Samples From a Large-Scale Field Survey.

Tomato production worldwide is affected by numerous plant virus species. The early and accurate detection of viruses is a critical step for disease control. However, the simultaneous detection of the most known tomato viruses can be difficult because of the high number and diversity of tomato-infecting viruses. Here, we have identified four new viruses in Serbia by applying target-independent small RNA high-throughput sequencing (HTS). HTS was applied on pools of samples and separate samples, in total comprising 30 tomato samples that exhibited (severe) virus-like symptoms and were collected in Serbia during three annual surveys (2011 to 2013). These samples had previously tested negative for the presence of 16 tomato viruses using targeted detection methods. Three divergent complete genome sequences of Physostegia chlorotic mottled virus were obtained from different localities, indicating for the first time that this virus is widespread in Serbia and might represent an emergent viral pathogen of tomato. The tomato torrado virus was detected at one locality with devastating yield losses. The southern tomato virus was detected at two localities, and the spinach latent virus was detected at one locality. In addition, we detected the presence of one already-known virus in Serbia, the tomato spotted wilt orthotospovirus. All the HTS results were subsequently confirmed by targeted detection methods. In this study, the successful application of post hoc HTS testing of a limited number of pooled samples resulted in the discovery of new viruses. Thus, our results encourage the use of HTS in research and diagnostic laboratories, including laboratories that have limited resources to resolve disease etiology.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 µm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

First report of charcoal rot caused by Macrophomina phaseolina on potato tubers in Mauritius.

Charcoal rot, caused by Macrophomina phaseolina, is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato (Solanum tuberosum L.). In this crop, charcoal rot can reduce the marketable quality of tubers (Arora 2012) and cause yield losses up to 88% (Somani 2007). During a survey of a potato field of 'Spunta' cultivar in Goodlands, Mauritius (20°02'28.2"S 57°39'30.4"E) approximately 10% of tubers with grey pigmentation around the lenticels and small water-soaked spots with white dots were observed. These symptoms later advanced to dark brown to black patches on the skin surface, all conforming to typical symptoms of charcoal rot (Arora and Khurana 2004). Fragments of infected and adjacent healthy tissue were cut, thoroughly washed with tap water, surface sterilized for 30 s with 1% sodium hypochlorite (25% bleach), placed on chloramphenicol-amended Potato Dextrose Agar (PDA), and incubated for 5 days in the dark at 25±2oC. From all the inoculated plates, only fast-growing, dark brown, grey to black Macrophomina-like colonies grew and several mono-sclerotial isolates were obtained with uniform morphological features. Following staining with cotton lactophenol dye using the clean slide technique, the isolate 449G-19/M exhibiting typical characteristics of M. phaseolina (Arora and Dhurwe 2019) and forming flattened, globose, black sclerotia with an average diameter of 180 µm (n= 50), was selected and used for further characterization. Identification was confirmed by sequencing of the ITS region of rDNA. Total DNA was extracted directly from the mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions, while PCR amplification and sequencing were performed with primers ITS1-F (Gardes and Bruns 1993) and ITS-4 (White et al. 1990). The nucleotide sequence of the isolate 449G-19/M (Accession No. MW301138) shared 98.28 to 99.80% similarity with over 70 M. phaseolina isolates in GenBank (99.18% with isolate from Zea mays, Accession No. KF531825 (Phillips et al. 2013)). Pathogenicity was tested on 20 healthy tubers which were initially disinfected with 2% sodium hypochlorite for 1 min and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7-day-old cultures of the isolate 449G-19/M near each tuber. Similarly, 10 tubers inoculated with sterile PDA served as a negative control. The plants were maintained in greenhouse conditions, watered daily, and assessed for the presence of symptoms 8 weeks post emergence. All inoculated tubers exhibited charcoal rot on progeny tubers while control plants remained symptomless. Koch's postulates were fulfilled successfully and the fungus recovered from the inoculated plants. Although M. phaseolina was previously observed in Mauritius on groundnut resulting in pre-emergence rot and collar rot (Anonymous 1962), to our knowledge, this is the first report demonstrating charcoal rot on potato tubers caused by M. phaseolina in Mauritius. As the sclerotia can remain in the soil for long periods of time (Arora and Khurana 2004) and with prevailing conditions of global warming, charcoal rot may be a threat for potatoes and other local crops (Somani et al. 2013). This study will sensitize agricultural extension officers on this new disease and calls for routine surveillance to safeguard this crop.

Waitea circinata var. zeae Causing Root Rot of Cabbage and Oilseed Rape.

Cabbage, a widely used and popular vegetable, and oilseed rape, the second most valuable oilseed crop in the world, are two important species from the Brassicaceae family. Two geographically separated outbreaks of cabbage and oilseed rape root rot with estimated incidence of 15 and 20%, respectively, were recorded during 2017 in the Vojvodina region, Serbia. Twelve hyphal-tip isolates were obtained from symptomatic cabbage and oilseed rape plants and identified as Waitea circinata var. zeae based on morphological and molecular features. This indicates that W. circinata var. zeae has expanded its host range to the Brassicaceae family. Sequence analyses of internal transcribed spacer (ITS) and large subunit of the ribosomal DNA, RPB2, and ß-tubulin genes revealed the highest similarity with multiple W. circinata var. zeae. Neighbor-joining analyses of ITS sequences resulted in a phylogenetic tree with one well-defined branch of W. circinata var. zeae, with two separate groups. All Serbian isolates and the majority of isolates originating from natural infection of dicotyledonous plants grouped together in group I. Following artificial inoculation, W. circinata var. zeae isolates caused mild to medium root necrosis of seedlings of 2 monocotyledonous and 12 dicotyledonous plant species, implying a wider host range than was known for W. circinata var. zeae. Additionally, this is the first occurrence of W. circinata var. zeae on dicotyledonous host plants in Europe. Because cabbage and oilseed rape are important crops grown worldwide, the occurrence of this new soilborne pathogen with a broad host range imposes the necessity for changes in routine disease control practices, particularly crop rotation.

First report of powdery mildew of blackberry caused by Podosphaera aphanis in Serbia.

Blackberries (Rubus L. subgenus Rubus Watson) are popular, wild fruits with high content of antioxidants and thus with beneficial effect on the human health (Reyes-Carmona et al. 2005). In July 2019 and May 2020, plants with typical powdery mildew symptoms were collected in the blackberry cv. 'Triple crown' orchard (of 2 ha in size) in the vicinity of Pakovrace (Moravica District, Serbia). The symptoms observed in 2019 included mild chlorotic spots on both old and young leaves accompanied by the white powdery mildew colonies on the surface of the leaves, visible on both primorcanes and floricanes. In 2020, even more intensive symptoms occurred on fruit bearing shoots which were covered with dense white fungal growth. Heavily infected leaves turned necrotic along the edges, followed by defoliation. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and estimated to be over 90% while disease severity was estimated to be over 40%. Morphological characteristics were assessed using bright-field and phase-contrast microscopy (Jankovics et al. 2011) and revealed the presence of unbranched, erect conidiophores (N=50, 75 to 200 µm) with cylindrical foot-cell and up to five short cells. Conidia were unicellular, hyaline and ellipsoid-barrel-shaped (N=50, 22.5 to 35.5 × 12.5 to 15 µm) containing fibrosin bodies (in 3% KOH). All observed characteristics resembled to Podosphaera spp. (Braun and Takamatsu 2000). The presence of chasmothecia was not recorded. Further molecular identification was conducted using internal transcribed spacer (ITS) sequence analysis of two isolates, 420G-19 and 30G-20, sampled in 2019 and 2020, respectively. Total DNA was extracted directly from epiphytic mycelium on the leaves using DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolates 420G-19 (530 bp) and 30G-20 (530 bp) (Accession No. MN914995 and MT514661) shared 100% identity, while both shared 99.49 to 99.81% nt identity with 32 Podosphaera aphanis strawberry and raspberry isolates in the GenBank (the highest 99.81% with GU942455, Harvey and Xu 2010), confirming that powdery mildew of blackberry in Serbia is caused by P. aphanis. In order to fulfill Koch's postulates, 10 rooted, healthy blackberry plants cv. 'Triple crown' were dusted with conidia of isolate 30G-20 and incubated at 23°C under the high relative humidity in the glasshouse. Healthy blackberry plants incubated in the same conditions, served as negative control. The minute white fungal colonies sharing the same microscopic features with the original isolate were visible 7-8 days post inoculation on all inoculated plants. No fungal growth was observed in the negative control. Serbia is the fourth largest blackberry producer in the world (Strik et al. 2007) and the occurrence of P. aphanis causing powdery mildew as a new pathogen is of utmost importance. P. aphanis is described as strawberry and raspberry powdery mildew pathogen with a population expressing substantial genetic diversity (Harvey and Xu 2010). The molecular data on blackberry originating isolates of P. aphanis are missing. Our study showed that P. aphanis could be destructive for blackberry in Serbia, thus representing a threat for the production of this valuable crop.

First report of Black Scurf caused by Rhizoctonia solani AG-3 on potato tubers in Mauritius.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

First Report of Target Spot on Tomato Caused by Corynespora cassiicola in Mauritius.

Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 µm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.

Characterization of Gnomoniopsis idaeicola, the Causal Agent of Canker and Wilting of Blackberry in Serbia.

Blackberry cane diseases with the symptoms of necrosis, canker, and wilting are caused by several fungi worldwide. Surveys conducted from 2013 to 2016 in Serbia revealed the occurrence of Gnomoniopsis idaeicola, the causal agent of cane canker and wilting, which was found to be distributed in almost half of the surveyed orchards, in three blackberry cultivars, and with disease incidence of up to 80%. Wide distribution and high disease incidence suggest that G. idaeicola has been present in Serbia for some time. Out of 427 samples, a total of 65 G. idaeicola isolates were obtained (isolation rate of 34.19%). Reference isolates, originating from different localities, were conventionally and molecularly identified and characterized. G. idaeicola was detected in single and mixed infections with fungi from genera Paraconiothyrium, Colletotrichum, Diaporthe, Botryosphaeria, Botrytis, Septoria, Neofusicoccum, and Discostroma, and no diagnostically specific symptoms could be related directly to the G. idaeicola infection. In orchards solely infected with G. idaeicola, blackberry plant mortality was up to 40%, and yield loses were estimated at 50%. G. idaeicola isolates included in this study demonstrated intraspecies diversity in morphological, biological, pathogenic, and molecular features, which indicates that population in Serbia may be of different origin. This is the first record of a massive outbreak of G. idaeicola infection, illustrating its capability of harmful influence on blackberry production. This study represents the initial step in studying G. idaeicola as a new blackberry pathogen in Serbia, aiming at developing efficient control measures.

Monilinia spp. Causing Brown Rot of Stone Fruit in Serbia.

Brown rot is one of the most important pre- and postharvest fungal diseases of stone fruit worldwide. In Serbia, where production of stone fruit is economically important, Monilinia laxa and M. fructigena are widely distributed. In surveys from 2011 to 2013, 288 isolates of Monilinia spp. were collected from 131 localities in 16 districts and from six hosts in Serbia. Using multiplex polymerase chain reaction, phylogenetic analysis, and morphological characterization, three species of Monilinia were identified as the causal agents of brown rot of stone fruit: M. laxa (89% of isolates), M. fructigena (3%), and M. fructicola (8%). In 2011, M. fructicola was reported for the first time on stone fruit in Serbia, with only one isolate detected. More isolates of M. fructicola were detected in 2012 (2 isolates) and 2013 (20 isolates). The presence of M. fructicola, as well as its increased frequency of detection during the survey, may indicate a change in the population structure of these pathogens, which could have an important impact on brown rot disease management in Serbia.

In vitro and in vivo antifungal properties of cysteine proteinase inhibitor from green kiwifruit.

BACKGROUND: Higher plants possess several mechanisms of defense against plant pathogens. Proteins actively synthesized in response to those stresses are called defense-related proteins which, among others, include certain protease inhibitors. It is of particular relevance to investigate plant natural defense mechanisms for pathogen control which include cystatins-specific inhibitors of cysteine proteases. RESULTS: In this study, a cysteine proteinase inhibitor (CPI), 11 kDa in size, was purified from green kiwifruit to homogeneity. Immuno-tissue print results indicated that CPI is most abundant in the outer layer of pericarp, near the peel, and the inner most part of the pulp-sites where it could act as a natural barrier against pathogens entering the fruit. The purified protein (15 µmol L(-1)) showed antifungal activity against two phytopathogenic fungi (Alternaria radicina and Botrytis cinerea) by inhibiting fungal spore germination. In vivo, CPI (10 µmol L(-1)) was able to prevent artificial infection of apple and carrot with spore suspension of B. cinerea and A. radicina, respectively. It also exerted activity on both intracellular and fermentation fluid proteinases. CONCLUSION: Identification and characterization of plant defense molecules is the first step towards creation of improved methods for pathogen control based on naturally occurring molecules.

Elimination of TSWV from impatiens hawkerii Bull. and regeneration of virus-free plant

The possibility for obtaining virus free plants from Impatiens hawkerii Bull. shoots infected with Tomato spotted wilt virus (TSWV) through meristem-tip culture was examined. TSWV presence in I. hawkerii plants was detected by DAS-ELISA and RT-PCR and identification of the virus was confirmed by sequencing one of the chosen isolate (GenBank Accesion CQ132190). Meristem-tip explants (0.3-1.5 mm) from virus-infected shoots are cultured on MS media supplemented with different concentrations of the cytokinins, CPPU or TDZ (0.01-1.0 uM), respectively. Using this system, a large number of in vitro shoots could be produced from a single explant. Also, cytokinins showed a stimulatory effect on the length, fresh and dry weights of the newly formed shoots. Plant pigments content in I. hawkerii shoots increased significantly in the presence of cytokinins. Rooting of shoots was spontaneous on the same media. Rooted plantlets were transferred to soil where 97 percent successfully acclimatized. By DAS-ELISA and RT-PCR, 80 percent of the in vitro plantlets were shown to be a virus-free. Considering these, the present protocol seems to be an efficient method for in vitro generation of virus-free I. hawkerii plantlets by meristem tip cultures.

Peach Rusty Spot Is Caused by the Apple Powdery Mildew Fungus, Podosphaera leucotricha.

Peach rusty spot, an economically important disease of peach (Prunus persica var. persica), appears as necrotic spots on fruit. The etiology of the disease is still not well understood, although it has long been suspected that the causal agent is the apple powdery mildew pathogen, Podosphaera leucotricha. This work confirmed this hypothesis based on cross-inoculation experiments and analysis of rDNA internal transcribed spacer sequences polymerase chain reaction amplified from rusty spot and peach powdery mildew lesions. Cross-inoculations of apple and peach leaves with P. leucotricha and P. pannosa, the causal agent of peach powdery mildew, showed that (i) young peach fruit, up to 5 cm in diameter, developed symptoms typical of rusty spot following inoculation with P. leucotricha; (ii) leaves of 'Jonagold' apple seedlings developed powdery mildew infections when inoculated by touching young rusty spot lesions to their surfaces; (iii) P. leucotricha sporulated on young peach fruit up to 5 cm in diameter; and (iv) peach leaves and young shoots were not susceptible to P. leucotricha, whereas P. pannosa infected all the green parts of peach. A field experiment revealed that there was only a 2- to 3-week period of time during early peach fruit development when the epidermis was susceptible to P. leucotricha. An outcome of this study is that now a clear distinction can be made between the symptoms caused by P. pannosa and P. leucotricha on peach.

Phytophthora ramorum Occurrence in Ornamentals in Serbia.

In a survey to determine the presence of Phytophthora ramorum in Serbia, ornamentals from garden centers, nurseries, and private and public gardens, as well as imported plant material, were inspected. In total, 577 plant, soil, and potting media samples were tested using various detection methods: lateral flow diagnostic test, enzyme-linked immunosorbent assay, conventional polymerase chain reaction, and isolation, followed by identification based on growth characteristics in culture and morphological features. P. ramorum was not detected in any of the 162 soil or potting media tested by the baiting method. P. ramorum was detected in 12 Rhododendron samples from one private garden in Zemun (City of Belgrade District) exhibiting symptoms of leaf necrosis and blight and petiole necrosis, and in three samples of Pieris spp. from one garden center exhibiting symptoms of leaf necrosis. Eight Phytophthora isolates were obtained from the positive Rhododendron plants and three isolates from Pieris plants, and all were identified as P. ramorum on the basis of their uniform morphological and growth characteristics. P. ramorum conformation was also made by sequencing of the internal transcribed spacer regions for a single isolate taken from one infected rhododendron and one pieris plant. Serbian isolates were determined as A1 mating type, due to formation of a few typical sexual structures when crossed with the A2 mating type of P. cinnamomi and P. cryptogea. Pathogenicity test on nonwounded detached leaves of 19 popular ornamentals, as well as the most frequently imported ones, revealed that 10 host species were susceptible, including Robinia pseudoacacia, which is widely distributed in Serbia. During this study, Cotoneaster horizontalis and C. dammeri were determined to be new experimental hosts of P. ramorum. This article provides evidence of P. ramorum introduction into Serbia. Although P. ramorum has not been detected in Serbian production nurseries, its presence outdoors might cause severe damages on susceptible common urban plants in public green and natural ecosystems.

Incidence and Distribution of Iris yellow spot virus on Onion in Serbia.

In a survey to determine the presence and distribution of Iris yellow spot virus (IYSV) in greenhouse ornamentals and onion field crops in 14 districts of Serbia as well as on imported ornamental plants, 1,574 samples were collected and analyzed by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). IYSV was not detected in nearly 1,200 plant samples collected from 39 genera of ornamentals grown in greenhouses in Serbia or imported from other countries during 2005 to 2007. The virus was detected in samples from an onion seed crop in the Sirig locality (South Backa District) that showed symptoms resembling those caused by IYSV and in samples without IYSV-like symptoms from an onion bulb crop in the Obrenovac locality (City of Belgrade District). Mechanical transmission of IYSV isolates was difficult, and only the isolate 605-SRB could infect four plant species, but not in all replications. No virus transmission could be demonstrated in 5,000 tested seeds originating from IYSV-infected onion crops. For further confirmation of IYSV, the nucleotide sequence of its nucleocapsid (NC) gene was obtained by reverse transcription-polymerase chain reaction (RT-PCR) in symptomatic onion samples as well as in symptomless leaves of Nicotiana benthamiana. Four previously developed primers were tested to determine their suitability for routine detection of Serbian IYSV isolates. Phylogenetic analysis showed clustering of isolates 605-SRB and 622-SRB from the onion seed crop and isolate 283-SRB from the onion bulb crop into two distant clades. The analysis indicated that Serbian isolates of IYSV do not share a recent common ancestor and that they represent two distinct lineages of IYSV in Serbia. Considering that onion is one of the most important and traditionally grown vegetable crops in Serbia, IYSV represents a potentially devastating pathogen in this country.