Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 59
Filter
Add more filters











Publication year range
1.
Chem Sci ; 2024 Sep 06.
Article in English | MEDLINE | ID: mdl-39246339

ABSTRACT

[This corrects the article DOI: 10.1039/D4SC01448K.].

2.
Chem Sci ; 15(24): 9096-9103, 2024 Jun 19.
Article in English | MEDLINE | ID: mdl-38903237

ABSTRACT

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.

3.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 03 22.
Article in English | MEDLINE | ID: mdl-38271265

ABSTRACT

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Subject(s)
Coordination Complexes , Organometallic Compounds , Ruthenium , Organometallic Compounds/chemistry , DNA/chemistry , Oligonucleotides/chemistry , Coordination Complexes/chemistry , Temperature , Ruthenium/chemistry
4.
Inorg Chem ; 62(45): 18510-18523, 2023 Nov 13.
Article in English | MEDLINE | ID: mdl-37913550

ABSTRACT

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP)2phen]Cl2 and [Ru(dppz)2phen](PF6)2 have also been obtained. It is well-known that compound [Ru(dppz)(phen)2]Cl2 binds to DNA by intercalation. Therefore, we used [Ru(dppz)2phen]Cl2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC50 in the micro- or even nanomolar range (0.06-7 µM). Confocal microscopy studies showed that [Ru(DIP)2phen]Cl2 and [Ru(DIP)2TAP]Cl2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn)2phen](PF6)2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn)2phen](PF6)2 stands out for its very good IC50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.


Subject(s)
Coordination Complexes , Photochemotherapy , Ruthenium , Coordination Complexes/chemistry , Ruthenium/pharmacology , Ruthenium/chemistry , Singlet Oxygen/metabolism , DNA , Ligands
5.
Phys Chem Chem Phys ; 25(34): 23316-23317, 2023 Aug 30.
Article in English | MEDLINE | ID: mdl-37594131

ABSTRACT

Correction for 'Time-resolved infra-red studies of photo-excited porphyrins in the presence of nucleic acids and in HeLa tumour cells: insights into binding site and electron transfer dynamics' by Páraic M. Keane et al., Phys. Chem. Chem. Phys., 2022, 24, 27524-27531, https://doi.org/10.1039/D2CP04604K.

6.
Phys Chem Chem Phys ; 24(44): 27524-27531, 2022 Nov 18.
Article in English | MEDLINE | ID: mdl-36345709

ABSTRACT

Cationic porphyrins based on the 5,10,15,20-meso-(tetrakis-4-N-methylpyridyl) core (TMPyP4) have been studied extensively over many years due to their strong interactions with a variety of nucleic acid structures, and their potential use as photodynamic therapeutic agents and telomerase inhibitors. In this paper, the interactions of metal-free TMPyP4 and Pt(II)TMPyP4 with guanine-containing nucleic acids are studied for the first time using time-resolved infrared spectroscopy (TRIR). In D2O solution (where the metal-free form exists as D2TMPyP4) both compounds yielded similar TRIR spectra (between 1450-1750 cm-1) following pulsed laser excitation in their Soret B-absorption bands. Density functional theory calculations reveal that vibrations centred on the methylpyridinium groups are responsible for the dominant feature at ca. 1640 cm-1. TRIR spectra of D2TMPyP4 or PtTMPyP4 in the presence of guanosine 5'-monophosphate (GMP), double-stranded {d(GC)5}2 or {d(CGCAAATTTGCG)}2 contain negative-going signals, 'bleaches', indicative of binding close to guanine. TRIR signals for D2TMPyP4 or PtTMPyP bound to the quadruplex-forming cMYC sequence {d(TAGGGAGGG)}2T indicate that binding occurs on the stacked guanines. For D2TMPyP4 bound to guanine-containing systems, the TRIR signal at ca. 1640 cm-1 decays on the picosecond timescale, consistent with electron transfer from guanine to the singlet excited state of D2TMPyP4, although IR marker bands for the reduced porphyrin/oxidised guanine were not observed. When PtTMPyP is incorporated into HeLa tumour cells, TRIR studies show protein binding with time-dependent ps/ns changes in the amide absorptions demonstrating TRIR's potential for studying light-activated molecular processes not only with nucleic acids in solution but also in biological cells.


Subject(s)
Nucleic Acids , Porphyrins , Electrons , Binding Sites , Guanine
7.
Nucleic Acids Res ; 50(22): 12636-12656, 2022 12 09.
Article in English | MEDLINE | ID: mdl-36382400

ABSTRACT

The four natural DNA bases (A, T, G and C) associate in base pairs (A=T and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases.


Subject(s)
DNA, B-Form , Ligands , Base Pairing , DNA/genetics , DNA/chemistry , Nucleic Acid Conformation , Molecular Targeted Therapy
8.
Chem Sci ; 13(35): 10193-10215, 2022 Sep 14.
Article in English | MEDLINE | ID: mdl-36277639

ABSTRACT

DNA is a strikingly flexible molecule and can form a variety of secondary structures, including the triple helix, which is the subject of this review. The DNA triplex may be formed naturally, during homologous recombination, or can be formed by the introduction of a synthetic triplex forming oligonucleotide (TFO) to a DNA duplex. As the TFO will bind to the duplex with sequence specificity, there is significant interest in developing TFOs with potential therapeutic applications, including using TFOs as a delivery mechanism for compounds able to modify or damage DNA. However, to combine triplexes with functionalised compounds, a full understanding of triplex structure and chemical modification strategies, which may increase triplex stability or in vivo degradation, is essential - these areas will be discussed in this review. Ruthenium polypyridyl complexes, which are able to photooxidise DNA and act as luminescent DNA probes, may serve as a suitable photophysical payload for a TFO system and the developments in this area in the context of DNA triplexes will also be reviewed.

9.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Article in English | MEDLINE | ID: mdl-35324198

ABSTRACT

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Subject(s)
G-Quadruplexes , Ruthenium , Circular Dichroism , DNA/chemistry , Humans , Ruthenium/chemistry , Telomere/metabolism
10.
Chem Commun (Camb) ; 56(67): 9703-9706, 2020 Aug 28.
Article in English | MEDLINE | ID: mdl-32699864

ABSTRACT

Ultrafast time resolved infrared (TRIR) is used to report on the binding site of the "light-switch" complex [Ru(phen)2(dppz)]2+1 to i-motif structures in solution. Detailed information is provided due to perturbation of the local base vibrations by a 'Stark-like' effect which is used to establish the contribution of thymine base loop interactions to the binding site of 1 in this increasingly relevant DNA structure.


Subject(s)
DNA/chemistry , Light , Organometallic Compounds/chemistry , Binding Sites , DNA/metabolism , Kinetics , Organometallic Compounds/metabolism , Spectroscopy, Fourier Transform Infrared , Thymine/chemistry
11.
Chemistry ; 26(71): 17103-17109, 2020 Dec 18.
Article in English | MEDLINE | ID: mdl-32725823

ABSTRACT

Ultrafast time-resolved infrared (TRIR) is used to report on the binding site of the [Ru(phen)2 (dppz)]2+ "light-switch" complex with both bimolecular (Oxytricha nova telomere) and intramolecular (human telomere) guanine-quadruplex structures in both K+ and Na+ containing solutions. TRIR permits the simultaneous monitoring both of the "dark" and "bright" states of the complex and of the quadruplex nucleobase bases, the latter via a Stark effect induced by the excited state of the complex. These data are used to establish the contribution of guanine base stacking and loop interactions to the binding site of this biologically relevant DNA structure in solution. A particularly striking observation is the strong thymine signal observed for the Na+ form of the human telomere sequence, which is expected to be in the anti-parallel conformation.

12.
Chem Sci ; 11(32): 8600-8609, 2020 Aug 06.
Article in English | MEDLINE | ID: mdl-34123120

ABSTRACT

Ruthenium polypyridyl complexes which can sensitise the photo-oxidation of nucleic acids and other biological molecules show potential for photo-therapeutic applications. In this article a combination of transient visible absorption (TrA) and time-resolved infra-red (TRIR) spectroscopy are used to compare the photo-oxidation of guanine by the enantiomers of [Ru(TAP)2(dppz)]2+ in both polymeric {poly(dG-dC), poly(dA-dT) and natural DNA} and small mixed-sequence duplex-forming oligodeoxynucleotides. The products of electron transfer are readily monitored by the appearance of a characteristic TRIR band centred at ca. 1700 cm-1 for the guanine radical cation and a band centered at ca. 515 nm in the TrA for the reduced ruthenium complex. It is found that efficient electron transfer requires that the complex be intercalated at a G-C base-pair containing site. Significantly, changes in the nucleobase vibrations of the TRIR spectra induced by the bound excited state before electron transfer takes place are used to identify preferred intercalation sites in mixed-sequence oligodeoxynucleotides and natural DNA. Interestingly, with natural DNA, while it is found that quenching is inefficient in the picosecond range, a slower electron transfer process occurs, which is not found with the mixed-sequence duplex-forming oligodeoxynucleotides studied.

13.
Front Chem ; 7: 744, 2019.
Article in English | MEDLINE | ID: mdl-31750292

ABSTRACT

A spectroscopic study of the interactions of Λ- and Δ-[Ru(phen)2(dppz)]2+ with i-motif DNA containing thymine loops of various lengths. In the presence of i-motifs, the luminescence of the Λ enantiomer was enhanced much more than the Δ. Despite this, the effect of each enantiomer on i-motif thermal stability was comparable. The sequences most affected by [Ru(phen)2(dppz)]2+ were those with long thymine loops; this suggests that long-looped i-motifs are attractive targets for potential transition metal complex drugs and should be explored further in drug design.

14.
Chem Commun (Camb) ; 55(62): 9116-9119, 2019 Jul 30.
Article in English | MEDLINE | ID: mdl-31298665

ABSTRACT

Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, the complex is not in contact with any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between T·T linkages, while the fourth shows sandwiching of a dppz ligand between a T·A/T·A quadruplex and a T·T mismatch, stabilised by an additional T·A base pair stacking interaction on a TAP surface. Overall, the structure shows an unexpected affinity for thymine, and suggests models for G-quadruplex loop binding.

15.
Angew Chem Int Ed Engl ; 58(29): 9881-9885, 2019 07 15.
Article in English | MEDLINE | ID: mdl-30958918

ABSTRACT

By using X-ray crystallography, we show that the complexes Λ/Δ-[Ru(TAP)2 (11-CN-dppz)]2+ (TAP=1,4,5,8-tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G-quadruplex in an enantiospecific manner that parallels the specificity of these complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5' end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2 (11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex-forming sequence, and use both structural models to provide insight into the motif-specific luminescence response of the isostructural phen analogue enantiomers.

16.
Inorg Chem ; 58(1): 663-671, 2019 Jan 07.
Article in English | MEDLINE | ID: mdl-30540448

ABSTRACT

[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene; dppz = dipyrido[3,2- a:2',3'- c]phenazine) is known to photo-oxidize guanine in DNA. Whether this oxidation proceeds by direct photoelectron transfer or by proton-coupled electron transfer is still unknown. To help distinguish between these mechanisms, spectro-electrochemical experiments have been carried out with [Ru(TAP)2(dppz)]2+ in acetonitrile. The UV-vis and mid-IR spectra obtained for the one-electron reduced product were compared to those obtained by picosecond transient absorption and time-resolved infrared experiments of [Ru(TAP)2(dppz)]2+ bound to guanine-containing DNA. An interesting feature of the singly reduced species is an electronic transition in the near-IR region (with λmax at 1970 and 2820 nm). Density functional and time-dependent density functional theory simulations of the vibrational and electronic spectra of [Ru(TAP)2(dppz)]2+, the reduced complex [Ru(TAP)2(dppz)]+, and four isomers of [Ru(TAP)(TAPH)(dppz)]2+ (a possible product of proton-coupled electron transfer) were performed. Significantly, these predict absorption bands at λ > 1900 nm (attributed to a ligand-to-metal charge-transfer transition) for [Ru(TAP)2(dppz)]+ but not for [Ru(TAP)(TAPH)(dppz)]2+. Both the UV-vis and mid-IR difference absorption spectra of the electrochemically generated singly reduced species [Ru(TAP)2(dppz)]+ agree well with the transient absorption and time-resolved infrared spectra previously determined for the transient species formed by photoexcitation of [Ru(TAP)2(dppz)]2+ intercalated in guanine-containing DNA. This suggests that the photochemical process in DNA proceeds by photoelectron transfer and not by a proton-coupled electron transfer process involving formation of [Ru(TAP)(TAPH)(dppz)]2+, as is proposed for the reaction with 5'-guanosine monophosphate. Additional infrared spectro-electrochemical measurements and density functional calculations have also been carried out on the free TAP ligand. These show that the TAP radical anion in acetonitrile also exhibits strong broad near-IR electronic absorption (λmax at 1750 and 2360 nm).


Subject(s)
Coordination Complexes/chemistry , DNA/chemistry , Intercalating Agents/chemistry , Oligonucleotides/chemistry , Coordination Complexes/radiation effects , Density Functional Theory , Electrochemical Techniques , Intercalating Agents/radiation effects , Ligands , Light , Models, Chemical , Oxidation-Reduction , Phenanthrenes/chemistry , Phenazines/chemistry , Ruthenium/chemistry
17.
Chemistry ; 24(59): 15859-15867, 2018 Oct 22.
Article in English | MEDLINE | ID: mdl-30063271

ABSTRACT

The new complexes [Ru(TAP)2 (11-CN-dppz)]2+ , [Ru(TAP)2 (11-Br-dppz)]2+ and [Ru(TAP)2 (11,12-diCN-dppz)]2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photo-oxidising complex [Ru(TAP)2 (dppz)]2+ promote π-stacking interactions and ordered binding to DNA, as shown by X-ray crystallography. The structure of Λ-[Ru(TAP)2 (11-CN-dppz)]2+ with the DNA duplex d(TCGGCGCCGA)2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11-Br and 11,12-dinitrile derivatives, highlighting the stabilization of syn guanine by this enantiomer when the terminal base pair is GC. In contrast the AT base pair has the normal Watson-Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz-purine interaction. The asymmetry of the cavity highlights the importance of the purine-dppz-purine stacking interaction.


Subject(s)
Coordination Complexes/chemistry , DNA/chemistry , Nitriles/chemistry , Ruthenium/chemistry , Base Pairing , Crystallography, X-Ray , Guanine/chemistry , Intercalating Agents/chemistry , Ligands , Models, Chemical , Molecular Structure , Purines/chemistry , Stereoisomerism , Structure-Activity Relationship , X-Rays
18.
Chem Sci ; 9(17): 4052-4061, 2018 May 07.
Article in English | MEDLINE | ID: mdl-29780534

ABSTRACT

Sequence-selective intercalation of pyrene into the chain-folds of a random, binary copolyimide under fast-exchange conditions results in the development of self-similar structure in the diimide region of the 1H NMR spectrum. The resulting spectrum can be described by the mathematics of fractals, an approach that is rationalised in terms of a dynamic summation of ring-current shielding effects produced by pyrene molecules intercalating into the chain at progressively greater distances from each "observed" diimide residue. The underlying set of all such summations is found to be a defined mathematical fractal namely the fourth-quarter Cantor set, within which the observed spectrum is embedded. The pattern of resonances predicted by a geometric construction of the fourth-quarter Cantor set agrees well with the observed spectrum.

19.
Chem Sci ; 8(7): 4705-4723, 2017 Jul 01.
Article in English | MEDLINE | ID: mdl-28936338

ABSTRACT

Recent research on the study of the interaction of ruthenium polypyridyl compounds and defined sequence nucleic acids is reviewed. Particular emphasis is paid to complexes [Ru(LL)2(Int)]2+ containing potentially intercalating ligands (Int) such as dipyridophenazine (dppz), which are known to display light-switching or photo-oxidising behaviour, depending on the nature of the ancillary ligands. X-ray crystallography has made a key contribution to our understanding, and the first complete survey of structural results is presented. These include sequence, enantiomeric, substituent and structural specificities. The use of ultrafast transient spectroscopic methods to probe the ultrafast processes for complexes such as [Ru(TAP)2(dppz)]2+ and [Ru(phen)2(dppz)]2+ when bound to mixed sequence oligonucleotides are reviewed with particular attention being paid to the complementary advantages of transient (visible) absorption and time-resolved (mid) infra-red techniques to probe spectral changes in the metal complex and in the nucleic acid. The observed photophysical properties are considered in light of the structural information obtained from X-ray crystallography. In solution, metal complexes can be expected to bind at more than one DNA step, so that a perfect correlation of the photophysical properties and factors such as the orientation or penetration of the ligand into the intercalation pocket should not be expected. This difficulty can be obviated by carrying out TRIR studies in the crystals. Dppz complexes also undergo insertion, especially with mismatched sequences. Future areas for study such as those involving non-canonical forms of DNA, such as G-quadruplexes or i-motifs are also briefly considered.

20.
Chemistry ; 23(43): 10344-10351, 2017 Aug 01.
Article in English | MEDLINE | ID: mdl-28543779

ABSTRACT

Key to the development of DNA-targeting phototherapeutic drugs is determining the interplay between the photoactivity of the drug and its binding preference for a target sequence. For the photo-oxidising lambda-[Ru(TAP)2 (dppz)]2+ (Λ-1) (dppz=dipyridophenazine) complex bound to either d{T1 C2 G3 G4 C5 G6 C7 C8 G9 A10 }2 (G9) or d{TCGGCGCCIA}2 (I9), the X-ray crystal structures show the dppz intercalated at the terminal T1 C2 ;G9 A10 step or T1 C2 ;I9 A10 step. Thus substitution of the G9 nucleobase by inosine does not affect intercalation in the solid state although with I9 the dppz is more deeply inserted. In solution it is found that the extent of guanine photo-oxidation, and the rate of back electron-transfer, as determined by pico- and nanosecond time-resolved infrared and transient visible absorption spectroscopy, is enhanced in I9, despite it containing the less oxidisable inosine. This is attributed to the nature of the binding in the minor groove due to the absence of an NH2 group. Similar behaviour and the same binding site in the crystal are found for d{TTGGCGCCAA}2 (A9). In solution, we propose that intercalation occurs at the C2 G3 ;C8 I9 or T2 G3 ;C8 A9 steps, respectively, with G3 the likely target for photo-oxidation. This demonstrates how changes in the minor groove (in this case removal of an NH2 group) can facilitate binding of RuII dppz complexes and hence influence any sensitised reactions occurring at these sites. No similar enhancement of photooxidation on binding to I9 is found for the delta enantiomer.


Subject(s)
Coordination Complexes/chemistry , DNA/chemistry , Inosine/chemistry , Oxidants, Photochemical/chemistry , Ruthenium/chemistry , Base Sequence , Binding Sites , Electron Transport , Guanine/chemistry , Intercalating Agents/chemistry , Models, Molecular , Molecular Structure , Oxidation-Reduction , Spectrophotometry, Ultraviolet/methods , Spectroscopy, Fourier Transform Infrared/methods , Stereoisomerism , Structure-Activity Relationship , Thermodynamics
SELECTION OF CITATIONS
SEARCH DETAIL